Name: Generation of Discriminative Human Monoclonal Antibodies from Rare Antigen-specific B Cells Circulating in Blood (Video) | JoVE Journal
Uploaded: 2018-02-06T14:00:00.000+00:00
Duration: 13 min 14 s
Description: Learn to generate fully human monoclonal antibodies from rare antigen-specific B cells circulating in human blood. This method enables precise discrimination between closely related antigens for immunotherapy applications.

ai_agent_IP

ai_agent

maintenance

instantTrialDurationMinutes

isBiopharma

enableNewMyJoveSectionDesign

educationFeatures

seoMetaApi

ai_copilot_institution_blacklist

ai_chat_institution_blacklist

freeAccessWindow

ssoRoleCapture

scheduledMaintenanceBanner

joveLabsFeatures

disable_autoplay_for_bots

extended_trial_duration

5 minutes

We thank the Cytometry Facility &#34;CytoCell&#34; (SFR Sant&#233;, Biogenouest, Nantes) for expert technical assistance. We thank also all the staff of recombinant protein production (P2R) and of IMPACT platforms (INSERM 1232, SFR Sant&#233;, Biogenouest, Nantes) for their technical support. We thank Emmanuel Scotet and Richard Breathnach for constructive comments on the manuscript. This work was financially supported by the IHU-Cesti project funded by the &#171; Investissements d&#39;Avenir &#187; French Government program, managed by the French National Research Agency (ANR) (ANR-10-IBHU-005). The IHU-Cesti project is also supported by Nantes M&#233;tropole and R&#233;gion Pays de la Loire. This work was realized in the context of the LabEX IGO program supported by the National Research Agency via the investment of the future program ANR-11-LABX-0016-01.

