Method Article

Clonal Analysis of the Neonatal Mouse Heart using Nearest Neighbor Modeling

1.3K views

DOI:

10.3791/61656

August 22nd, 2020

* These authors contributed equally

In This Article

Summary

Presented here is a protocol for using multicolor lineage tracing and nearest-neighbor modeling to identify clonally derived cardiomyocytes during growth and regeneration in mice. This approach is objective, works across different labeling conditions, and can be adapted to incorporate a variety of image analysis pipelines.

Abstract

By replacing lost or dysfunctional myocardium, tissue regeneration is a promising approach to treat heart failure. However, the challenge of detecting bona fide heart regeneration limits the validation of potential regenerative factors. One method to detect new cardiomyocytes is multicolor lineage tracing with clonal analysis. Clonal analysis experiments can be difficult to undertake, because labeling conditions that are too sparse lack sensitivity for rare events such as cardiomyocyte proliferation, and diffuse labeling limits the ability to resolve clones. Presented here is a protocol to undertake clonal analysis of the neonatal mouse heart by using statistical modeling of nearest neighbor distributions to resolve cardiomyocyte clones. This approach enables resolution of clones over a range of labeling conditions and provides a robust analytical approach for quantifying cardiomyocyte proliferation and regeneration. This protocol can be adapted to other tissues and can be broadly used to study tissue regeneration.

Introduction

A histologic hallmark of heart failure is the loss of cardiomyocytes (CMs), either following injury, senescence, or apoptosis1. Replenishing lost or dysfunctional myocardium through tissue regeneration represents a potential therapeutic strategy for curing patients with heart failure. Over the past several decades, seminal advances in developmental and regenerative biology have unearthed a limited ability for the mammalian heart to replenish lost CMs2,3,4,5. This exciting work has raised the possibility that innate growth mechanisms can be deployed for regeneration. Because innate regenerative responses are functionally absent in the adult mammalian heart, methods to improve the robustness of endogenous repair are needed for therapeutic heart regeneration to be realized.

The mechanisms for innate heart regeneration appear to be conserved across species. Following injury, pre-existing CMs proliferate to generate new CMs in zebrafish6,7, newts8,9, mice4,10, rats11, and pigs12,13. Accordingly, many groups are seeking to identify mitogens capable of promoting cardiomyogenesis. However, such work is challenging. Not only is the task of getting adult mammalian CMs to proliferate daunting but being able to identify rare proliferative events is difficult1,14. The challenge of identifying rare cycling CMs is compounded by the tendency of adult mammalian CMs to preferentially undergo endomitosis. For example, after injury to the mouse heart, almost 25% of CMs in the border zone re-enter the cell cycle, but only 3.2% of CMs divide4. Because most cycling CMs duplicate their genome but fail to undergo cytokinesis, simply assaying for an increase in the numbers of cycling CMs is ambiguous to bona fide cardiomyogenesis. Thus, assays for nucleoside incorporation by CMs or for the presence of proliferative markers on CMs may not entirely indicate regeneration. As more candidate factors for heart regeneration emerge, assays to better identify CM hyperplasia are needed.

Clonal analysis by lineage tracing is a valuable approach to assay for cardiomyogenesis because it allows for the direct visualization of cells and their progeny. Traditional approaches for clonal analysis involve rare labeling of single cells with a reporter gene. However, single-color lineage tracing of rare cells may be of limited value for infrequent events such as CM proliferation because the chances of labeling a proliferating CM are low15. Alternatively, multicolor lineage tracing can increase the sensitivity for clonal analysis16. Briefly, individual cells are genetically labeled with one of several fluorescent proteins at random, such that proliferating cells will generate homogeneously colored clusters of cells that can be resolved from neighboring fluorescent cells. This method has been used to trace growth across a variety of organs, and has been more recently applied to studies of mammalian heart regeneration17,18. While multicolor lineage tracing can detect clonal expansion of CMs in embryonic and neonatal stages, innate regenerative responses are not easily detected in the adult mouse heart after cardiac injury17,19. One approach to enhance the sensitivity of multicolor lineage tracing would be to increase the level of labeling and increase the probability for visualizing rare events. However, wider labeling comes at the cost of not being able to distinguish similarly labeled cells as rising from a common ancestor versus cells that were independently labeled with the same fluorophore. Presented here is a protocol that uses nearest-neighbor modeling to identify clonally related CMs in the neonatal mouse heart. This method is unbiased, quantitative, and works over a range of labeling conditions.

