Method Article

Gene Mining and Sequence Analysis of Purine Nucleosidase Based on RNA-Seq

DOI:

10.3791/61561

October 20th, 2020

In This Article

Summary

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

In this protocol, a method for gene mining and sequence analysis of purine nucleosidase (PN, EC:3.2.2.1) based on RNA-Seq was described. ProtProm analysis was applied to show the unique secondary and tertiary structures of PN. Furthermore, the PN gene was cloned from transcriptome to verify the reliability of RNA-Seq results.

Abstract

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Caterpillar fungus (Ophiocordyceps sinensis) is one of the most valued fungal Traditional Chinese medicine (TCM), and it contains plenty of active ingredients such as adenosine. Adenosine is considered as a biologically effective ingredient that has a variety of anti-tumor and immunomodulatory activities. In order to further elucidate the mechanism of purine nucleosidase (PN) in adenosine biosynthesis, a gene encoding PN was successfully mined and further analyzed based on the RNA-Seq database of caterpillar fungus. The full-length cDNA of PN was 855 bp, which encoded 284 amino acids. BLAST analysis showed the highest homology of 85.06% with nucleoside hydrolase in NCBI. ProtProm analysis showed that the relative molecular weight was 30.69 kDa and the isoelectric point was 11.55. The secondary structure of PN was predicted by Predict Protein; the results showed that alpha helix structure accounted for 28.17%, strand structure accounted for 11.97%, and loop structure accounted for 59.86%. Moreover, PN gene was further cloned from transcriptome and detected by agarose gel electrophoresis for verification. This study provides more sufficient scientific basis and new ideas for the genetic regulation of adenosine biosynthesis in fungal TCM.

Introduction

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Fungal Traditional Chinese medicine (TCM) has abundant species resources1,2. Caterpillar fungus (Ophiocordyceps sinensis) is a well-known fungal TCM and is regarded as a source of innovative drugs3,4. Caterpillar fungus is a worm and fungus combined mixture that is found on the Tibetan plateau in southwestern China, where Hirsutella sinensis is parasitic on the caterpillar body5. Currently, H. sinensis is reported as the only anamorph of caterpillar fungus according to molecular and morphological biology evidence6,7, and it has less associated toxicity and similar clinical efficacy compared to wild caterpillar fungus8. It was revealed that H. sinensis possesses a variety of biologically effective ingredients, such as nucleosides, polysaccharides, and ergosterols, with extensive pharmacological effects such as repairing a liver injury9,10,11. Adenosine is a typical active ingredient isolated from caterpillar fungus, and it is a kind of purine alkaloid12. Adenosine has a variety of biological activities: anti-tumor, antibacterial, and immunomodulatory activities13,14. Unfortunately, the biosynthetic mechanism of adenosine as well as the key genes involved is still unclear15,16.

Adenosine mainly shows its anti-tumor effect through immunosuppressive actions in the tumor microenvironment17. It was reported that adenosine showed immunosuppressive functions, which was critical to initiate tissue repair after injury and to protect tissues against excessive inflammation18,19. Moreover, it was demonstrated that adenosine-mediated repression of immunity could severely impair cancer immunosurveillance as well as promote tumor growth20. Thus, it is urgent to study the mechanism of adenosine biosynthesis for its wide application in anti-tumor.

It was reported that a complete view of expressed genes and their expression levels could be systematically conducted by next-generation sequencing of transcriptome21. Furthermore, transcriptome sequencing and analysis was applied to predict the genes involved in the biosynthetic pathway of the active ingredients, and further investigate the interaction of different biosynthetic pathways22. Purine nucleosidase (PN, EC 3.2.2.1) is a class of nucleosidase with substrate specificity for purine nucleosides, which can hydrolyze the glycoside bonds of purine nucleosides into sugars and bases23. It typically plays important roles in adenosine biosynthesis. It was reported that the biosynthetic pathway of adenosine in fungal TCM was predicted; qPCR and gene expression showed that the increased adenosine accumulation is a result of down-regulation of PN gene, indicating that the PN gene may play an important role in adenosine biosynthesis15. Therefore, the mechanism of PN in adenosine biosynthesis must be urgently clarified. However, the sequence information and protein structure of PN as well as other key genes involved in adenosine biosynthesis of fungal TCM have not been further studied.