All human peripheral blood samples were obtained from anonymous adult donors after informed consent, in accordance with the local ethics committee (Etablissement Fran&#231;ais du Sang, EFS, Nantes, procedure PLER NTS-2016-08).
1. Isolation of Human Peripheral Blood Mononuclear Cells
NOTE: Starting material can be total human peripheral blood or cytapheresis samples. Samples should not be older than 8 h and supplemented with anticoagulants (e.g., heparin).
<ol>
	<li>Dilute blood with 2 volumes (human peripheral blood) or 5 volumes (cytapheresis sample) of RPMI (Roswell Park Memorial Institute) medium.</li>
	<li>Carefully layer 35 mL of diluted cell suspension onto 15 mL of density gradient medium in a 50-mL conical tube. Make as many tubes as necessary to distribute all the diluted blood. Centrifuge at 1,290 x g for 25 min at room temperature in a swinging-bucket rotor with brake off.</li>
	<li>Carefully aspirate the mononuclear cell layer at the interface between the density gradient medium and the plasma layer, and transfer the cells to a new 50 mL conical tube.</li>
	<li>Fill the tube with RPMI medium, mix and centrifuge at 1,290 x g for 10 min at room temperature. Carefully remove the supernatant.</li>
	<li>Resuspend the cell pellet in 20 mL of RPMI medium and centrifuge at 200 x g for 10 min to remove the platelets. Carefully remove the supernatant. Repeat this step once.</li>
	<li>Resuspend the cell pellet in RPMI medium with 10% Fetal Bovine Serum (FBS). 
	NOTE: Proceed directly to tetramer labeling or keep cells at 4 &#176;C overnight at a concentration of 107 cells/mL.</li>
</ol>
2. Tetramer-associated Magnetic Enrichment of Ag-specific B Cells
<ol>
	<li>Prepare Ag-tetramers by adding either PE or APC-labeled premium grade streptavidin or BV421-labeled streptavidin at a molar ratio of 1:4 to biotinylated antigen monomers. Add the appropriate amount of streptavidin-conjugate in three separate portions, adding one aliquot every 10 min at room temperature.</li>
	<li>Distribute cells (up to 3 x 108 per tube) in 15 mL conical tubes and centrifuge at 460 x g for 5 min. 
	NOTE: The following protocol is for one tube.</li>
	<li>Resuspend the cell pellet in 200 &#181;L of PBS (Phosphate Buffered Saline) with 2% FBS. Add PE-, APC-, and BV421-conjugated tetramers, each to a final concentration of 10 &#181;g/mL. Mix well and incubate for 30 min at room temperature.</li>
	<li>Prepare ice-cold cell separation buffer (SB) using PBS with 0.5% BSA (Bovine Serum Albumin) and EDTA (Ethylenediaminetetraacetic acid) 2 mM.</li>
	<li>Add 10 mL of SB. Pellet cells by centrifugation at 460 x g for 5 min.</li>
	<li>Resuspend cells in 500 &#181;L of ice-cold SB. Add 50 &#181;L of anti-PE and 50 &#181;L of anti-APC magnetic microbeads.</li>
	<li>Mix well and incubate for 20 min at 4 &#176;C.</li>
	<li>Repeat step 2.5 twice.</li>
	<li>Eliminate the supernatant carefully andresuspend the cell pellet at a concentration of 2 x 108 cells/mL in ice cold SB.</li>
	<li>Equilibrate a large magnetic column positioned on a magnet with 3 mL of SB.</li>
	<li>Transfer cell suspension from 2.9 onto the top of the equilibrated column and allow it to drain completely. CRITICAL STEP: To avoid clumping of the column, pass cells through a 70 &#181;m nylon mesh.</li>
	<li>Rinse the tube which contained the cells with 3 mL of ice cold SB and transfer the buffer directly onto the column (in case of filtration, rinse the 70 &#181;m nylon mesh).</li>
	<li>When the buffer has completely drained into the column, add another 3 mL of ice cold SB to the column.</li>
	<li>Repeat step 2.13 for another 3 mL wash.</li>
	<li>Remove the column from the magnet and place over a 15-mL conical collecting tube.</li>
	<li>Add 5 mL of ice cold SB onto the top of the column and immediately flush the cells out of the column using the plunger. Repeat this step once.</li>
	<li>Centrifuge the collected cells (enriched relevant tetramer positive cell fraction) at 460 x g for 5 min and proceed to additional antibody staining. 
	NOTE: Pool collected cells from all tubes, if appropriate.</li>
</ol>
3. Staining of Ag-specific Human B Cells and Cell Sorting
<ol>
	<li>Resuspend the cell pellet with a cocktail of anti-human antibodies against CD3 (final dilution: 1:20), CD19 (1:20), CD14 (1:50), CD16 (1:50), and 7AAD (1:1000) in a final volume of 100 &#181;L of PBS with 2% FBS. Incubate for 30 min at 4 &#176;C.</li>
	<li>Add 10 mL of PBS to cells, centrifuge at 460 x g for 5 min, and eliminate the supernatant. Repeat this step once. Resuspend the cell pellet in 200 &#181;L of PBS, filter onto 70 &#181;m nylon mesh.</li>
	<li>Proceed to sort specific B cells at the single cell level on a cell sorter cytometer with a 100 &#181;m-nozzle and a pressure of 20 psi without exceeding 1,000 events/s9. 
	NOTE: The gating strategy used is shown in Figure 1. Cells were first gated on CD14-CD16-7AAD- cells to exclude monocytes, NK, and dead cells (not shown in Figure 1). Then CD19+ B cells were selected before gating on double stained cells by PE and APC relevant Ag-tetramers. Non-specific B cells were excluded by gating on BV421 negative cells (unstained by irrelevant Ag-tetramer).</li>
	<li>Collect single B cells into 8-strip PCR tubes previously filled with 10 &#181;L of 1x&#160;PBS and 10 units of RNAse Inhibitor and placed on a rack for 96 microtubes.Immediately freeze the PCR tubes at -80 &#176;C. 
	NOTE: The sort masks chosen on the cytometer instrument are yield mask: 0, purity mask: 32, and phase mask: 0. This single-cell deposit could be adjusted to a 96- or 384-well PCR plate if needed. Single B cells must be frozen as quickly as possible and can be left at -80 &#176;C for several weeks, if needed.</li>
</ol>
4. Single Cell RT-PCR
<ol>
	<li>Lyse cells by directly heating the frozen samples in PCR strips at 70 &#176;C for 5 min in a dry bath.</li>
	<li>Transfer strips to ice and proceed to reverse transcription (RT) by adding 10 &#181;L per tube of a 2x&#160;master mix buffer containing 1 mM dNTP, 25 &#181;g/mL oligod(T) primers, 5 &#181;M random hexamers, 20 units of RNAse inhibitor, and 400 units of reverse transcriptase. 
	NOTE: After cell thawing, RT must be performed quickly to avoid RNA degradation.</li>
	<li>Incubate at 25 &#176;C for 5 min to allow random hexamers to hybridize, then incubate for 1 h at 50 &#176;C, and finish with an incubation at 95 &#176;C for 3 min to stop the reaction.</li>
	<li>Proceed with two rounds of nested PCR amplification for each of the regions encoding for variable heavy (vH) and kappa (vL&#954;) or lambda light chains (vL&#955;). 
	NOTE: Alternatively, RT samples can be frozen at -20 &#176;C and kept for one week.
	<ol>
		<li>For the first round of PCR, add 3 &#181;L of cDNA for a 40 &#181;L final volume containing 1.5 mM MgCl2, 0.25 mM dNTPs, 2.5 units of DNA Polymerase, and 200 nM of outer primers (see Figure 2 and Table of Materials for primer sequences). 
		NOTE: Composition of outer primers mix. For heavy chain amplification: 4 forward primers (5&#39;LVH mix) and 2 reverse primers (3&#39;C&#181;C&#947; mix). For light kappa chain amplification, 3 forward primers (5&#39;LV| mix) and 1 reverse primer (3&#39;C&#954;543-566). For light lambda chain amplification, 7 forward primers (5&#39;LVl mix) and 1 reverse primer (3&#39;Cl). 
		NOTE: Primers were designed by Tiller et al. for amplification of all the heavy and light chain family genes5.</li>
		<li>Apply the following cycling conditions: 94 &#176;C for 4 min, followed by 40 cycles of 30 s at 94 &#176;C, 30 s at 58 &#176;C for VH and VL&#954; (60 &#176;C for VL&#955;), and 55 s at 72 &#176;C, with a final elongation step at 72 &#176;C for 7 min.</li>
		<li>For the second round PCR, use 3 &#181;L of the first amplification product for a final volume of 40 &#181;L containing 1.5 mM MgCl2, 0.25 mM dNTPs, 2.5 units of DNA polymerase, and 200 nM of inner primers containing restriction enzyme sites for cloning into expression vectors (see Figure 2 and Table of Materials for primer sequences). 
		NOTE: Composition of inner primers mix. For heavy chain amplification: 9 forward primers (5&#39;AgeIVH mix) and 3 reverse primers (3&#39;SalIJH mix). For light kappa chain amplification, 9 forward primers (5&#39;AgeIV| mix) and 3 reverse primers (3&#39;BsiWIJ&#954; mix). For light lambda chain amplification, 6 forward primers (5&#39;AgeIVl mix) and 1 reverse primer (3&#39;XhoICl). 
		NOTE: Primers were designed by Tiller et al., for amplification of all of the heavy and light chain family genes5.</li>
		<li>Apply the following cycling conditions: 94 &#176;C for 4 min, followed by 40 cycles of 30 s at 94&#176;C, 30 s at 58 &#176;C for VH and LC&#954; (60 &#176;C for LC&#955;), and 45 s at 72 &#176;C with a final elongation step at 72 &#176;C for 7 min.</li>
	</ol>
	</li>
	<li>Identify positive wells by migrating 5 &#956;L of PCR products of vH, vL&#954; and vL&#955; on a 1.5% agarose gel (500 bp products for variable heavy chain encoding segments and a 350 bp product for variable light chain encoding segments).</li>
	<li>Purify the remaining 35 &#181;L PCR products remaining from positive wells using ultrafiltration membranes designed for purification of PCR products.</li>
	<li>Elute PCR products with 60 &#181;L of H2O.</li>
</ol>
5. Expression Cloning
<ol>
	<li>Prepare Inserts 
	NOTE: Digest 60 &#181;L of each purified PCR product in a final volume of 100 &#181;L containing the appropriate restriction enzyme buffer.
	<ol>
		<li>For vH PCR products, add 50 units of AgeI and 50 units of SalI, and incubate for 1 h at 37 &#176;C.</li>
		<li>For vL&#955; PCR products, add 50 units of AgeI and 50 units of XhoI, and incubate for 1 h at 37 &#176;C.</li>
		<li>For vL&#954; PCR products, add 50 units of AgeI and incubate for 1 h at 37 &#176;C. Purify digests using 96 PCR membranes and elute with 60 &#181;L of H2O. Digest the 60 &#181;L eluate in a final volume of 100 &#181;L of BsiWI restriction enzyme buffer, add 50 units of BsiWI, and incubate for 1 h at 55 &#176;C.</li>
		<li>Inactivate the enzymes by heating at 80 &#176;C for 15 min.</li>
	</ol>
	</li>
	<li>Preparation of Expressing Vectors 
	NOTE: vH PCR products are cloned in an expression vector (HC&#947;1) containing the constant heavy chain C&#947;1 of IgG1. vL&#954; PCR products are cloned in an expression vector (LC&#954;) containing the constant light chain C&#954;. vL&#955; PCR products are cloned in an expression vector (LC&#955;) containing the constant light chain C&#955;.
	<ol>
		<li>Perform the following digestions:
		<ol>
			<li>Mix 1 &#181;g of expression vector HC&#947;1 with 10 units of AgeI and 10 units of SalI endonucleases in a total volume of 20 &#181;L of restriction buffer recommended by the manufacturer, and incubate for 1 h at 37 &#176;C.</li>
			<li>Mix 1 &#181;g of expression vector LC&#954; with 10 units of AgeI restriction enzyme in a total volume of 20 &#181;L of restriction buffer recommended by the manufacturer, and incubate for 1 h at 37&#176;C. Add 10 units of BsiWI restriction enzyme, and incubate for 1 h at 55 &#176;C.</li>
			<li>Mix 1 &#181;g of expression vector LC&#955; with 10 units of AgeI and 10 units of XhoI endonucleases in a total volume of 20 &#181;L of restriction buffer recommended by the manufacturer, and incubate for 1 h at 37 &#176;C</li>
		</ol>
		</li>
		<li>Heat each digestion mixture at 65 &#176;C for 10 min to inactivate the restriction enzymes.</li>
		<li>Perform ligation of 5 &#181;L of digested PCR product with 2 &#181;L (100 ng) of corresponding linearized expression vector in a total volume of 20 &#181;L of 1x&#160;DNA ligase buffer with 1 unit of T4 DNA-Ligase by incubation overnight at 4 &#176;C. 
		NOTE: Alternatively, ligation is performed for 3 h at 4&#176;C.</li>
	</ol>
	</li>
	<li>Cloning
	<ol>
		<li>Electroporate 1 &#181;L of the 20 &#181;L ligation mixture into 45 &#181;L of homemade electrocompetent TOP10 E. coli (Current Protocols in Molecular Biology, section 1.8.4-1.8.8).Immediately add 500 &#181;L of 2X YT medium and incubate in a water bath at 37 &#176;C for 30 min. Spread transformed bacteria on 2x&#160;YT ampicillin plates. Incubate overnight at 37 &#176;C.</li>
		<li>For each transformation, screen eight colonies by PCR.
		<ol>
			<li>Set up a reaction premix as follows on ice: 45 &#181;L of 5x&#160;PCR Buffer, 12 &#181;L of MgCl2 (25 mM), 4 &#181;L of dNTPs (from a stock containing 10 mM of each), 10 &#181;L of forward primer (stock 10 &#181;M) hybridizing to the vector sequence (primer Ab-vec-sense), and 10 &#181;L of reverse primer (stock 10 &#181;M) targeting the constant heavy or light chain region (see Table of Materials for primer sequences). Make up to a final volume of 200 &#181;L with H2O. Then add 4 &#181;L of DNA polymerase enzyme (5 U/&#181;L).</li>
			<li>Distribute 25 &#181;L of reaction premix per 8-strip PCR tube on ice.</li>
			<li>Use a sterile toothpick to pick up individual colonies. Streak the toothpick onto a 2x TY ampicillin plate to constitute a replicate plate and then dip it into a PCR reaction tube.</li>
			<li>Perform the screening PCR under the following cycling conditions: 94 &#176;C for 10 min, followed by 25 cycles of 30 s at 94 &#176;C, 30 s at 55 &#176;C, and 50 s at 72 &#176;C.</li>
			<li>Identify positive bacteria by migrating 5 &#181;L of the PCR products on a 1.5% agarose gel. 
			NOTE: Positives colonies give a PCR product around 850 bp for the heavy chain vector and 600 bp&#160;for the light chain vector.</li>
		</ol>
		</li>
		<li>Inoculate four positive colonies from the replicate plate into 2 mL of LB medium and incubate overnight at 37 &#176;C with shaking at 200 rpm.</li>
		<li>Extract plasmids from liquid cultures using a plasmid purification kit, as indicated by the manufacturer.</li>
		<li>Verify correct insertion of variable domains by Sanger sequencing of the plasmids with the Ab-vec-sense primer. 
		NOTE: Plasmids with the correct insert (encoding the HC and the corresponding LC) are to be cotransfected into 293A cells for secretion. The specificity of small scale-produced mAbs is assayed by ELISA. Then, large scale production is performed if applicable.</li>
	</ol>
	</li>
</ol>
6. Production of mAbs
<ol>
	<li>Small scale production for specificity checking
	<ol>
		<li>The day before the transfection, seed 15,000 Human embryonic kidney 293A (HEK 293A) cells in 200 &#181;L of Dulbecco&#39;s Modified Eagle Medium (DMEM) supplemented with 10% FBS per well in 96-well plates. Incubate overnight in a CO2 incubator (5% CO2) at 37 &#176;C.</li>
		<li>Cotransfect 293A cells in DMEM medium containing 10% FBS using a linear polyethylenimine derivative as transfection reagent. 
		NOTE: Perform the transfection in triplicates. The following protocol is for one well of a flat bottom 96-well plate.
		<ol>
			<li>Dilute 0.5 &#181;L of DNA transfection reagent into 10 &#181;L of 150 mM NaCl. Dilute 0.125 &#181;g of vH and 0.125 &#181;g of vL expressing vectors into 10 &#181;L of 150 mM NaCl. Vortex each dilution for 10 s.</li>
			<li>Add 10 &#181;L diluted DNA transfection reagent into the 10 &#181;L DNA solution. Vortex 15 s and incubate for 15 min at room temperature. Add the 20 &#181;L mix drop-wise on 293A cells, and mix by gently swirling the plate.</li>
		</ol>
		</li>
		<li>Replace the medium 16 h after transfection and culture cells for 5 days in serum-free medium. 
		NOTE: Use serum-free medium to avoid serum Igs contaminating the produced antibodies.</li>
		<li>Eliminate cells and debris by centrifugation at 460 x g for 5 min.</li>
		<li>Harvest supernatants by aspiration with a multi-channel pipette and transfer them into a V-bottom 96-well plate.</li>
		<li>Coat relevant Ag overnight at 4 &#176;C in 100 &#181;L per well of reconstituted ELISA/ELISPOT coating buffer 1x&#160;at a final concentration of 2 &#181;g/mL in 96-well ELISA plates. See examples in 9.</li>
		<li>Block wells with 10% FBS DMEM medium for 2 h at 37 &#176;C</li>
		<li>Add 50 &#181;L of supernatants of transfected 293A cells from step 6.1.5, and incubate for 2 h at RT.</li>
		<li>Add 100 &#181;L of an anti-human IgG Ab conjugated to horseradish peroxidase (HRP) enzyme at 1 &#181;g/mL and incubate for 1 h at room temperature. Add 50 &#181;L chromogenic substrate (TMB), and incubate for 20 min.</li>
		<li>Read optical densities at 450 nm on a spectrophotometer. 
		NOTE: The specific mAbs revealed by ELISA assay can be further produced at large scale and purified on protein A column presenting affinity for human IgG.</li>
	</ol>
	</li>
	<li>Large scale production and purification of specific mAbs
	<ol>
		<li>The day before the transfection, seed 6 x 106 Human embryonic kidney 293A (HEK 293A) cells into 175 cm2 flasks containing 25 mL DMEM supplemented with 10% FBS. Incubate overnight in a CO2 incubator (5% CO2) at 37 &#176;C. 
		NOTE: Cells should be 70% confluent when transfected.</li>
		<li>Cotransfect 293A cells in DMEM medium containing 10% FBS using a linear polyethylenimine derivative as transfection reagent.
		<ol>
			<li>Dilute 50 &#181;L of DNA transfection reagent into 450 &#181;L of 150 mM NaCl. Dilute 10 &#181;g of vH and 10 &#181;g of vL expressing vectors into 500 &#181;L of 150 mM NaCl. Vortex 10 s each dilution.</li>
			<li>Add diluted DNA transfection reagent to the DNA solution. Vortex 15 s and incubate for 15 min at room temperature. Add the 1 mL mix drop-wise to the cells, and mix by gently swirling the flask.</li>
		</ol>
		</li>
		<li>Replace the medium 16 h after transfection and culture cells for 5 days in serum-free medium.</li>
		<li>Harvest medium by aspirating with a 25-mL pipette.</li>
		<li>Eliminate cells and debris by centrifugation at 460 x g for 5 min.</li>
		<li>Purify the antibodies using a 1 mL column coated with protein A on a fast protein liquid chromatography (FPLC) system at 4 &#176;C.
		<ol>
			<li>Equilibrate the protein A sepharose column with 20 mM phosphate buffer (pH 7).</li>
			<li>Filter the cell culture medium from 6.2.5 using a 1.22 &#181;m filter, then a 0.45 &#181;m filter.</li>
			<li>Load the filtered medium onto the column.</li>
			<li>Wash with 20 mM phosphate buffer (pH 7) and elute with a 0.1 M citrate buffer (pH 3.5).</li>
			<li>Read optical densities at 280 nm on an absorption spectrophotometer and immediately neutralize protein-containing fractions with 1 M Tris buffer (pH 9).</li>
		</ol>
		</li>
		<li>Dialyze purified Ab overnight at 4 &#176;C in a cassette with a 3.5K molecular weight cutoff against PBS buffer (pH 7.4).</li>
		<li>Sterilize by 0.2 &#181;m filtration and control purity by size-exclusion chromatography, as indicated by the manufacturer.</li>
	</ol>
	</li>
</ol>

