A subscription to JoVE is required to view this content. Sign in or start your free trial.

Method Article

Three-Dimensional Adipocyte Culture as a Model to Study Cachexia-Induced White Adipose Tissue Remodeling

2.7K views

DOI:

10.3791/61853

January 18th, 2021

In This Article

Summary

This protocol describes a three-dimensional (3D) magnetic printing culture system that permits dissection of white adipose tissue (WAT) remodeling induced by a conditioned medium from cancer cells. Using a 3D culture system of UCP1+ adipocytes that express a green fluorescent protein (GFP) allows the study of beige adipocytes contributing to adipose tissue remodeling.

Abstract

Cancer cachexia (CC) presents itself as a syndrome with multiple manifestations, causing a marked multi-organ metabolic imbalance. Recently, cachectic wasting has been proposed to be stimulated by several inflammatory mediators, which may disrupt the integrative physiology of adipose tissues and other tissues such as the brain and muscle. In this scenario, the tumor can survive at the host's expense. In recent clinical research, the intensity of depletion of the different fat deposits has been negatively correlated with the patient's survival outcome. Studies have also shown that various metabolic disorders can alter white adipose tissue (WAT) remodeling, especially in the early stages of cachexia development. WAT dysfunction resulting from tissue remodeling is a contributor to overall cachexia, with the main modifications in WAT consisting of morpho-functional changes, increased adipocyte lipolysis, accumulation of immune cells, reduction of adipogenesis, changes in progenitor cell population, and the increase of "niches" containing beige/brite cells.

To study the various facets of cachexia-induced WAT remodeling, particularly the changes progenitor cells and beige remodeling, two-dimensional (2D) culture has been the first option for in vitro studies. However, this approach does not adequately summarize WAT complexity. Improved assays for the reconstruction of functional AT ex vivo help the comprehension of physiological interactions between the distinct cell populations. This protocol describes an efficient three-dimensional (3D) printing tissue culture system based on magnetic nanoparticles. The protocol is optimized for investigating WAT remodeling induced by cachexia induced factors (CIFs). The results show that a 3D culture is an appropriate tool for studying WAT modeling ex vivo and may be useful for functional screens to identify bioactive molecules for individual adipose cell populations applications and aid the discovery of WAT-based cell anticachectic therapy.

Introduction

Living organisms are composed of cells in 3D microenvironments with cell-cell and cell-matrix interplay and elaborate transport dynamics for nutrients and cells1,2. However, most of the fundamental knowledge gained in cell biology has been generated using monolayer cell culture (2D). Although 2D culture can answer some of the mechanistic questions, this approach inadequately recapitulates the natural environment within which cells reside and may be incompatible with predicting a complex drug response1. Moreover, cells sense their physical surroundings through mechanotransduction. Indeed, mechanical forces are translated to biochemical signals that ultimately influence gene expression patterns and the cell's fate. In the last few decades, 3D tissue culture has emerged as a new in vitro tool that can mimic the in vivo microenvironment with greater fidelity. This can avoid some mechanistic pitfalls generated by in vitro 2D approaches3.

Cancer cachexia (CC) is defined as a syndrome with multiple manifestations, causing a marked multi-organ metabolic imbalance. During cachexia development, WAT undergoes numerous morphological changes resulting in increased adipocyte lipolysis, accumulation of immune cells, reduction in adipogenesis, progenitor cell population changes, and an increase in "niches" containing beige/brite cells (beige remodeling)4. However, recapitulating the mechanism by which cachexia affects WAT remodeling using in vitro models presents a significant technical challenge. Indeed, a few studies that attempted investigation of tumor/tissue communication have used monolayer in vitro cell culture (2D), circumventing the complexity of the 3D microenvironment of WAT.

Although several experimental approaches generate 3D culture, three different assembly methods are preferred to produce adipospheroids: magnetic levitation or printing5, hanging drop6, and Matrigel-scaffold systems7. Despite being appropriate for adipospheroids, these systems have advantages and disadvantages and should be chosen according to each experimental design's characteristics. Based on the limitations mentioned above, the magnetic printing method was used to generate 3D cell cultures5. This method uses a magnetic nanoparticle assembly consisting of gold nanoparticles and iron oxide, making the printing method suitable for most cell types. Here, 3D cell cultures were used to induce adipogenesis, and CIFs were used to reproduce CC's environmental condition.

Access restricted. Please log in or start a trial to view this content.