In this study, a novel sequence of PN gene was mined from RNA-Seq data of caterpillar fungus and verified by gene cloning. Furthermore, the molecular characteristics and protein structure of PN were comprehensively analyzed, which could provide new directions and ideas for the gene regulation of adenosine biosynthesis.

Access restricted. Please log in or start a trial to view this content.

Protocol

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

NOTE: A strain of anamorph of caterpillar fungus (H. sinensis) was deposited in our laboratory. Escherichia coli DH5 were preserved by Shenzhen Hospital, Beijing University of Chinese Medicine.

1. Preparing for RNA-Seq

  1. Harvesting of mycelia
    1. Prepare fermentation medium for fermentation of H. sinensis: powdered corn flour (1%), silkworm pupae (1.5%), yeast extract (0.5%), tryptone (1%), glucose (1.5%), bran (1.5%), dextrin (0.5%), KH2PO4 (0.02%) and MgSO4 (0.01%).
    2. Prepare inoculation by 10% fermentation medium for scale-up culture (add 10 mL medium per 100 mL medium). Conduct submerged fermentation by the condition of 16 °C on a rotary shaker at 150 rpm for 10 days.
    3. Asexually reproduce and harvest mycelia of the anamorph of caterpillar fungus for 10 days. Centrifuge the fermented medium and discard the supernatant after centrifugation. Suspend the mycelia by adding 100 mL of ultrapure water for 3 times and remove the supernatant by centrifugation. Grind the cleaned mycelia into a powder using liquid nitrogen.
  2. RNA-Seq
    1. Extract total RNA of the anamorph of caterpillar fungus according to the manufacturer’s protocols (Table of Materials) and further treat the sample with RNase-free DNase I (Table of Materials).
    2. Isolate the mRNA from total RNA PolyATtract mRNA Isolation Systems, and isolate poly(A) mRNA using beads with oligo(dT) according to the manufacturer’s protocols (Table of Materials).
    3. Take the short fragments as templates to synthesize the first-strand cDNA by random hexamer-primers according to the manufacturer’s protocols (Table of Materials). Perform the synthesis of second-strand cDNA according to the manufacturer’s protocols.
    4. Subsequently, generate the sequencing libraries using the Ultra RNA Library Prep Kit according to the manufacturer’s protocols (Table of Materials).
    5. Purify short fragments by PCR extraction kit according to the manufacturer’s protocols (Table of Materials) and resolve it by EB buffer, respectively.
    6. Connect the short fragments (threshold of 300 bp) with sequencing adapters according to the result of agarose gel electrophoresis.
    7. Subsequently, conduct amplification with PCR using the templates selected from suitable fragments.
    8. Sequence the library by Illumina HiSeq 4000 with paired-end sequencing according to the manufacturer’s protocols. Filter dirty raw reads from the raw sequence data to obtain clean data. Adopt denovo assembly to get Unigenes with the least Ns that cannot be extended on either end.
    9. Align Unigene sequences by blastx to protein databases such as nr, Swiss-Prot, KEGG, and COG (e-value < 0.00001). Retrieve proteins with the highest sequence similarity with the given Unigenes along with their protein functional annotations. Summarize the RNA-Seq results (Table of Materials).
      NOTE: Commercial kits were used in the above steps, and all operations were done according to the manufacturer's protocol.