<ol><li>Buss, N. A., Henderson, S. J., McFarlane, M., Shenton, J. M., de Haan, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Monoclonal+antibody+therapeutics%3A+history+and+future%5BTitle%5D)+AND+%22Curr+Opin+Pharmacol%22%5BJournal%5D)">Monoclonal antibody therapeutics: history and future.</a> Curr Opin Pharmacol. 12 (5), 615-622 (2012).</li>
<li>Park, J., Kwon, M., Shin, E. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Immune+checkpoint+inhibitors+for+cancer+treatment%5BTitle%5D)+AND+%22Arch+Pharm+Res%22%5BJournal%5D)">Immune checkpoint inhibitors for cancer treatment.</a> Arch Pharm Res. 39 (11), 1577-1587 (2016).</li>
<li>Pendley, C., Schantz, A., Wagner, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Immunogenicity+of+therapeutic+monoclonal+antibodies%5BTitle%5D)+AND+%22Curr+Opin+Mol+Ther%22%5BJournal%5D)">Immunogenicity of therapeutic monoclonal antibodies.</a> Curr Opin Mol Ther. 5 (2), 172-179 (2003).</li>
<li>Kwakkenbos, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Generation+of+stable+monoclonal+antibody-producing+B+cell+receptor-positive+human+memory+B+cells+by+genetic+programming%5BTitle%5D)+AND+%22Nat+Med%22%5BJournal%5D)">Generation of stable monoclonal antibody-producing B cell receptor-positive human memory B cells by genetic programming.</a> Nat Med. 16 (1), 123-128 (2010).</li>
<li>Tiller, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Efficient+generation+of+monoclonal+antibodies+from+single+human+B+cells+by+single+cell+RT-PCR+and+expression+vector+cloning%5BTitle%5D)+AND+%22J+Immunol+Methods%22%5BJournal%5D)">Efficient generation of monoclonal antibodies from single human B cells by single cell RT-PCR and expression vector cloning.</a> J Immunol Methods. 329 (1-2), 112-124 (2008).</li>
<li>Franz, B., May, K. F., Dranoff, G., Wucherpfennig, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Ex+vivo+characterization+and+isolation+of+rare+memory+B+cells+with+antigen+tetramers%5BTitle%5D)+AND+%22Blood%22%5BJournal%5D)">Ex vivo characterization and isolation of rare memory B cells with antigen tetramers.</a> Blood. 118 (2), 348-357 (2011).</li>
<li>Morris, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Isolation+of+a+human+anti-HIV+gp41+membrane+proximal+region+neutralizing+antibody+by+antigen-specific+single+B+cell+sorting%5BTitle%5D)+AND+%22PLoS+One%22%5BJournal%5D)">Isolation of a human anti-HIV gp41 membrane proximal region neutralizing antibody by antigen-specific single B cell sorting.</a> PLoS One. 6 (9), e23532(2011).</li>
<li>Iizuka, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Identification+of+cytomegalovirus+%28CMV%29pp65+antigen-specific+human+monoclonal+antibodies+using+single+B+cell-based+antibody+gene+cloning+from+melanoma+patients%5BTitle%5D)+AND+%22Immunol+Lett%22%5BJournal%5D)">Identification of cytomegalovirus (CMV)pp65 antigen-specific human monoclonal antibodies using single B cell-based antibody gene cloning from melanoma patients.</a> Immunol Lett. 135 (1-2), 64-73 (2011).</li>
<li>Ouisse, L. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Antigen-specific+single+B+cell+sorting+and+expression-cloning+from+immunoglobulin+humanized+rats%3A+a+rapid+and+versatile+method+for+the+generation+of+high+affinity+and+discriminative+human+monoclonal+antibodies%5BTitle%5D)+AND+%22BMC+Biotechnol%22%5BJournal%5D)">Antigen-specific single B cell sorting and expression-cloning from immunoglobulin humanized rats: a rapid and versatile method for the generation of high affinity and discriminative human monoclonal antibodies.</a> BMC Biotechnol. 17 (1), 3(2017).</li>
<li>Kerkman, P. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Identification+and+characterisation+of+citrullinated+antigen-specific+B+cells+in+peripheral+blood+of+patients+with+rheumatoid+arthritis%5BTitle%5D)+AND+%22Ann+Rheum+Dis%22%5BJournal%5D)">Identification and characterisation of citrullinated antigen-specific B cells in peripheral blood of patients with rheumatoid arthritis.</a> Ann Rheum Dis. , (2015).</li>
<li>Hamilton, J. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((General+Approach+for+Tetramer-Based+Identification+of+Autoantigen-Reactive+B+Cells%3A+Characterization+of+La-+and+snRNP-Reactive+B+Cells+in+Autoimmune+BXD2+Mice%5BTitle%5D)+AND+%22J+Immunol%22%5BJournal%5D)">General Approach for Tetramer-Based Identification of Autoantigen-Reactive B Cells: Characterization of La- and snRNP-Reactive B Cells in Autoimmune BXD2 Mice.</a> J Immunol. 194 (10), 5022-5034 (2015).</li>
<li>Sanjuan Nandin, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Novel+in+vitro+booster+vaccination+to+rapidly+generate+antigen-specific+human+monoclonal+antibodies%5BTitle%5D)+AND+%22J+Exp+Med%22%5BJournal%5D)">Novel in vitro booster vaccination to rapidly generate antigen-specific human monoclonal antibodies.</a> J Exp Med. , (2017).</li>
<li>Bowers, P. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Mammalian+cell+display+for+the+discovery+and+optimization+of+antibody+therapeutics%5BTitle%5D)+AND+%22Methods%22%5BJournal%5D)">Mammalian cell display for the discovery and optimization of antibody therapeutics.</a> Methods. 65 (1), 44-56 (2014).</li>
</ol>