Protocol

1. Incubation of 2D cells with magnetic nanoparticles

  1. Grow adherent 2D cultures to ~ 70% confluence using standard cell culture procedures.
  2. Prepare the magnetic nanoparticle assembly. Take it out of the refrigerator and let it warm to room temperature (20-25 °C) for about 15 min1.
  3. Mixed medium: Add the magnetic nanoparticles directly to 12 mL of medium in 100 mm cell culture plates. Suspend and resuspend the medium a few times to obtain a homogeneous distribution of the nanoparticles.
    NOTE: The medium will appear dark because of the brown color of the iron oxide. A concentration of 2.5 µL/cm2 of the culture area is recommended.
  4. Wash the 100 mm 2D culture plate three times with phosphate-buffered saline (PBS).
  5. Add 12 mL of the mixed medium from step 1.3 to the 100 mm cell culture plates. Incubate the plates overnight in an incubator (37 °C, 5% CO2) to allow attachment of the magnetic nanoparticles to the cells

2. Creating 3D cultures with spheroid assembly in 96-well plates

  1. After overnight incubation, wash the cells to remove any residual medium and unattached magnetic nanoparticles by gently agitating the plates with 3 x 10 mL of PBS.
  2. Aspirate the PBS from the Petri dish and detach the cells by incubation with 0.25% trypsin-ethylenediamine tetraacetic acid (EDTA) solution for 2-5 min at 37 °C.
  3. While waiting for the cells to detach, disinfect the magnetic drives with 70% ethanol1.
  4. After the cells have detached, add serum-containing medium at 4x the volume of the trypsin-EDTA solution to neutralize trypsin's effect, and then transfer the suspension into a conical tube.
  5. Centrifuge the suspension, at 500 × g for 10 min. Aspirate the supernatant, taking care not to touch the pellet.
    NOTE: After centrifugation, the cells should appear brown, and cell suspensions in medium should appear darker than usual. Cells should appear peppered with the nanoparticles1.
  6. Count the cells in suspension and calculate the volume of medium volumes needed to create 3D cultures. For adipospheroids, use 5,000 to 10,000 cells in 150 µL in 96-well plates.
  7. Using a 96-well bioprinting kit, place a cell-repellent 96-well plate at the top of the Spheroid Drive.
  8. Pipette 150 µL of cell suspension into each well of the 96-well plate and close the plate to allow the cells to aggregate at the bottom in the shape of a magnet.
  9. Leave the plate on the spheroid drive in the incubator for 1-2 h to yield a competent spheroid.
    NOTE: These cultures should appear dense and brown and should be printed in the plate (Figure S1). Figure S2 presents a summary workflow of the main steps of 3D magnetic printing of spheroid assembly in 96-well plates.

3. White adipogenesis induction

  1. Prepare maintenance and induction media8; prepare induction medium before each use.
    1. Prepare maintenance medium containing 5 µg/mL of insulin (10 mg/mL stock stored at 4 °C for one week) and 0.5 µM rosiglitazone (10 mM stock in dimethyl sulfoxide (DMSO)).
    2. Prepare induction medium containing 125 µM indomethacin from a 0.125 M stock in ethanol, 2 µg/mL of dexamethasone from a 2 mg/mL stock in ethanol, 0.5 mM isobutyl-1-methylxanthine (IBMX) from a 0.25 M stock in DMSO, and 0.5 µM rosiglitazone from a 10 mM stock in DMSO.
      NOTE: Heat indomethacin to 60 °C to dissolve.
  2. After 24-48 h of printing spheroids, replace the regular complete medium with the induction medium (day 0).
  3. After 48 h (day 2), replace the induction medium with the maintenance medium.
  4. Change the medium every 3-5 days until the cells are fully differentiated.
    ​NOTE: Generally, after 7-8 days of stimulation with the induction medium, cells differentiate into mature fat cells and are filled with oil droplets that can be viewed at the edges of the adipospheroids.

4. Production of Lewis lung carcinoma conditioned medium ( LLC-CM)

  1. Seed Lewis lung carcinoma (LL/2) cells in 100 mm cell culture plates in growth medium at a density of 6000 cells/cm2.
    NOTE: The growth medium contains Dulbecco's modified Eagle's medium (DMEM) with 10% fetal bovine serum (FBS) and 100 U/mL of penicillin-streptomycin.
  2. After 2 days, replace the medium in each plate with fresh growth medium.
    NOTE: LL/2 cells contain a heterogeneous mix of adherent (higher number) and floating cells.
  3. After 2 days (day 4), harvest the conditioned medium, and clear it of cells and debris by centrifugation (500 × g, 10 min).
  4. Freeze aliquots of the conditioned medium in liquid nitrogen for later use.
    NOTE: To treat spheroids with the conditioned medium, use a combination of 75% fresh growth medium and 25% LLC-conditioned medium.