2. Gene mining of purine nucleosidase

  1. Download the files of RNA-Seq results on the computer. Find the annotation result files of assembled Unigenes from the RNA-Seq results.
    NOTE: Paired-end reads were used again for gap filling of scaffolds to obtain sequences with least Ns that cannot be extended on either end. Such sequences were defined as Unigenes. Unigene annotation provides information of expression and functional annotation of Unigene.
  2. Open the Annotation Files path and enter map 00230 in the search bar; then search purine metabolism (map00230) in the KEGG classification of annotation files.
  3. Mark EC:3.2.2.1 (PN) red in the annotated map00230 and indicate that there were assembled Unigenes that have been annotated to PN.
    NOTE: There were three Unigenes (Unigene10777, Unigene14697, and Unigene17827) annotated to PN after clicking on the EC number 3.2.2.1 and shown in the annotated map00230.
  4. Click on EC number 3.2.2.1 and show the annotated Unigenes information.
  5. Open the LTFViewer software and import Unigene.fa file with a Ctrl-O shortcut and show the sequence information of assembled Unigenes.
  6. Search for sequence information of Unigene10777, Unigene14697, and Unigene17827 with a Ctrl-F shortcut.
  7. Download the sequence information of Unigene10777, Unigene14697, and Unigene17827 with Ctrl-C and Ctrl-V shortcuts.
  8. Eliminate Unigene10777 and Unigene17827 with excessively short sequences of open reading frame (ORF).
    NOTE: Basic sequence information was displayed in LTFViewer software.
  9. Select Unigene14697 (size 1,705 bp, gap 0 0%) with suitable length of ORF for further study.

3. Bioinformatic analysis

  1. Analyze the ORF of PN gene by ORFfinder (https://www.ncbi.nlm.nih.gov/orffinder/).
    1. Paste the sequence into the box. Choose parameters as follows, minimal ORF length (nt): 75, genetic Code: 1. standard, ORF start codon to use: ATG only. Click on the Submit button to obtain the ORF information.
  2. Use the ProtParam tool (http://us.expasy.org/tools/protparam.html) to calculate the theoretical molecular mass and isoelectric point.
    1. Paste the amino acid sequence (in one-letter code) into the box and click on the Compute Parameters button to obtain the results.
  3. Apply SignalP5.0 Server (http://www.cbs.dtu.dk/services/SignalP/) to predict the signal peptides.
    1. Enter protein sequences in FASTA format. Choose parameters as follows, organism group: Eukarya, output format: Long output. Click on the Submit button to obtain the results.
  4. Apply BLAST (https://blast.ncbi.nlm.nih.gov/Blast.cgi) to analyze the homology of protein sequences.
    1. Click on the Protein Blast button and enter the sequence into the box. Choose parameters as follows, database: Non-redundant protein sequences (nr), algorithm: blastp (protein-protein BLAST). Click on the Blast button to obtain the results.
  5. Apply Clustal X program (http://www.clustal.org/) to align the acid sequences of PN from different fungi.
    1. Upload a file or paste the sequences into the box. Set the parameters as follows, output format: ClustalW with character counts. Click on the Submit button to obtain the results. Clustal X can only recognize files in the FASTA format, and the path of files can only include English names.
  6. Use MEGA 4.0 (https://www.megasoftware.net/mega4/) to conduct the phylogenetic tree.
    1. Open the software and click on the File button to upload the sequences. Select the data type as Protein Sequences, click on the OK button to proceed to the next step. Subsequently, click on the Phylogeny button and select Bootstrap Test Phylogeny, and then click on Neighbor Joining Tree. Select the default parameters and click on the Compute button to obtain the results.
  7. Apply InterProScan (http://www.ebi.ac.uk/interpro/search/sequence/) to identify the catalytic domain of PN.
    1. Enter the sequence into the box. Select the default parameters and click on the Search button to obtain the results.
  8. Apply Predict Protein (http://www.predictprotein.org/) online to predict the protein secondary structure.
    1. Enter an amino-acid sequence (one letter code) into the box, and then click on the predictProtein button to obtain the results.
  9. Apply Online tools SWISS-MODEL (http://swissmodel.expasy.org/) to evaluate the three-dimensional structure of PN24.
    1. Click on the Start Modeling button and paste the target sequence into the box. Fill in the Project Title and Email information and click on the Search for Templates button to obtain the results.