The authors have nothing to disclose.

The proposed protocol is a powerful method for the generation of human mAbs directly from Ag-specific B cells circulating in the blood. It combines three important aspects: (i) the use of a tetramer-associated magnetic enrichment, which allows an ex vivo isolation of even rare Ag-binding B cells; (ii) a gating strategy that uses three Ag tetramers (two relevant ones and one irrelevant one) labelled with three different fluorochromes to isolate, by flow cytometry, only the B cells expressing a BCR specific for th...

An erratum was issued for: <a href="https://www.jove.com/video/56508/generation-discriminative-human-monoclonal-antibodies-from-rare">Generation of Discriminative Human Monoclonal Antibodies from Rare Antigen-specific B Cells Circulating in Blood</a>.
The Affiliations section was corrected from:
Marie-Claire Devilder1,2,&#160;M&#233;linda Moyon1,2,&#160;Xavier Saulquin1, Laetitia Gautreau-Rolland1 
1Centre R&#233;gional de Recherche en Canc&#233;rologie et Immunologie Nantes/Angers, INSERM 1232, LabEx IGO, Universit&#233; de Nantes 
2CHU Nantes
to:
Marie-Claire Devilder1,2,3,&#160;M&#233;linda Moyon1,2,3,&#160;Xavier Saulquin1,2, Laetitia Gautreau-Rolland1,2&#160; 
1CRCINA, Inserm, CNRS, Universit&#233; d&#39;Angers, Universit&#233; de Nantes 
2LabEx IGO, &#34;Immunotherapy, Graft, Oncology&#34; 
3CHU, Nantes, France

An erratum was issued for: <a href="https://www.jove.com/video/56508/generation-discriminative-human-monoclonal-antibodies-from-rare">Generation of Discriminative Human Monoclonal Antibodies from Rare Antigen-specific B Cells Circulating in Blood</a>

Erratum: Generation of Discriminative Human Monoclonal Antibodies from Rare Antigen-specific B Cells Circulating in Blood