Access restricted. Please log in or start a trial to view this content.

Results

Adipospheroids from 3D culture of stromal vascular fraction (SVF) cells
Both 3D and confluent 2D cultures were set up with the same numbers of SVF cells from the same mouse inguinal WAT preparation (Figure 1A, Figure 1B) and subjected to the same experimental protocol to compare gene expression marker. Spheroids stimulated with induction medium expanded over time. Figure 2B shows...

Access restricted. Please log in or start a trial to view this content.

Discussion

This protocol sets up a 3D cell culture system to study adipocyte differentiation in adipospheroids derived from primary SVF cells from WAT. Compared to conventional 2D adherent culture, this 3D system facilitates AT remodeling, which closely resembles in vivo conditions. In the last few years, studies have shown that culturing cells in 3D yields distinct cellular morphology and signaling compared to a 2D culture system3. Fibroblast morphology in 3D is different from that found in 2D

Access restricted. Please log in or start a trial to view this content.

Disclosures

The authors declare that they have no competing financial interests.

Acknowledgements

This work was supported by grants from the NIH DK117161, DK117163 to SRF, and P30-DK-046200 to Adipose Biology and Nutrient Metabolism Core of Boston Nutrition and Obesity Research Center, and by São Paulo Research Foundation (FAPESP) Grants: 2018/20905-1 and CNPq 311319/2018-1 to MLBJr.

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
3-Isobutyl-1-methylxanthineSigma-Aldrich (St. Louis, MO, USA)I-5879Cell culture
96-Well Bioprinting Kit, blackGreiner (Monroe, NC, USA)655841Cell culture
Alexa Fluor 647 AffiniPure F(ab')2 Fragment Donkey Anti-Rabbit IgG (H+L)Jackson ImmunoResearch711-606-152Immunofluorescence staining, secondary, 1:400 in TBS with 0.1% Tween-20
CELL CULTURE MICROPLATE, 96 WELL, PS, F-BOTTOM, µCLEAR, BLACK, CELLSTAR, CELL-REPELLENT SURFACE, LID, STERILE, 8 PCS./BAGGreiner (Monroe, NC, USA)655976Cell culture
DexamethasoneSigma-Aldrich (St. Louis, MO, USA)D-1756Cell culture
DMEMCorning (Manassas, VA, USA)10-017-CVCell culture
Fetal Bovine Serum (Tova)Gemini Bio (West Sacramento, CA)100-500Cell culture
IndomethacinSigma-Aldrich (St. Louis, MO, USA)I-7378Cell culture
InsulinSigma-Aldrich (St. Louis, MO, USA)I0516Cell culture
LL/2 (LLC1) (ATCC CRL-1642)American Type Culture Collection (Manassas, VA, USA)CRL-1642Lewis Lung Carcinoma cell line
NanoShuttle-PLGreiner (Monroe, NC, USA)657843Cell culture
NucBlue Fixed Cell ReadyProbes Reagent (DAPI)ThermoFisher (Waltham, MA, USA)R37606Immunofluorescence staining, following the manufacturer's instructions
Pen strepCorning (Manassas, VA, USA)30-002-CICell culture
Perilipin-1 (D1D8) XP Rabbit mAbCell Signaling Technology (Danvers, MA, USA)9349Immunofluorescence staining, primary, 1:1000 in TBS with 0.1% Tween-20
RosiglitazoneSigma-Aldrich (St. Louis, MO, USA)R-2408Cell culture
Trypsin-EDTA, 0.05%Corning (Manassas, VA, USA)25-052-CICell culture
Reverse-transcription PCR primers
PrimerForwardReverse
AdipoqGTTCCCAATGTACCCATTCGCTGTTGCAGTAGAACTTGCCAG
Col4a1TCCAAGGGCGAAGTGGGTTTACCCTTGCTCGCCTTTGACT
Cyclophilin aATGGCACTGGCGGCAGGTCCTTGCCATTCCTGGACCCAAA
Fabp4TGGTGACAAGCTGGTGGTGGAATGTCCAGGCCTCTTCCTTTGGCTCA
Fn1GCTTCCCCAACTGGTTACCCTGGGTTGGTGATGAAGGGGGT
Pgc1aGAAAACAGGAACAGCAGCAGAGGGGGTCAGAGGAAGAGATAAAG
Ucp1TCCTAGGGACCATCACCACCCAGCCGGCTGAGATCTTGTTTCC
Mouse genotyping
Primer nameDescriptionSequence
Cre FGeneric Cre forwardGCG GTC TGG CAG TAA AAA CTA TC
Cre RGeneric Cre reverseGTG AAA CAG CAT TGC TGT CAC TT
oIMR7318mT/mG forwardCTC TGC TGC CTC CTG GCT TCT
oIMR7319mT/mG wild type reverseCGA GGC GGA TCA CAA GCA ATA
oIMR7320mT/mG mutant reverseTCA ATG GGC GGG GGT CGT T
WH336UCP1 mutant forwardCAA TCT GGG CTT AAC GGG TCC TC
WH337UCP1 mutant reverseGTT GCA TCG ACC GGT TAA TGC AG
WH338UCP1 wild type forwardGGT CAG CCT AAT TAG CTC TGT
WH339UCP1 wild type reverseGAT CTC CAG CTC CTC CTC TGT C