4. Gene cloning and construction of recombinant plasmid

  1. Design primers whose reverse primer contained a NotI site and the forward primer had an EcoRI site.
  2. Show the forward primer as: AGAGAATTCATGACCATGCCAGATTCT (5’–3’), and the reverse primer as: ATAGCGGCCGCCTAACGCGTGCCGTTAGA (5’–3’) by Primer Express.
  3. Prepare the primers as well as the cDNA of caterpillar fungus for cloning of PN gene. Conduct PCR as follows: pre-denaturation at 95 °C for 5 min, denaturation at 94 °C for 45 s, renaturation at 55 °C for 60 s, extension at 72 °C for 90 s, repeat for 35 cycles, and extension at 72 °C for 10 min.
  4. Obtain the PCR fragments and detect it by agarose gel electrophoresis for verification. Ligate the PCR fragments with pMD18-T. Conduct ligation system of PMD18-T as follows: 1 μL PMD18-T, 4 μL Solution1, and 5 μL Target gene. Set the conditions as follows: maintaining at 16 °C for 16 h, inactivation at 65 °C for 15 min.
  5. Transfer the recombinant plasmids to the competent E. coli JM109 cells according to the operation manual25.
  6. Digest the recombinant pMD18-T/PN plasmids and vector ppic9K with EcoRI and NotI. Ligate the fragments after digestion by T4 DNA ligase.
  7. Construct the recombinant plasmid ppic9K/PN for further heterologous expression.

Access restricted. Please log in or start a trial to view this content.

Results

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

The ORF sequence of PN gene was 855 bp in length, which encoded 284 amino acids with a calculated molecular mass of 30.69 kDa and a predicted isoelectric point of 11.55, indicating that PN is an alkaline protein. Application of SignalP4.0 Server was conducted to identify signal peptide, and the results indicated that PN has no signal peptides. Moreover, the results of BLASTP search indicated that PN originated from caterpillar fungus shared the highest identity (85.06%, E value = 1e-88) with nucleoside ...

Access restricted. Please log in or start a trial to view this content.

Discussion

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Human health is facing a series of major medical problems such as tumor, cardiovascular, and cerebrovascular diseases26,27. TCM has been regarded as the source of research and development of innovative medicine, because of its rich species resources and diverse structure and functions of active ingredients28,29. Caterpillar fungus is a fungal parasite on the larvae of Lepidoptera, and it is an invigorant ...

Access restricted. Please log in or start a trial to view this content.

Disclosures

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

The authors report no conflicts of interest.

Acknowledgements

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

This study was supported by National Natural Science Foundation of China (31871244, 81973733, 81803652), Natural Science Foundation of Guangdong Province (2019A1515011555, 2018A0303100007), Shenzhen Foundation of Health and Family Planning Commission (SZBC2018016), Special Fund for Economic and Technological Development of Longgang District of Shenzhen City (LGKCYLWS2020064, LGKCYLWS2019000361).

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
RNase-free DNase ITaKaRa2270B
PolyATtract mRNA Isolation SystemsPromegaIII
Random hexamer-primersThermo ScientificSO142
NEBNext1 Ultra RNA Library Prep KitNEBE7530S
PCR extraction kitQiaQuick
AgaroseTransGen BiotechGS201-01
High-throughput sequencerIlluminaHiSeq™ 4,000
LTF ViewerLTFV5.2
ORF programNCBI
ProtParam toolSIB Swiss Institute of Bioinformatics
SignalP ServerDTU Health Tech5.0
BLASTNCBI
Clustal X programUCD Dublin
MEGACenter for Evolutionary Medicine and Informatics4.0
InterProScanEuropean Molecular Biology Laboratory
Predict ProteinTechnical University of Munich
WISS-MODELSwiss Institute of Bioinformatics
Primer ExpressApplied Biosystems3.0
EcoRINEBR0101V
NotINEBER0591
pMD18-T VectorTaKaRa6011
agaroseSigma-AldrichGS201-01
Trans2K® Plus II DNA MarkerSigma-AldrichBM121-01
6×DNA Loading BufferSigma-AldrichGH101-01
GelStainSigma-AldrichGS101-02
50 x TAESigma-AldrichT1060
Gel imaginganalysis systemSyngeneG:BOX F3
E. coli JM109Promega
T4 DNA ligaseEarthOxBE004A-02
pPIC9KGenlociGP0983