Access restricted. Please log in or start a trial to view this content.

Protocol

All procedures for handling mice, performing survival surgeries, and for harvesting hearts require approval by a local institutional animal use committee.

1. Mice for clonal analysis of CMs

  1. Cross Myh6-MerCreMer mice20 with Gt(ROSA)26Sortm1(CAG-EGFP,-mCerulean,-mOrange,-mCherry)Ilw mice21 to generate Myh6-MerCreMer; R26R-Rainbow bitransgenic mice.
    1. Maintain stocks of mice homozygous for the R26R-Rainbow allele and cross with mice heterozygous for the Myh6-MerCreMer allele, such that all of the experiments are performed in mice heterozygous for the R26R-Rainbow allele. Alternatively, use mice homozygous for the R26R-Rainbow allele to increase color diversity, but this will require an imaging system that can faithfully discriminate EGFP, mCerulean, mOrange, and mCherry fluorophores.
  2. Perform genotyping at the time of heart collection.
    NOTE: Myh6-MerCreMer mice express a tamoxifen-inducible Cre recombinase in CMs and can be genotyped using the PCR primers CGTACTGACGGTGGGAGAAT (Cre-F) and GTGGCAGATGGCGCGGCAACA (Cre-R) to generate a 200 base pair (bp) product. R26R-Rainbow mice constitutively express EGFP but will stochastically express mCerulean, mOrange, or mCherry after Cre-mediated recombination. R26R-Rainbow can be genotyped with the PCR primers CTCTGCTGCCTCCTGGCTTCT (R26-F), CGAGGCGGATCACAAGCAATA (R26-R), and TCAATGGGCGGGGGTCGTT (Rainbow-R). The wild type allele gives a 350 bp product and the Rainbow allele gives a 250 bp product.

2. Cryoinjury and labeling of cardiomyocytes

  1. Perform cryoinjuries as previously described with minor modifications22,23. Carefully place one-day-old mice (P1) on a bed of crushed ice for 3 min to induce cardiac arrest. Confirm adequate anesthesia by performing a toe pinch without reflexive withdrawal.
    NOTE: Timing of anesthesia is critical. Survival can be impaired if mice are cooled for too long. Additionally, age of mice is critical. Regenerative capacity wanes sharply over the first week of life10.
  2. Position the anesthetized pup on a cold pack and under the objective of a surgical dissecting microscope. Use 6 mm microscissors to perform a thoracotomy between the 4th and 5th rib to expose the anterior surface of the heart.
  3. Using a cryoprobe cooled in liquid nitrogen, place the probe on the left ventricle for 1-2 s. For sham injuries, perform thoracotomy without cryoinjury.
    NOTE: The duration of cryoinjury dictates the extent of injury. Prolonged injuries will decrease survival rates.
  4. Close the incision with 6-0 polypropylene suture attached to a 0.15 mm diameter needle.
  5. Warm the pup quickly and manually stimulate to resume blood flow. Once the pup is spontaneously moving, place on a heating pad.
  6. Inject recovered pups with 20 μg of tamoxifen intraperitoneally. At this point, inject analgesics, such as 0.25% bupivacaine along the suture line, if required. Return pups to the dam.
    NOTE: Pups from a single litter are recovered together and returned to the dam together. This workflow improves survival and reacceptance of the litter by the dam.