The method described here allows the rapid and versatile production of fully human monoclonal antibodies (mAbs) against a desired antigen (Ag). mAbs are essential tools in many fundamental research applications in vitro and in vivo: flow cytometry, histology, western-blotting, and blocking experiments for example. Furthermore, mAbs are being used more and more in medicine to treat autoimmune diseases, cancer, and to control transplantation rejection1. For example, anti-CTLA-4 and anti-PD-1 (or anti-PD-L1) mAbs were recently used as immune checkpoint inhibitors in cancer treatments2.
The first mAbs were produced by immunoglobulin (Ig)-secreting hybridomas obtained from the splenic cells of immunized mice or rats. However, the strong immune response against murine or rat mAbs hampers their therapeutic use in humans, due to their rapid clearance and the probable induction of hypersensitivity reactions3. To tackle this problem, animal protein sequences of mAbs have been partially replaced by human ones to generate so-called chimeric mouse-human or humanized antibodies. However, this strategy only partially decreases immunogenicity, while substantially increasing both the cost and the time-scale of production. A better solution is to generate human mAbs directly from human B cells and several strategies for this are available. One of them is the use of phage or yeast display. This involves displaying variable domains from a combinatorial library of random human Ig heavy and light chains on phages or yeasts, and carrying out a selection step using the specific antigen of interest. A major drawback of this strategy is that heavy and light chains are randomly associated, leading to a very large increase in the diversity of generated antibodies. Antibodies obtained are unlikely to correspond to those that would arise from a natural immune response against a particular Ag. Moreover, human protein folding and post-translational modifications are not systematically reproduced in prokaryotes or even in yeasts. A second human mAb production method is the immortalization of natural human B cells, by Epstein-Barr virus infection or expression of the anti-apoptotic factors BCL-6 and BCL-XL4. However, this method is applicable only to memory B cells and is inefficient, requiring screening of numerous mAb-producing immortalized B cells to identify the few (if any) mAb clones with the desired antigenic specificity. The method is thus both costly and time consuming.
A new protocol has recently been described for production of human mAbs from isolated single B cells5. It relies on an optimized single-cell Reverse Transcription-Polymerase Chain Reaction (RT-PCR) for amplification of both the heavy- and light-chain encoding segments from a single sorted B cell. This is followed by the cloning and expression of these segments in a eukaryotic expression system, thus allowing reconstruction of a fully human mAb. This protocol has been used successfully starting from B cells from vaccinated donors. Cells were harvested several weeks after vaccination to obtain higher frequencies of B cells directed against the desired Ag, and thus limit the time required for screening6. Other fully human mAbs have also been produced from HIV+ (Human Immunodeficiency Virus) infected patients7 and melanoma patients8. Despite these advances, there is still no procedure available that enables the isolation of Ag-specific B cells independent of their memory phenotype or frequency.
The procedure described here leads to efficient ex vivo isolation of human circulating B cells based on their BCR specificity, followed by the production of fully human antigen-specific mAbs in high yield and with a low screening time. The method is not restricted to memory B cells or antibody-secreting B cells induced after an immune response, but can also be applied to the human na&#239;ve B cell repertoire. That it works even starting from Ag-specific B cells present at very low frequencies is a good indication of its efficiency. The principle of the method is as follows: Peripheral Blood Mononuclear Cells (PBMC) are stained with two tetramers presenting the antigen of interest, each labeled with a different fluorochrome (e.g., Phycoerythrin (PE) and Allophycocyanin (APC)), and a third tetramer presenting a closely related antigen conjugated with a third fluorochrome (e.g., Brillant Violet 421 (BV421)). To enrich for antigen-binding cells, cells are then incubated with beads coated with anti-PE and anti-APC Abs, and sorted in cell separation columns. The PE+ APC+ cell fraction is selected, stained with a variety of mAbs specific for different PBMC cell types to permit identification of B cells, and subjected to flow cytometry cell sorting. B cells which are PE+ and APC+, but Brilliant Violet-, are isolated. This step counter-selects cells which are not B cells or do not bind to the tetramerized antigen, but do bind to either PE or APC (these cells will be PE+ APC- or PE- APC+) or to the non-antigen part of the tetramers used (these cells will be BV421+). B cells not highly specific for the epitope of interest are also counter-selected at this step (these cells will also be BV421+). Thus, this method can purify highly specific B cells expressing B-cell Receptors (BCRs) able to discriminate between two very closely related antigens. Single specific B cells are collected in tubes and their PCR-amplified Ig cDNAs (complementary deoxyribonucleic acids) cloned and expressed by a human cell line as secreted IgG mAbs.
As a proof of concept, this study describes the efficient generation of human mAbs, which recognize a peptide presented by a major histocompatibility complex class I (MHC-I) molecule and can discriminate between this peptide and other peptides loaded on the same MHC-I allele. Although the level of complexity of this Ag is important, this method allows (i) high yield recovery of Ag-specific mAbs; (ii) production of mAbs able to discriminate between two structurally close Ags. This approach can be extended to vaccinated or infected patients without any protocol modification, and has also already been successfully implemented in a humanized rat system9. Thus, this study describes a versatile and efficient approach to generate fully human mAbs that can be used in basic research and immunotherapy.