References

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,
  1. Dong, C. J. The traditional Chinese medicine fungus Cordyceps and its biotechnological production. Research Journal of Biotechnology. 8, 1-2 (2013).
  2. Xia, E. H., et al. The caterpillar fungus, Ophiocordyceps sinensis, genome provides insights into highland adaptation of fungal pathogenicity. Scientific Reports. 7 (1), 1806(2017).
  3. Koganti, P., et al. Cordyceps sinensis increases hypoxia tolerance by inducing heme oxygenase-1 and metallothionein via Nrf2 activation in human lung epithelial cells. BioMed Research International. 2013, 569206(2013).
  4. Shen, C. Y., Jiang, J. G., Li, Y., Wang, D. W., Wei, Z. Anti-ageing active ingredients from herbs and nutraceuticals used in traditional Chinese medicine: pharmacological mechanisms and implications for drug discovery. British Journal of Pharmacology. 174, (2017).
  5. Jiang, Y., Yao, Y. J. Names related to Cordyceps sinensis anamorph. Mycotaxon. 84, 245-254 (2002).
  6. Chen, Y. Q., Wang, N., Qu, L. H., Li, T. H., Zhang, W. M. Determination of the anamorph of Cordyceps sinensis inferred from the analysis of the ribosomal DNA internal transcribed spacers and 5.8S rDNA. Biochemical Systematics and Ecology. 29, 597-607 (2001).
  7. Liu, Z. Y., et al. Molecular evidence for the anamorph-teleomorph connection in Cordyceps sinensis. Mycological Research. 105, 827-832 (2001).
  8. Yu, S. J., Zhang, Y., Fan, M. Z. Analysis of volatile compounds of mycelia of Hirsutella sinensis, the anamorph of Ophiocordyceps sinensis. Applied Mechanics and Materials. 140, 253-257 (2012).
  9. Singh, M., et al. Cordyceps sinensis increases hypoxia tolerance by inducing heme oxygenase-1 and metallothionein via Nrf2 activation in human lung epithelial cells. BioMed Research International. 2013, 569206(2013).
  10. Cha, S. H., et al. Production of mycelia and exo-biopolymer from molasses by Cordyceps sinensis 16 in submerged culture. Bioresource Technology. 98, 165-168 (2007).
  11. Lin, S., et al. Enhancement of cordyceps polysaccharide production via biosynthetic pathway analysis in Hirsutella sinensis. International Journal of Biological Macromolecules. 92, 872-880 (2016).
  12. Xia, E. H., et al. The caterpillar fungus, Ophiocordyceps sinensis, genome provides insights into highland adaptation of fungal pathogenicity. Scientific Reports. 7, 1806(2017).
  13. Cha, S. H., et al. Production of mycelia and exo-biopolymer from molasses by Cordyceps sinensis 16 in submerged culture. Bioresource Technology. 98, 165-168 (2007).
  14. Antonioli, L., Blandizzi, C., Pacher, P., Hasko, G. Immunity, inflammation and cancer: a leading role for adenosine. Nature Reviews. Cancer. 13, 842-857 (2013).
  15. Lin, S., Zou, Z., Zhou, C., Zhang, H., Cai, Z. Transcriptome analysis reveals the molecular mechanisms underlying adenosine biosynthesis in anamorph Strain of caterpillar fungus. BioMed Research International. 2019, 1864168(2019).
  16. Lin, S., et al. Biosynthetic pathway analysis for improving the cordycepin and cordycepic aid production in Hirsutella sinensis. Applied Biochemistry and Biotechnology. 179, 633-649 (2016).
  17. Allard, B., Beavis, P. A., Darcy, P. K., Stagg, J. Immunosuppressive activities of adenosine in cancer. Current Opinion in Pharmacology. 29, 7-16 (2016).
  18. Fredholm, B. B. Adenosine, an endogenous distress signal, modulates tissue damage and repair. Cell Death and Differentiation. 14, 1315-1323 (2007).
  19. Ohta, A., Sitkovsky, M. Role of G-protein-coupled adenosine receptors in downregulation of inflammation and protection from tissue damage. Nature. 414, 916-920 (2001).
  20. Allard, B., Turcotte, M., Stagg, J. CD73-generated adenosine: orchestrating the tumor-stroma interplay to promote cancer growth. Journal of Biomedicine & Biotechnology. 2012, 485156(2012).
  21. Zhang, Y., Wang, X., Nan, P., Li, J., Jin, L. De novo transcriptome sequencing of genome analysis provides insights into Solidago canadensis invasive capability via photosynthesis. Journal of Plant Interactions. 14, 572-579 (2019).