3. Harvesting of hearts and processing for histological analysis

  1. Harvest hearts at 20 days post injury (dpi), or postnatal day (P21), as regenerative responses can be observed by this time point10. First euthanize mice in a CO2 inhalational chamber and then transfer to a surgical microscope.
    NOTE: Euthanasia should be performed in compliance with institutional guidelines for animal use.
  2. Once sufficient anesthesia is confirmed, perform a double thoracotomy using surgical microscissors to expose the heart. Then, perfuse the heart with 1 mL of 1 M KCl, 1 mL of 4% paraformaldehyde, and 1 mL of phosphate buffered saline (PBS).
    NOTE: Adequate washing is needed to limit intraventricular blood clots that can cause autofluorescence during image acquisition.
  3. After perfusion, dissect out the heart and place in a tube containing at least 1 mL of PBS.
  4. Use a dissecting microscope to trim the hearts in order to optimize embedding. A horizontal slice below the atrium provides a good surface for embedding the hearts for short-axis sections.
    NOTE: Alternatively, one can transversely cut the heart if long axis sections are desired.
  5. Place trimmed hearts in 1 mL of 30% (wt/vol) sucrose at 4 °C for 12–18 h. Remove the samples from the sucrose solution. Embed trimmed tissue into blocks using tissue freezing media.
  6. Freeze the embedded tissue quickly on dry ice and store blocks at −80 ˚C.
  7. Section frozen whole-heart blocks into 10 μm sections with a cryostat, mount on charged slides, and store slides at −20 ˚C. Serially section hearts across 10 slides. This is done by mounting a section on each of the 10 slides before returning to the first slide to add another section. Such a strategy limits the chance of capturing the same CMs on multiple sections on a given slide.
    NOTE: Be careful to limit exposure to light in order to prevent loss of fluorescence.
  8. When ready for imaging, thaw slides and rehydrate in PBS. Add an anti-fade mounting medium before applying a #1.5 glass coverslip. Store cover-slipped slides in a covered container at 4 ˚C.
    NOTE: For expected results for cryoinjury, the reader is directed towards prior work on this topic23. Cardiac sections have high levels of autofluorescence. Use of quenching agents, such as Sudan Black, prior to application of a coverslip can help to mitigate autofluorescence. However, caution should be used to avoid quenching fluorophores of interest.

4. Imaging

NOTE: The steps below apply to the use of a commercial microscope (see Table of Materials) that has an upright widefield fluorescence system with filter cubes equipped to discriminate mCerulean, EGFP, mOrange, and mCherry fluorophores, and software associated with this set up (see Table of Materials). Additional steps will vary depending on the exact imaging system that is used.

  1. Image the entire slide at 5x magnification with only the GFP filter to create a slide map.
  2. Select individual sections on the slide map that are intact and with limited autofluorescence for imaging. Due to the serial sectioning in sets of 10 slides, adjacent sections will be at least 100 μm apart, preventing imaging of the same CMs.
  3. Perform tile scan imaging for the individual sections using a 20x objective with the mCerulean, mOrange, mCherry, and EGFP filters. Representative images are shown in Figure 1.
  4. Save images in a format that allows for the individual channel information to be retrieved. Be careful to name the files in a format that will allow for identifying the heart, fluorophore, and position of the section within the heart. A systematic naming approach is required for the computational steps below.