<table><tbody><tr><td>HEK 293A cell line</td><td>Thermo Fisher scientific</td><td>R70507</td><td></td></tr><tr><td>DMEM (1X) Dulbecco&#039;s Modified Eagle Medium</td><td>Gibco by life technologies</td><td>21969-035</td><td>(+) 4,5g/L D-Glucose&lt;br/&gt; 0,11g/L Sodium Pyruvate&lt;br/&gt; (-) L-Glutmine</td></tr><tr><td>RPMI medium1640 (1X)</td><td>Gibco by life technologies</td><td>31870-025</td><td></td></tr><tr><td>Bovine Serum Albumine (BSA)</td><td>PAA</td><td>K45-001</td><td></td></tr><tr><td>Nutridoma-SP</td><td>Roche</td><td>11011375001</td><td>100X Conc</td></tr><tr><td>PBS-Phosphate Buffered Saline (10X) pH 7,4</td><td>Ambion</td><td>AM9624</td><td></td></tr><tr><td>EDTA (Ethylenediaminetetraacetic acid) 0,5M pH=8</td><td>Invitrogen by Life Technologies</td><td>15575-020</td><td></td></tr><tr><td>Fetal Bovine serum (FBS)</td><td>Dominique Dutscher</td><td>S1810-500</td><td></td></tr><tr><td>Ficoll - lymphocytes separation medium</td><td>EuroBio</td><td>CMSMSL01-01</td><td>density 1,0777+/-0,001</td></tr><tr><td>streptavidin R-phycoerythrin conjugate</td><td>Invitrogen by Life Technologies</td><td>S21388</td><td>premiun grade 1mg/ml contains 5mM sodium azide</td></tr><tr><td>Streptavidin, allophycocyanin conjugate</td><td>Invitrogen by thermoFisher scientific</td><td>S32362</td><td>1mg/ml&lt;br/&gt; 2mM azide premium grade</td></tr><tr><td>Brilliant violet 421 streptavidin</td><td>Biolegend</td><td>405225</td><td>conc : 0,5mg/ml</td></tr><tr><td>Anti-PE conjugated magnetic MicroBeads</td><td>Miltenyi Biotec</td><td>130-048-801</td><td></td></tr><tr><td>Anti-APC conjugated magnetic MicroBeads</td><td>Miltenyi Biotec</td><td>130-090-855</td><td></td></tr><tr><td>MidiMACs or QuadroMACS separotor</td><td>Miltenyi Biotec</td><td>130-042-302/130-090-976</td><td></td></tr><tr><td>LS Columns</td><td>Miltenyi Biotec</td><td>130-042-401</td><td></td></tr><tr><td>CD3 BV510 BD horizon</td><td>BD Pharmingen / BD Biosciences</td><td>563109</td><td>Used dilution 1:20</td></tr><tr><td>CD19 FITC</td><td>BD Pharmingen / BD Biosciences</td><td>345788</td><td>Used dilution 1:20</td></tr><tr><td>CD14 PerCPCy5.5</td><td>BD Pharmingen / BD Biosciences</td><td>561116</td><td>Used dilution 1:50</td></tr><tr><td>CD16 PerCPCy5.5</td><td>BD Pharmingen / BD Biosciences</td><td>338440</td><td>Used dilution 1:50</td></tr><tr><td>7AAD</td><td>BD Pharmingen / BD Biosciences</td><td>51-68981E (559925)</td><td>Used dilution 1:1000</td></tr><tr><td>FACS ARIA III Cell Sorter Cytometer</td><td>BD Biosciences</td><td></td><td></td></tr><tr><td>8-strip PCR tubes</td><td>Axygen</td><td>321-10-061</td><td></td></tr><tr><td>Racks for 96 microtubes</td><td>Dominique Dutscher</td><td>45476</td><td></td></tr><tr><td>RNAseOUT Ribonuclease Inhibitor (recombinant)</td><td>Invitrogen by thermoFisher scientific</td><td>10777-019</td><td>qty:5000U (40U/ul)</td></tr><tr><td>Distilled Water Dnase/Rnase Free</td><td>Gibco</td><td>10977-035</td><td></td></tr><tr><td>Oligod(T)18 mRNA Primer</td><td>New England BioLabs</td><td>S1316S</td><td>5.0 A260unit</td></tr><tr><td>Random hexamers</td><td>Invitrogen by thermoFisher scientific</td><td>N8080127</td><td>qty : 50uM, 5nmoles</td></tr><tr><td>Superscript III Reverse transcriptase</td><td>Invitrogen by thermoFisher scientific</td><td>18080-044</td><td>qty : 10000U (200U/ul)</td></tr><tr><td>GoTaq G2 Flexi DNA polymerase</td><td>Promega</td><td>M7805</td><td></td></tr><tr><td>dNTP Set, Molecular biology grade</td><td>Thermo Scientific</td><td>R0182</td><td>4*100umol</td></tr><tr><td>5LVH1</td><td>Eurofins</td><td>ACAGGTGCCCACT&lt;br/&gt; CCCAGGTGCAG</td><td>First round of PCR - Amplification of heavy chains - Outer primers - Forward Prmers</td></tr><tr><td>5LVH3</td><td>Eurofins</td><td>AAGGTGTCCAGTG&lt;br/&gt; TGARGTGCAG</td><td>First round of PCR - Amplification of heavy chains - Outer primers - Forward Prmers</td></tr><tr><td>5LVL4_6</td><td>Eurofins</td><td>CCCAGATGGGTCC&lt;br/&gt; TGTCCCAGGTGCAG</td><td>First round of PCR - Amplification of heavy chains - Outer primers - Forward Prmers</td></tr><tr><td>5LVH5</td><td>Eurofins</td><td>CAAGGAGTCTGTT&lt;br/&gt; CCGAGGTGCAG</td><td>First round of PCR - Amplification of heavy chains - Outer primers - Forward Prmers</td></tr><tr><td>3HuIgG_const_anti</td><td>Eurofins</td><td>TCTTGTCCACCTT&lt;br/&gt; GGTGTTGCT</td><td>First round of PCR - Amplification of heavy chains - Outer primers -Reverse primers for human Ig- Bacteria PCR screening</td></tr><tr><td>3CuCH1</td><td>Eurofins</td><td>GGGAATTCTCACA&lt;br/&gt; GGAGACGA</td><td>First round of PCR - Amplification of heavy chains - Outer primers -Reverse primers for human Ig</td></tr><tr><td>5AgeIVH1_5_7</td><td>Eurofins</td><td>CTGCAACCGGTGTACATTCC&lt;br/&gt; GAGGTGCAGCTGGTGCAG</td><td>Second round of PCR - Amplification of heavy chains - Inner primers -Forward primers</td></tr><tr><td>5AgeIVH3</td><td>Eurofins</td><td>CTGCAACCGGTGTACATTCT&lt;br/&gt; GAGGTGCAGCTGGTGGAG</td><td>Second round of PCR - Amplification of heavy chains - Inner primers -Forward primers</td></tr><tr><td>5AgeIVH3_23</td><td>Eurofins</td><td>CTGCAACCGGTGTACATTCT&lt;br/&gt; GAGGTGCAGCTGTTGGAG</td><td>Second round of PCR - Amplification of heavy chains - Inner primers -Forward primers</td></tr><tr><td>5AgeIVH4</td><td>Eurofins</td><td>CTGCAACCGGTGTACATTCC&lt;br/&gt; CAGGTGCAGCTGCAGGAG</td><td>Second round of PCR - Amplification of heavy chains - Inner primers -Forward primers</td></tr><tr><td>5AgeIVH4_34</td><td>Eurofins</td><td>CTGCAACCGGTGTACATTCC&lt;br/&gt; CAGGTGCAGCTACAGCAGTG</td><td>Second round of PCR - Amplification of heavy chains - Inner primers -Forward primers</td></tr><tr><td>5AgeIVH1_18</td><td>Eurofins</td><td>CTGCAACCGGTGTACATTCC&lt;br/&gt; CAGGTTCAGCTGGTGCAG</td><td>Second round of PCR - Amplification of heavy chains - Inner primers -Forward primers</td></tr><tr><td>5AgeIVH1_24</td><td>Eurofins</td><td>CTGCAACCGGTGTACATTCC&lt;br/&gt; CAGGTCCAGCTGGTACAG</td><td>Second round of PCR - Amplification of heavy chains - Inner primers -Forward primers</td></tr><tr><td>5AgeIVH3__9_30_33</td><td>Eurofins</td><td>CTGCAACCGGTGTACATTCT&lt;br/&gt; GAAGTGCAGCTGGTGGAG</td><td>Second round of PCR - Amplification of heavy chains - Inner primers -Forward primers</td></tr><tr><td>5AgeIVH6_1</td><td>Eurofins</td><td>CTGCAACCGGTGTACATTCC&lt;br/&gt; CAGGTACAGCTGCAGCAG</td><td>Second round of PCR - Amplification of heavy chains - Inner primers -Forward primers</td></tr><tr><td>3SalIJH1_2_4_5</td><td>Eurofins</td><td>TGCGAAGTCGACG&lt;br/&gt; CTGAGGAGACGGTGACCAG</td><td>Second round of PCR - Amplification of heavy chains - Inner primers -Reverse primers</td></tr><tr><td>3SalIJH3</td><td>Eurofins</td><td>TGCGAAGTCGACG&lt;br/&gt; CTGAAGAGACGGTGACCATTG</td><td>Second round of PCR - Amplification of heavy chains - Inner primers -Reverse primers</td></tr><tr><td>3SalIJH6</td><td>Eurofins</td><td>TGCGAAGTCGACG&lt;br/&gt; CTGAGGAGACGGTGACCGTG</td><td>Second round of PCR - Amplification of heavy chains - Inner primers -Reverse primers</td></tr><tr><td>5&#039;LVk1_2</td><td>Eurofins</td><td>ATGAGGSTCCCYG&lt;br/&gt; CTCAGCTGCTGG</td><td>First round of PCR - Amplification of light chains k - Outer primers -Forward primers</td></tr><tr><td>5&#039;LVk3</td><td>Eurofins</td><td>CTCTTCCTCCTGC&lt;br/&gt; TACTCTGGCTCCCAG</td><td>First round of PCR - Amplification of light chains k - Outer primers -Forward primers</td></tr><tr><td>5&#039;LVk4</td><td>Eurofins</td><td>ATTTCTCTGTTGC&lt;br/&gt; TCTGGATCTCTG</td><td>First round of PCR - Amplification of light chains k - Outer primers -Forward primers</td></tr><tr><td>3&#039;Ck543_566</td><td>Eurofins</td><td>GTTTCTCGTAGTC&lt;br/&gt; TGCTTTGCTCA</td><td>First round of PCR - Amplification of light chains k - Outer primers -Reverse primers- Bacteria PCR