A subscription to JoVE is required to view this content. Sign in or start your free trial.

Method Article

Mapping R-Loops and RNA:DNA Hybrids with S9.6-Based Immunoprecipitation Methods

3.9K views

DOI:

10.3791/62455

August 24th, 2021

In This Article

Summary

R-loops constitute a prevalent class of transcription-driven non-B DNA structures that occur in all genomes depending on both DNA sequence and topological favorability. In recent years, R-loops have been implicated in a variety of adaptive and maladaptive roles and have been linked to genomic instability in the context of human disorders. As a consequence, the accurate mapping of these structures in genomes is of high interest to many investigators. DRIP-seq (DNA:RNA Immunoprecipitation followed by high throughput sequencing) is described here. It is a robust and reproducible technique that permits accurate and semi-quantitative mapping of R-loops. A recent iteration of the method is also described in which fragmentation is accomplished using sonication (sDRIP-seq), which allows strand-specific and high-resolution mapping of R-loops. sDRIP-seq thus addresses some of the common limitations of the DRIP-seq method in terms of resolution and strandedness, making it a method of choice for R-loop mapping.

Abstract

R-loops constitute a prevalent class of transcription-driven non-B DNA structures that occur in all genomes depending on both DNA sequence and topological favorability. In recent years, R-loops have been implicated in a variety of adaptive and maladaptive roles and have been linked to genomic instability in the context of human disorders. As a consequence, the accurate mapping of these structures in genomes is of high interest to many investigators. DRIP-seq (DNA:RNA Immunoprecipitation followed by high throughput sequencing) is described here. It is a robust and reproducible technique that permits accurate and semi-quantitative mapping of R-loops. A recent iteration of the method is also described in which fragmentation is accomplished using sonication (sDRIP-seq), which allows strand-specific and high-resolution mapping of R-loops. sDRIP-seq thus addresses some of the common limitations of the DRIP-seq method in terms of resolution and strandedness, making it a method of choice for R-loop mapping.

Introduction

R-loops are three-stranded nucleic acid structures that form primarily during transcription upon hybridization of the nascent RNA transcript to the template DNA strand. This results in the formation of an RNA:DNA hybrid and causes the displacement of the non-template DNA strand in a single-stranded looped state. Biochemical reconstitution1,2,3,4 and mathematical modeling5, in combination with other biophysical measurements6,7, have established that R-loops are more likely to occur over regions that exhibit specific favorable characteristics. For instance, regions that display strand asymmetry in the distribution of guanines (G) and cytosines (C) such that the RNA is G-rich, a property called positive GC skew, are favored to form R-loops when transcribed owing to the higher thermodynamic stability of the DNA:RNA hybrid compared to the DNA duplex8. Regions that have evolved positive GC skew, such as the early portions of many eukaryotic genes4,9,10,11, are prone to forming R-loops in vitro and in vivo3,4,12. Negative DNA superhelical stress also greatly favors structure formation13,14 because R-loops efficiently absorb such topological stresses and return the surrounding DNA fiber to a favorable relaxed state5,15.

Historically, R-loop structures were considered to result from rare, spontaneous, entanglements of RNA with DNA during transcription. However, the development of DNA:RNA immunoprecipitation (DRIP) coupled with high-throughput DNA sequencing (DRIP-seq) allowed the first genome-wide mapping of R-loops and revealed that those structures are far more prevalent than expected in human cells4,16. R-loops occur over tens of thousands of conserved, transcribed, genic hotspots in mammalian genomes, with a predilection for GC-skewed CpG islands overlapping the first intron of genes and the terminal regions of numerous genes17. Overall, R-loops collectively occupy 3%-5% of the genome in human cells, consistent with measurements in other organisms, including yeasts, plants, flies, and mice18,19,20,21,22.

Analysis of R-loop forming hotspots in human cells revealed that such regions associate with specific chromatin signatures23. R-loops, in general, are found over regions with lower nucleosome occupancy and higher RNA polymerase density. At promoters, R-loops associate with increased recruitment of two co-transcriptionally deposited histone modifications, H3K4me1 and H3K36me317. At gene termini, R-loops associate with closely arranged genes that undergo efficient transcription termination17, consistent with prior observations24. R-loops were also shown to participate in the initiation of DNA replication at the replication origins of bacteriophage, plasmid, mitochondrial, and the yeast genomes25,26,27,28,29,30,31. In addition, 76% of R-loop-prone human CpG island promoters function as early, constitutive replication origins32,33,34,35, further reinforcing the connections between R-loops and replication origins. Collectively, these studies suggest that R-loops represent a novel type of biological signal that can trigger specific biological outputs in a context-dependent manner23.

Early on, R-loops were shown to form at class switch sequences during the process of immunoglobulin class switch recombination3,36,37. Such programmed R-loops are thought to initiate class switch recombination through the introduction of double-stranded DNA breaks38. Since then, harmful R-loop formation, generally understood to result from excessive R-loop formation, has been linked to genomic instability and processes such as hyper recombination, transcription-replication collisions, replication, and transcriptional stress (for review39,40,41,42,43). As a consequence, improved mapping of R-loop structures represents an exciting and essential challenge to better decipher the distribution and function of these structures in health and disease.