5. Analysis of images to identify labeled CMs

  1. Select the imaged sections that are intact from each set and distribute randomly to all screeners. Ensure that screeners adhere to the following steps for each image.
  2. For each channel (mCerulean, mOrange, and mCherry), use the ‘Color Balance’ tool on ImageJ24 to adjust brightness and contrast of the image to help the user identify labeled cells.
    NOTE: ImageJ is a free image analysis tool that can be downloaded from https://imagej.net. This protocol used version 2.0.0-rc-69/1.52i.
  3. In ImageJ, select ‘Set Measurements’ from the ‘Analyze’ drop-down menu. In the window that opens, select ‘Area | Center of mass | Bounding rectangle | Limit to threshold’.
    NOTE: The image subtraction module can sometimes be used to improve fluorophore signal relative to the background autofluorescence. However, if performed, subtraction should be done systematically for all images in a dataset.
  4. With the image of interest open, select ‘Tools’ and then select ‘ROI manager’ from the ‘Analyze’ drop-down menu. This will open, the ‘ROI Manager’ window.
  5. Select the ‘Freehand selections’ tool from the ImageJ toolbar and trace the cell of interest (Figure 2A). Once traced, press ‘t’ or use the ‘Add [t]’ button in the ‘ROI manager’ window (Figure 2B). Repeat for all the cells of a single channel.
    NOTE: Segmentation and ROIs should be done for each channel separately.
  6. Once all the cells for a given channel have been selected, save the ROI’s as a .zip file. Do this by first selecting ‘Deselect’ in the ‘ROI Manager’ window to make sure no single ROI is highlighted. Then, click on the ‘More’ tab in the ‘ROI manager’ window and select the ‘Save’ option. This will open the desktop navigator, where the ROIs are saved as a .zip file.
  7. Export the measurements for each of the ROIs as a .csv file. To do this, make sure no single ROI is highlighted, again by selecting ‘Deselect’, and then select ‘Measure’ in the ‘ROI manager’ window. This will open a new ‘Results’ window with all the measurements selected earlier.
  8. In the ‘Results’ window select ‘File’, then select ‘Save as’ from the drop-down menu (Figure 2C). This will once again open the desktop navigator, so that the file can be saved in the .csv format.
    NOTE: Make sure to save the ROIs and measurements before moving on to segmenting the next channel.
  9. Be careful to name the files in a format that will allow for identifying the heart, channel, and position of the section within the heart. For example, ‘HeartType#_Set#_Section#_Channel’ (e.g., ‘CI-1_Set4_S3_mOrange.zip’ for the ROIs and ‘CI-1_Set4_S3_mOrange.csv’ for the corresponding measurements).
    NOTE: The code below assumes the naming convention above. A different naming convention will require modification to the code.

6. Statistical analysis

NOTE: Cells carrying the same fluorophore are a mix of clonally derived cells (kin) and unrelated cells that underwent a random recombination event to express the same fluorophore (non-kin). Based on prior data17, kin cells are assumed to have a closer physical proximity than non-kin cells expressing the same fluorophore. Thus, kin and non-kin cells can be differentiated based on a distance threshold. However, in order to determine the threshold, the nearest neighbor distributions for kin and non-kin cells need to be deconvolved. Fortunately, nearest neighbor distributions for non-kin cells can be estimated by evaluating the nearest neighbor values from each cell to the closest cell carrying a different fluorophore. Here, methodology is presented for statistically determining a threshold distance to define clonality and for assigning a probability of kinship between cells.