  22. Liu, Z. Q., et al. Transcriptome sequencing and analysis of the entomopathogenic fungus Hirsutella sinensis isolated from Ophiocordyceps sinensis. BMC Genomics. 16, 106(2015).
  23. Ogawa, J., et al. Purification, characterization, and gene cloning of purine nucleosidase from Ochrobactrum anthropi. Applied and Environmental Microbiology. 67, 1783-1787 (2001).
  24. Konstantin, A., et al. The swiss-model workspace: a web-based environment for protein structure homology modelling. Bioinformatics. 16, 195-201 (2006).
  25. Chung, C., Niemela, S. L., Miller, R. H. One-step preparation of competent Escherichia coli: transformation and storage of bacterial cells in the same solution. Proceedings of the National Academy of Sciences. 86, 2172-2175 (1989).
  26. Lin, S., et al. Association between aldose reductase gene C(-106)T polymorphism and diabetic retinopathy: A systematic review and Meta-Analysis. Ophthalmic Research. 63, 1-10 (2020).
  27. Peng, Y., et al. Inguinal subcutaneous white adipose tissue (ISWAT) transplantation model of murine islets. Journal of Visualized Experiments: JoVE. (156), (2020).
  28. Zhang, T. T., Jiang, J. G. Active ingredients of traditional Chinese medicine in the treatment of diabetes and diabetic complications. Expert Opinion on Investigational Drugs. 21, 1625-1642 (2012).
  29. Lin, S., Zhou, C., Zhang, H., Cai, Z. Expression, purification and characterization of 5'-nucleotidase from caterpillar fungus by efficient genome-mining. Protein Expression and Purification. 168, 105566(2020).
  30. Kinjo, N., Mu, Z. Morphological and phylogenetic studies on Cordyceps sinensis distributed in southwestern China. Mycoence. 42, 567-574 (2001).
  31. Xiao, J. H., Ying, Q., Xiong, Q. Nucleosides, a valuable chemical marker for quality control in traditional Chinese medicine Cordyceps. Recent Patents on Biotechnology. 7, 2(2013).
  32. Tu, P., Yong, J., Guo, X. Discovery, research and development for innovative drug of traditional Chinese medicine under new situations. Zhongguo Zhong Yao Za Zhi. 40, 3423-3428 (2015).
  33. Zheng, P., et al. Genome sequence of the insect pathogenic fungus Cordyceps militaris, a valued traditional Chinese medicine. Genome Biology. 12, 116(2011).
  34. Covarrubias, R., et al. Role of the CD39/CD73 purinergic pathway in modulating arterial thrombosis in mice. Arteriosclerosis, Thrombosis, and Vascular Biology. 36, 1809-1820 (2016).
  35. Ogawa, Y., Murayama, N., Yanoshita, R. Molecular cloning and characterization of ecto-5'-nucleotidase from the venoms of Gloydius blomhoffi. Toxicon. 54, 408-412 (2009).
  36. Lin, S., et al. Mining and characterization of two novel chitinases from Hirsutella sinensis using an efficient transcriptome-mining approach. Protein Expresion and Purification. 133, 81-89 (2017).
  37. Ueda, M., Hirano, Y., Fukuhara, H. Gene cloning, expression, and X-ray crystallographic analysis of a β-mannanase from Eisenia fetida. Enzyme and Microbial Technology. 117, 15-22 (2018).
  38. Rebets, Y., Kormanec, J., Luzhetskyy, A., Bernaerts, K., Anné, J. Cloning and expression of metagenomic DNA in Streptomyces lividans and subsequent fermentation for optimized production. Methods in Molecular Biology. 1539, 99(2017).
  39. Wang, S. S., Ning, Y. J., Wang, S. N., Zhang, J., Chen, Q. J. Purification, characterization, and cloning of an extracellular laccase with potent dye decolorizing ability from white rot fungus Cerrena unicolor GSM-01. International Journal of Biological Macromolecules. 95, 920-927 (2016).

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Request permission to reuse the text or figures of this JoVE article

Request Permission

Tags

Purine NucleosidaseRNA Seq AnalysisGene MiningCaterpillar FungusAdenosine BiosynthesisBLAST AnalysisProtein Structure PredictionAgarose Gel ElectrophoresisTranscriptome CloningNucleoside Hydrolase
Video Coming Soon

Related Articles