screening</td></tr><tr><td>5&#039;AgeIVk1</td><td>Eurofins</td><td>CTGCAACCGGTGTACATTCT&lt;br/&gt; GACATCCAGATGACCCAGTC</td><td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td></tr><tr><td>5&#039;AgeIVk1_9_1&amp;ndash;13</td><td>Eurofins</td><td>TTGTGCTGCAACCGGTGTAC&lt;br/&gt; ATTCAGACATCCAGTTGACCCAGTCT</td><td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td></tr><tr><td>5&#039;AgeIVk1D_43_1_8</td><td>Eurofins</td><td>CTGCAACCGGTGTACATTGT&lt;br/&gt; GCCATCCGGATGACCCAGTC</td><td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td></tr><tr><td>5&#039;AgeIVk2</td><td>Eurofins</td><td>CTGCAACCGGTGTACATGGG&lt;br/&gt; GATATTGTGATGACCCAGAC</td><td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td></tr><tr><td>5&#039;AgeIVk2_28_2_30</td><td>Eurofins</td><td>CTGCAACCGGTGTACATGGG&lt;br/&gt; GATATTGTGATGACTCAGTC</td><td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td></tr><tr><td>5&#039;AgeVk3_11_3D_11</td><td>Eurofins</td><td>TTGTGCTGCAACCGGTGTAC&lt;br/&gt; ATTCAGAAATTGTGTTGACACAGTC</td><td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td></tr><tr><td>5&#039;AgeVk3_15_3D_15</td><td>Eurofins</td><td>CTGCAACCGGTGTACATTCA&lt;br/&gt; GAAATAGTGATGACGCAGTC</td><td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td></tr><tr><td>5&#039;AgeVk3_20_3D_20</td><td>Eurofins</td><td>TTGTGCTGCAACCGGTGTAC&lt;br/&gt; ATTCAGAAATTGTGTTGACGCAGTCT</td><td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td></tr><tr><td>5&#039;AgeVk4_1</td><td>Eurofins</td><td>CTGCAACCGGTGTACATTCG&lt;br/&gt; GACATCGTGATGACCCAGTC</td><td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td></tr><tr><td>3&#039;BsiWIJk1_2_4</td><td>Eurofins</td><td>GCCACCGTACGTT&lt;br/&gt; TGATYTCCACCTTGGTC</td><td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td></tr><tr><td>3&#039;BsiWIJk3</td><td>Eurofins</td><td>GCCACCGTACGTT&lt;br/&gt; TGATATCCACTTTGGTC</td><td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td></tr><tr><td>3&#039;BsiWIJk5</td><td>Eurofins</td><td>GCCACCGTACGTT&lt;br/&gt; TAATCTCCAGTCGTGTC</td><td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td></tr><tr><td>5&#039;LVl1</td><td>Eurofins</td><td>GGTCCTGGGCCCA&lt;br/&gt; GTCTGTGCTG</td><td>First round of PCR - Amplification of light chains &amp;lambda; - Outer primers -Forward primers</td></tr><tr><td>5&#039;LVl2</td><td>Eurofins</td><td>GGTCCTGGGCCCA&lt;br/&gt; GTCTGCCCTG</td><td>First round of PCR - Amplification of light chains &amp;lambda; - Outer primers -Forward primers</td></tr><tr><td>5&#039;LVl3</td><td>Eurofins</td><td>GCTCTGTGACCTC&lt;br/&gt; CTATGAGCTG</td><td>First round of PCR - Amplification of light chains &amp;lambda; - Outer primers -Forward primers</td></tr><tr><td>5&#039;LVl4_5</td><td>Eurofins</td><td>GGTCTCTCTCSCA&lt;br/&gt; GCYTGTGCTG</td><td>First round of PCR - Amplification of light chains &amp;lambda; - Outer primers -Forward primers</td></tr><tr><td>5&#039;LVl6</td><td>Eurofins</td><td>GTTCTTGGGCCAA&lt;br/&gt; TTTTATGCTG</td><td>First round of PCR - Amplification of light chains &amp;lambda; - Outer primers -Forward primers</td></tr><tr><td>5&#039;LVl7</td><td>Eurofins</td><td>GGTCCAATTCYCA&lt;br/&gt; GGCTGTGGTG</td><td>First round of PCR - Amplification of light chains &amp;lambda; - Outer primers -Forward primers</td></tr><tr><td>5LVl8</td><td>Eurofins</td><td>GAGTGGATTCTCA&lt;br/&gt; GACTGTGGTG</td><td>First round of PCR - Amplification of light chains &amp;lambda; - Outer primers -Forward primers</td></tr><tr><td>3&#039;Cl</td><td>Eurofins</td><td>CACCAGTGTGGCC&lt;br/&gt; TTGTTGGCTTG</td><td>First round of PCR - Amplification of light chains &amp;lambda; - Outer primers -Forward primers</td></tr><tr><td>5&#039;AgeIVl1</td><td>Eurofins</td><td>CTGCTACCGGTTCCTGGGCC&lt;br/&gt; CAGTCTGTGCTGACKCAG</td><td>Second round of PCR - Amplification of light chains &amp;lambda; - Inner primers -forward primers</td></tr><tr><td>5&#039;AgeIVl2</td><td>Eurofins</td><td>CTGCTACCGGTTCCTGGGCC&lt;br/&gt; CAGTCTGCCCTGACTCAG</td><td>Second round of PCR - Amplification of light chains &amp;lambda; - Inner primers -forward primers</td></tr><tr><td>5&#039;AgeIVl3</td><td>Eurofins</td><td>CTGCTACCGGTTCTGTGACC&lt;br/&gt; TCCTATGAGCTGACWCAG</td><td>Second round of PCR - Amplification of light chains &amp;lambda; - Inner primers -forward primers</td></tr><tr><td>5&#039;AgeIVl4_5</td><td>Eurofins</td><td>CTGCTACCGGTTCTCTCTCS&lt;br/&gt; CAGCYTGTGCTGACTCA</td><td>Second round of PCR - Amplification of light chains &amp;lambda; - Inner primers -forward primers</td></tr><tr><td>5&#039;AgeIVl6</td><td>Eurofins</td><td>CTGCTACCGGTTCTTGGGCC&lt;br/&gt; AATTTTATGCTGACTCAG</td><td>Second round of PCR - Amplification of light chains &amp;lambda; - Inner primers -forward primers</td></tr><tr><td>5&#039;AgeIVl8</td><td>Eurofins</td><td>CTGCTACCGGTTCCAATTCY&lt;br/&gt; CAGRCTGTGGTGACYCAG</td><td>Second round of PCR - Amplification of light chains &amp;lambda; - Inner primers -forward primers</td></tr><tr><td>3&#039;XhoICl</td><td>Eurofins</td><td>CTCCTCACTCGAG&lt;br/&gt; GGYGGGAACAGAGTG</td><td>Second round of PCR - Amplification of light chains &amp;lambda; - Inner primers -Reverse primers - Bacteria PCR screening</td></tr><tr><td>Ab-vec-sense</td><td>Eurofins</td><td>GCTTCGTTAGAAC&lt;br/&gt; GCGGCTAC</td><td>Bacteria PCR screening</td></tr><tr><td>QA Agarose-TM, Molecular Biology Grade</td><td>MP Bio</td><td>AGAH0500</td><td></td></tr><tr><td>NucleoFast 96 PCR Plate</td><td>Macherey Nagel</td><td>743.100.100</td><td></td></tr><tr><td>Enzyme Age I HF</td><td>New England Biolabs</td><td>R3552L</td><td>20000U/ml</td></tr><tr><td>Enzyme SalI HF</td><td>New England Biolabs</td><td>R3138L</td><td>20000U/ml</td></tr><tr><td>Enzyme Xho I</td><td>New England Biolabs</td><td>R0146L</td><td>20000U/ml</td></tr><tr><td>Enzyme BSIWI</td><td>New England Biolabs</td><td>R0553L</td><td>10000U/ml</td></tr><tr><td>HCg1 (Genbank accession number FJ475055)</td><td></td><td></td><td></td></tr><tr><td>LCk (Genbank accession number FJ475056 )</td><td></td><td></td><td></td></tr><tr><td>LCl (Genbank accession number FJ517647)</td><td></td><td></td><td></td></tr><tr><td>T4 DNA ligase</td><td>Invitrogen by thermoFisher scientific</td><td>15224.017</td><td>100U (1U/ul)</td></tr><tr><td>2X YT medium</td><td>Sigma Aldrich</td><td>Y1003-500ML</td><td></td></tr><tr><td>Ampicillin</td><td>Sigma Aldrich</td><td>10835242001</td><td></td></tr><tr><td>LB (Luria Bertani) Broth (Lennox)</td><td>Sigma Aldrich</td><td>L3022-250G</td><td></td></tr><tr><td>Nucleospin Plasmid DNA, RNA and protein purification</td><td>Macherey Nagel</td><td>740588.250</td><td></td></tr><tr><td>Jet PEI DNA transfection reagent</td><td>PolyPlus</td><td>101-40</td><td></td></tr><tr><td>Flat bottom96-well plate</td><td>Falcon</td><td>353072</td><td></td></tr><tr><td>V-bottom 96-well plate</td><td>Nunc/Thermofisher</td><td>055142</td><td></td></tr><tr><td>Nunc easy 175 cm2 flasks</td><td>Nunc/Thermofisher</td><td>12-562-000</td><td></td></tr><tr><td>ELISA/ELISPOT coating buffer</td><td>eBiosciences</td><td>00-0044-59</td><td></td></tr><tr><td>Nunc maxisorp flat bottom 96 well ELISA plates</td><td>Nunc/Thermofisher</td><td>44-2404-21</td><td>high protein binding</td></tr><tr><td>Anti-human IgG Ab conjugated to horseradish peroxidase (HRP)</td><td>BD Pharmingen / BD Biosciences</td><td>55788</td><td></td></tr><tr><td>TMB substrate</td><td>BD Biosciences</td><td>555214</td><td></td></tr><tr><td>Streptavidin</td><td>Sigma</td><td>S0677</td><td></td></tr><tr><td>1 mL-HiTrap protein A HP column</td><td>GE Healthcare</td><td>17-0402-01</td><td></td></tr><tr><td>&amp;Auml;KTA FPLC</td><td>GE Healthcare</td><td>18190026</td><td></td></tr><tr><td>Superdex 200 10/300 GL column</td><td>GE Healthcare</td><td>17517501</td><td></td></tr><tr><td>NGC Quest 10 Plus Chromatography System</td><td>BioRad</td><td>7880003</td><td></td></tr></tbody></table>