  1. Using the .csv files obtained from section 5, calculate the nearest neighbor distances for each cell within a heart slice. Compile these results into within-channel (mCerulean-mCerulean, mOrange-mOrange, and mCherry-mCherry) and between-channel (mCerulean-mOrange, mOrange-mCherry, and mCherry-mCerulean) distances. Save the results into two .csv files: one for within-channel and one for between-channel distances.
    1. Install the Python25 code that requires the numpy and pandas libraries.
      > pip install numpy; pip install pandas
    2. Calculate distances and export .csv files for within-channel distances and between-channel distances using python snippet_6_1.py.
  2. Read the within-channel and between-channel distances into an R26 data frame, converting the heart identifiers into a categorical variable. Apply a threshold chosen ad-hoc by looking at nearest neighbor histograms (Figure 3A,C) to minimize outliers. Be sure to choose a threshold that covers over 90% of the between-channel and within-channel distances, while excluding the long tail to avoid overfitting to the noise at large nearest neighbor distances. This protocol uses a threshold of 400 μm (Figure 3). Use Rscript snippet_6_2.R to execute this step.
    NOTE: Alternatively, one can model multiple slices as individual variables. This protocol limits the model complexity to the heart level for ease of modeling and estimation.
  3. Obtain the natural logarithms for the within-channel and between-channel distances. Because cells are space-occupying, non-point entities, the minimum nearest neighbor distance distribution is centered around a non-zero value and has asymmetric tails since the maximum distance between pairs of cells can be substantially higher than the median values (Figure 3A,C). Use the log-normal distribution to model such distributions (Figure 3B,D). Do this by using Rscript snippet_6_3.R.
  4. Use the following Bayesian model to estimate the means and variances of the kin (α2, σ22) and non-kin (α1, σ21) nearest-neighbor distributions, and the probability of within-channel distances arising from the kin distribution (π=eβ/(1+eβ)):
    bw.disti ~ N(α1, σ21| l.lim<bw.disti<u.lim)
    wi.disti ~ N(α1, σ21| l.lim<wi.disti<u.lim)*(1-π) + N(α2, σ22| l.lim<wi.disti<u.lim)*π
    σ1 ~T1(0,1|σ1>0)
    σ2 ~T1(0,1|σ2>0)
    α1 ~ Unif(2,6)
    α2 ~ Unif(1,5)
    β ~ Unif(-5,0)
    where Unif(a,b) is the uniform distribution on the interval [a,b], N(μ,σ2|l<x<u) is the normal distribution with mean μ and variance σ2 constrained to the interval (l,u), T1(0,1|x>0) is the standard Cauchy distribution (T with 1 degree of freedom) constrained to the positive half-line, bw.disti is the ith logged between-channel pair distance and wi.disti is the ith logged within-channel pair distance. Note that the within-channel logged distances have a two-component mixture distribution reflecting the admixture of kin and non-kin cell pairs.
    1. Provide the model with informative priors if possible. For example, this protocol expects the kin cells to be closer to each other than non-kin cells, so this is provided as a prior for the mean of the distribution of the distances. Then, use the runjags27 and coda28 R packages and the JAGS29 program for parameter estimation (Rscript snippet_6_4.R).
  5. Execute the JAGS model with the number of chains corresponding to the number of available CPUs. Use Rscript snippet_6_5.R to perform this step. Allow the software to run until convergence.
  6. Use metrics to test for convergence of the algorithm, such as effective sample size (available with runjags), the Gelman-Rubin convergence diagnostic (available with runjags), and its autocorrelation (autocorr/autocorr.diag available in coda). Verify the goodness of fit of the estimated model for the nearest neighbor distances by inspecting a Q-Q plot, which plots a quantile-level comparison of actual and estimated values for nearest neighbor distances using Rscript snippet_6_6.R (Figure 4C,F). This script requires the user to edit the values in lines 25-29 of snippet_6_6.R based on the output from Command 6.
    NOTE: Ideally, an effective sample size (SSeff) of greater than 10,000 should be obtained for each of the parameters30. However, a SSeff greater than 2,500 may be suitable for some complex models. The Gelman Rubin diagnostic is 1.00 for perfect convergence and must be less than 1.05 for satisfactory convergence. High autocorrelation indicates slow mixing within chains and is an indicator of slow convergence. The autocorrelation plot must follow an exponential decay in case of a good model. The Q-Q plot of actual and modeled nearest-neighbor distributions (Figure 4C,F) should follow the diagonal as closely as possible.
  7. After verifying the accuracy of the models, obtain the probability of a pair of cells being kin as a function of their distance. To determine a threshold distance for determining whether within-channel cells are likely to be kin, identify the distance at which the probability for being kin drops below 0.5. This can be done using Rscript snippet_6_7.R.
    NOTE: Alternative thresholds can be chosen based on experimental goals. For some applications, thresholds may not be relevant and the probability of being a kin pair may be directly used to weight pairs of cells.

Access restricted. Please log in or start a trial to view this content.

Results

Following the protocol for neonatal cryoinjury should yield P21 hearts with and without injury. Cryoinjured hearts have a well-circumscribed injury while the surface of sham hearts is smooth and homogeneous. In cryoinjured hearts, the area of injury should be consistent from heart to heart. After microscopy, images similar to Figure 1 should be obtained. Note that the image resolution allows for identification of individual CMs and imaging conditions allow for each fluorophore to be resolved...

Access restricted. Please log in or start a trial to view this content.