References

  1. Haisler, W. L., et al. Three-dimensional cell culturing by magnetic levitation. Nature Protocol. 8 (10), 1940-1949 (2013).
  2. Pampaloni, F., Reynaud, E. G., Stelzer, E. H. The third dimension bridges the gap between cell culture and live tissue. Nature Reviews Molecular Cell Biology. 8 (10), 839-845 (2007).
  3. Eisenstein, M. Organoids: the body builders. Nature Methods. 15 (1), 19-22 (2018).
  4. Henriques, F., Júnior, M. L. B. Adipose tissue remodeling during cancer-associated cachexia: Translational features from adipose tissue dysfunction. Immunometabolism. 2 (4), 200032(2020).
  5. Tseng, H., et al. A spheroid toxicity assay using magnetic 3D bioprinting and real-time mobile device-based imaging. Scientific Reports. 5 (1), 13987(2015).
  6. Akama, T., Leung, B. M., Labuz, J., Takayama, S., Chun, T. H. Designing 3-D adipospheres for quantitative metabolic study. Methods Molecular Biology. 1566, 177-183 (2017).
  7. Muller, S., et al. Human adipose stromal-vascular fraction self-organizes to form vascularized adipose tissue in 3D cultures. Scientific Reports. 9 (1), 7250(2019).
  8. Aune, U. L., Ruiz, L., Kajimura, S. Isolation and differentiation of stromal vascular cells to beige/brite cells. Journal of Visualized Experiments. (73), e50191(2013).
  9. Henriques, F., et al. Toll-like receptor-4 disruption suppresses adipose tissue remodeling and increases survival in cancer cachexia syndrome. Scientific Reports. 8 (1), 18024(2018).
  10. Kir, S., et al. Tumour-derived PTH-related protein triggers adipose tissue browning and cancer cachexia. Nature. 513 (7516), 100-104 (2014).
  11. Petruzzelli, M., et al. A switch from white to brown fat increases energy expenditure in cancer-associated cachexia. Cell Metabolism. 20 (3), 433-447 (2014).
  12. Lopes, M. A., Oliveira Franco, F., Henriques, F., Peres, S. B., Batista, M. L. LLC tumor cells-derivated factors reduces adipogenesis in co-culture system. Heliyon. 4 (7), 00708(2018).
  13. Wang, H., Liu, L., Lin, J. Z., Aprahamian, T. R., Farmer, S. R. Browning of white adipose tissue with roscovitine induces a distinct population of UCP1(+) adipocytes. Cell Metabolism. 24 (6), 835-847 (2016).
  14. Grinnell, F. Fibroblast biology in three-dimensional collagen matrices. Trends Cell Biology. 13 (5), 264-269 (2003).
  15. Vidi, P. A., Bissell, M. J., Lelievre, S. A. Three-dimensional culture of human breast epithelial cells: the how and the why. Methods Molecular Biology. 945, 193-219 (2013).
  16. Fisher, M. F., Rao, S. S. Three-dimensional culture models to study drug resistance in breast cancer. Biotechnology Bioengineering. 117 (7), 2262-2278 (2020).

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Tags

Cachexia Induced WAT RemodelingMagnetic Nanoparticle SystemProgenitor CellsBeige RemodelingAdipocyte LipolysisAdipogenesis ReductionImmune Cell AccumulationBeige Brite Cells
Video Coming Soon