generation of discriminative human monoclonal antibodies from rare antigen-specific b cells circulating in blood

Generation of Discriminative Human Monoclonal Antibodies from Rare Antigen-specific B Cells Circulating in Blood

Monoclonal antibodies (mAbs) are powerful tools useful for both fundamental research and in biomedicine. Their high specificity is indispensable when the antibody needs to distinguish between highly related structures (e.g., a normal protein and a mutated version thereof). The current way of generating such discriminative mAbs involves extensive screening of multiple Ab-producing B cells, which is both costly and time consuming. We propose here a rapid and cost-effective method for the generation of discriminative, fully human mAbs starting from human blood circulating B lymphocytes. The originality of this strategy is due to the selection of specific antigen binding B cells combined with the counter-selection of all other cells, using readily available Peripheral Blood Mononuclear Cells (PBMC). Once specific B cells are isolated, cDNA (complementary deoxyribonucleic acid) sequences coding for the corresponding mAb are obtained using single cell Reverse Transcription-Polymerase Chain Reaction (RT-PCR) technology and subsequently expressed in human cells. Within as little as 1 month, it is possible to produce milligrams of highly discriminative human mAbs directed against virtually any desired antigen naturally detected by the B cell repertoire.

Starting from PBMC from healthy donors, this project presents the generation of human mAbs, which recognize the peptide Pp65495 (Pp65, from human cytomegalovirus) presented by the major histocompatibility complex class I (MHC-I) molecule HLA-A*0201 (HLA-A2). These mAbs can discriminate between this complex and complexes representing other peptides loaded onto the same MHC-I molecule.
PBMC were stained with HLA-A2/Pp65...

We describe a method for the production of human antibodies specific for an antigen of interest, starting from rare B cells circulating in human blood. Generation of these natural antibodies is efficient and rapid, and the antibodies obtained can discriminate between highly related antigens.

Monoclonal antibodies (mAbs) are powerful tools useful for both fundamental research and in biomedicine. Their high specificity is indispensable when the ...

generation-discriminative-human-monoclonal-antibodies-from-rare

Research

JoVE Journal

Immunology and Infection

This video demonstrates a method of antibody generation from mammalian cells by introducing plasmid vectors with heavy and light chain genes. These vectors interact with polyethylenimine and enter the cells by forming polyplexes; later, they are translated into individual proteins and assembled into complete antibodies, which are secreted into the extracellular medium.

Generating Recombinant Monoclonal Antibodies From Mammalian Cell Cultures

The video demonstrates a technique for generating monoclonal antibodies from antigen-specific B cells. Eukaryotic expression vectors encoding the heavy and light chains of antibodies, cloned from isolated antigen-specific B cells, are introduced into mammalian cells using polyplexes. Once inside the cells, these vectors undergo translation, and the resulting heavy and light chain peptides assemble into antibodies, which are subsequently secreted by the cells.

A Technique to Generate Monoclonal Antibodies from Antigen-Specific B Cells

This article describes a method for the generation and propagation of human T cell clones that specifically respond to a defined alloantigen. This protocol can be adapted for cloning human T cells specific for a variety of peptide-MHC ligands.

Generation of Human Alloantigen-specific T Cells from Peripheral Blood

Synthesis of human monoclonal antibodies is the first step in studies aimed at unraveling the pathophysiological mechanisms of auto-antibody-mediated immune responses. We have developed a protocol to generate recombinant human immunoglobulin G (IgG) monoclonal antibodies from blood sorted B cells, including B-cell isolation, antibody cloning and in vitro synthesis.

Generation of Recombinant Human IgG Monoclonal Antibodies from Immortalized Sorted B Cells

Human peripheral blood is commonly used for the assessment of the humoral immune response. Here, the methods for isolating human B cells from peripheral blood, differentiating human B cells into antibody (Ab)-secreting B cells (ASCs) in culture, and enumerating the total IgM- and IgG-ASCs via an ELISpot assay are described.

The Isolation, Differentiation, and Quantification of Human Antibody-secreting B Cells from Blood: ELISpot as a Functional Readout of Humoral Immunity

An optimized protocol is presented for the generation of monoclonal antibodies based on the hybridoma technology. Mice were immunized with an immunoconjugate. Spleen cells were fused by PEG and an electric impulse with immortal myeloma cells. Antibody-producing hybridoma cells were selected by HAT and antigen-specific ELISA screening.

Generation of Murine Monoclonal Antibodies by Hybridoma Technology

A simple yet effective method that employs magnetic nanoparticles to detect and enrich antigen-reactive B cells for functional and phenotypic analysis is described.

Detection and Enrichment of Rare Antigen-specific B Cells for Analysis of Phenotype and Function

This article provides a detailed protocol for the preparation and evaluation of monoclonal antibodies against natural products for use in various immunoassays. This procedure includes immunization, cell fusion, indirect competitive ELISA for positive clone screening, and monoclonal hybridoma preparation. The specifications for antibody characterization using MALDI-TOF-MS and ELISA analyses are also provided.

Generation of Monoclonal Antibodies Against Natural Products

The BSelex method to identify and recover individual antigen-specific antibodies from human peripheral blood mononuclear cells combines flow cytometry with single cell PCR and cloning.

Single-cell Screening Method for the Selection and Recovery of Antibodies with Desired Specificities from Enriched Human Memory B Cell Populations

We describe herein a simple analysis of the heterogeneity of the murine immune B cell compartment in the peritoneum, spleen, and bone marrow tissues by flow cytometry. The protocol can be adapted and extended to other mouse tissues.

Flow Cytometric Characterization of Murine B Cell Development

Learn to generate fully human monoclonal antibodies from rare antigen-specific B cells circulating in human blood. This method enables precise discrimination between closely related antigens for immunotherapy applications.

Generation of Discriminative Human Monoclonal Antibodies from Rare Antigen-specific B Cells Circulating in Blood

Explore More Videos