Discussion

Multicolor lineage tracing is a powerful approach to identify patterns of organ growth with single cell resolution. However, a major limitation to multicolor lineage tracing is the need for sparse labeling of cells, which can reduce the sensitivity for identifying rare events. For organs like the heart with notoriously low levels of parenchymal cell turnover, this can lead to underestimates of growth responses. Presented here is a step-by-step protocol for performing clonal analysis of CM expansion during growth and rege...

Access restricted. Please log in or start a trial to view this content.

Disclosures

The authors have nothing to disclose.

Acknowledgements

This work was funded by an R03 HL144812 (RK), a Duke University Strong Start Physician Scientist Award (RK), a Mandel Foundation Seed Grant (RK), and a T32 HL007101 Training grant (DCC). We would additionally like to acknowledge Evelyn McCullough for assistance with mouse husbandry and Dr. Douglas Marchuk and Matthew Detter for helpful comments and discussion. Finally, we would like to thank Purushothama Rao Tata for kindly providing R26R-Rainbow mice.

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
#1.5 glass coverslipFisherScientific12-544E
6-O proleneEthicon8706H
Anti-fade mounting mediumFisherScientific00-4958-02
CO2 inhalational chamber
Cold pack
CryomoldsVWR15160-215
CryoprobeWorld Precision Instruments501313
Filter cubes
Gt(ROSA)26Sortm1(CAG-EGFP,-mCerulean,-mOrange,-mCherry)Ilw mice
ImageJ softwarehttps://imagej.net
KCl 1MFisherScientificLC187951
Leica CM3050 cryostat
Liquid Nitrogen
Microscissors, 6mmWorld Precision Instruments14003
Myh6-CreERT2 miceThe Jackson Laboratory005657
Needler holderWorld Precision Instruments14109
Paraformaldehyde 4%FisherScientificAC416785000
Phosphate buffered saline
Pythonhttps://www.python.org/
Rhttps://cran.r-project.org/
Rotating Shaker
Stereoscope
Sucrose 30% (wt/vol)FisherScientificBP220
Surgical dissecting scissorsWorld Precision Instruments14393
Syringe for tamoxifenVWRBD328438
Tamoxifen, 20 μgSigmaT5648
Tissue Freezing MediaVWR15148-031
White Frosted/Plus slidesGlobe Scientific1358W
Zeiss Axio Imager M1 upright widefield fluorescence system
Zen 2.5 Blue software

References

  1. Karra, R., Poss, K. D. Redirecting cardiac growth mechanisms for therapeutic regeneration. Journal of Clinical Investigation. 127 (2), 427-436 (2017).
  2. Bergmann, O., et al. Dynamics of Cell Generation and Turnover in the Human Heart. Cell. 161 (7), 1566-1575 (2015).
  3. Bergmann, O., et al. Evidence for cardiomyocyte renewal in humans. Science. 324 (5923), 98-102 (2009).
  4. Senyo, S. E., et al. Mammalian heart renewal by pre-existing cardiomyocytes. Nature. 493 (7432), 433-436 (2013).
  5. Mollova, M., et al. Cardiomyocyte proliferation contributes to heart growth in young humans. Proceedings of the National Academy of Sciences U.S.A. 110 (4), 1446-1451 (2013).
  6. Kikuchi, K., et al. Primary contribution to zebrafish heart regeneration by gata4(+) cardiomyocytes. Nature. 464 (7288), 601-605 (2010).
  7. Jopling, C., et al. Zebrafish heart regeneration occurs by cardiomyocyte dedifferentiation and proliferation. Nature. 464 (7288), 606-609 (2010).
  8. Oberpriller, J. O., Oberpriller, J. C. Response of the adult newt ventricle to injury. Journal of Experimental Zoology. 187 (2), 249-253 (1974).
  9. Oberpriller, J., Oberpriller, J. C. Mitosis in adult newt ventricle. Journal of Cell Biology. 49 (2), 560-563 (1971).
  10. Porrello, E. R., et al. Transient regenerative potential of the neonatal mouse heart. Science. 331 (6020), 1078-1080 (2011).
  11. Wang, H., et al. Natural Heart Regeneration in a Neonatal Rat Myocardial Infarction Model. Cells. 9 (1), (2020).
  12. Ye, L., et al. Early Regenerative Capacity in the Porcine Heart. Circulation. 138 (24), 2798-2808 (2018).
  13. Zhu, W., et al. Regenerative Potential of Neonatal Porcine Hearts. Circulation. 138 (24), 2809-2816 (2018).
  14. Kadow, Z. A., Martin, J. F. Distinguishing Cardiomyocyte Division From Binucleation. Circulation Research. 123 (9), 1012-1014 (2018).
  15. Roy, E., Neufeld, Z., Livet, J., Khosrotehrani, K. Concise review: understanding clonal dynamics in homeostasis and injury through multicolor lineage tracing. Stem Cells. 32 (12), 3046-3054 (2014).
  16. Livet, J., et al. Transgenic strategies for combinatorial expression of fluorescent proteins in the nervous system. Nature. 450 (7166), 56-62 (2007).
  17. Sereti, K. I., et al. Analysis of cardiomyocyte clonal expansion during mouse heart development and injury. Nature Communications. 9 (1), 1-13 (2018).
  18. Xiao, Q., et al. A p53-based genetic tracing system to follow postnatal cardiomyocyte expansion in heart regeneration. Development. 144 (4), 580-589 (2017).
  19. Ali, S. R., et al. Existing cardiomyocytes generate cardiomyocytes at a low rate after birth in mice. Proceedings of the National Academy of Sciences U.S.A. 111 (24), 8850-8855 (2014).
  20. Sohal, D. S., et al. Temporally regulated and tissue-specific gene manipulations in the adult and embryonic heart using a tamoxifen-inducible Cre protein. Circulation Research. 89 (1), 20-25 (2001).
  21. Red-Horse, K., Ueno, H., Weissman, I. L., Krasnow, M. A. Coronary arteries form by developmental reprogramming of venous cells. Nature. 464 (7288), 549-553 (2010).
  22. Polizzotti, B. D., et al. Neuregulin stimulation of cardiomyocyte regeneration in mice and human myocardium reveals a therapeutic window. Science Translational Medicine. 7 (281), 245(2015).
  23. Polizzotti, B. D., Ganapathy, B., Haubner, B. J., Penninger, J. M., Kuhn, B. A cryoinjury model in neonatal mice for cardiac translational and regeneration research. Nature Protocols. 11 (3), 542-552 (2016).
  24. Schindelin, J., et al. Fiji: an open-source platform for biological-image analysis. Nature Methods. 9 (7), 676-682 (2012).
  25. van Rossum, G. Python tutorial, Technical Report CS-R9526. Centrum voor Wiskunde en Informatica (CWI). , Amsterdam. (1995).
  26. Team, R. C. R: A language and environment for statistical computing. , (2013).
  27. Denwood, M. J. runjags: An R package providing interface utilities, model templates, parallel computing methods and additional distributions for MCMC models in JAGS. Journal of Statistical Software. 71 (9), 1-25 (2016).
  28. Plummer, M., Best, N., Cowles, K., Vines, K. CODA: convergence diagnosis and output analysis for MCMC. R News. 6 (1), 7-11 (2006).
  29. Plummer, M. Proceedings of the 3rd international workshop on distributed statistical computing. , Vienna, Austria. 1-10 (2003).
  30. Kruschke, J. Doing Bayesian data analysis: A tutorial with R, JAGS, and Stan. , Academic Press. (2014).
  31. Darehzereshki, A., et al. Differential regenerative capacity of neonatal mouse hearts after cryoinjury. Developmental Biology. 399 (1), 91-99 (2015).
  32. Kimura, W., et al. Hypoxia fate mapping identifies cycling cardiomyocytes in the adult heart. Nature. 523 (7559), 226-230 (2015).

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Request permission to reuse the text or figures of this JoVE article

Request Permission

Tags

Multicolor Lineage TracingCardiomyocyte ProliferationTissue RegenerationStatistical ModelingCardiomyocyte ClonesHeart FailureTissue Regeneration
Video Coming Soon

Related Articles