DNA:RNA immunoprecipitation (DRIP) relies on high affinity of the S9.6 monoclonal antibody for DNA:RNA hybrids44. DRIP-seq permits robust genome-wide profiling of R-loop formation4,45. While useful, this technique suffers from limited resolution due to the fact that restriction enzymes are used to achieve gentle DNA fragmentation. In addition, DRIP-seq does not provide information on the directionality of R-loop formation. Here, we report a variant of DRIP-seq that permits the mapping of R-loops at high resolution in a strand-specific manner. This method relies on sonication to fragment the genome prior to immunoprecipitation and the method is thus called sDRIP-seq (sonication DNA:RNA immunoprecipitation coupled with high throughput sequencing) (Figure 1). The use of sonication permits an increased resolution and limits restriction enzyme-linked fragmentation biases observed in DRIP-seq approaches46. sDRIP-seq produces R-loop maps that are in strong agreement with the results from both DRIP-seq and the previously described high-resolution DRIPc-seq method in which sequencing libraries are built from the RNA strands of immunoprecipitated R-loop structures45.

Faced with a plethora of methods to choose from, users may wonder which particular DRIP-based approach is preferable for their needs. We offer the following advice. DRIP-seq, despite its limitations, is technically easiest and is the most robust (highest yields) of all three methods discussed here; it thus remains broadly useful. Numerous DRIP-seq datasets have been published, which provide a useful comparison point for new datasets. Finally, the bioinformatic analysis pipeline is simpler as the data is not stranded. It is recommended that new users begin honing their R-loop mapping skills with DRIP followed by quantitative polymerase chain reaction (qPCR) and DRIP-seq. sDRIP-seq represents a slightly higher degree of technical difficulty: the yields are slightly reduced due to sonication (discussed below) and the sequencing library process is slightly more complex. Yet, the gain of strandedness and higher resolution is invaluable. It is noted that sDRIP-seq will capture both two-stranded RNA:DNA hybrids and three-stranded R-loops. Due to the library construction steps, DRIP-seq will not capture two-stranded RNA:DNA hybrids. DRIPc-seq is the most technically demanding and requires higher amount of starting materials. In return, it offers the highest resolution and strandedness. Because sequencing libraries are built from the RNA moiety of R-loops or hybrids, DRIPc-seq may suffer from possible RNA contamination, especially since S9.6 possesses residual affinity for dsRNA19,47,48. sDRIP-seq permits strand-specific, high resolution mapping without worries about RNA contamination since sequencing libraries are derived from DNA strands. Overall, these three methods remain useful and present differing degrees of complexity and slightly different caveats. All three, however, produce highly congruent datasets48 and are highly sensitive to RNase H pre-treatment, which represents an essential control to ensure signal specificity45,49. It is noted that given the size selection imposed on sequencing libraries, small hybrids (estimated <75 bp), such as those forming transiently around lagging strand DNA replication priming sites (Okazaki primers) will be excluded. Similarly, since all DRIP methods involve DNA fragmentation, unstable R-loops that require negative DNA supercoiling for their stability will be lost5. Thus, DRIP approaches may underestimate R-loop loads, especially for short, unstable R-loops that may be best captured using in vivo approaches45,48. It is noted that R-loops can also be profiled in an S9.6-independent manner at deep coverage, high-resolution, and in a strand-specific manner on single DNA molecules after sodium bisulfite treatment12. Additionally, strategies using a catalytically inactive RNase H1 enzyme have been employed to map native R-loops in vivo, highlighting short, unstable R-loops that form primarily at paused promoters50,51,52.

Access restricted. Please log in or start a trial to view this content.

Protocol

The following protocol is optimized for the human Ntera-2 cell line grown in culture, but it has been successfully adapted without modification to a range of other human cell lines (HEK293, K562, HeLa, U2OS), primary cells (fibroblasts, B-cells) as well as in other organisms with small modifications (mice, flies).

1. Cell harvest and lysis

  1. Culture Ntera-2 cells to 75%-85% confluency. Ensure that the optimal cell count is 5 to 6 million cells with >90% viable counts to start any DRIP procedure.
  2. Wash the cells once with 1x PBS, add 1.5 mL of Trypsin-EDTA 1x, and then incubate for 2 min at 37 °C until the cells dissociate from the dish.
  3. Add 5 mL of warm media and pipette well to resuspend cells into a single cell suspension. Transfer the content into a new 15 mL tube and gently pellet the cells at 300 x g for 3 min.
  4. Wash the cells once with 5 mL of 1x PBS and gently pellet the cells at 300 x g for 3 min.
  5. Fully resuspend the cells in 1.6 mL of TE buffer (10 mM Tris-Cl pH 7.5, 1 mM EDTA pH 8.0). Add 5 µL of proteinase K (20 mg/mL stock solution) and 50 µL of SDS (20% stock solution) and gently invert the tubes five times until the solution become viscous. Do not try to pipette the solution, only mix by inversion.
  6. Incubate the tubes overnight at 37 °C.

2. DNA extraction

  1. Pour the DNA lysate into a pre-spun 15 mL high density phase lock gel tube and add 1 volume (1.6 mL) of Phenol/Chloroform Isoamyl alcohol (25:24:1). Gently invert five times and spin down at 1,500 x g for 5 min.
  2. Add 1/10 volume of 3 M sodium acetate (NaOAc) (pH 5.2) and 2.5 volumes of 100% Ethanol to a new 15 mL tube. Pour in the top aqueous phase from the phase lock gel tube and gently invert until the DNA is fully precipitated (up to 10 min).
  3. Spool the DNA threads using a wide bore 1,000 µL tip and transfer to a clean 2 mL tube while taking care not to carry over the residual supernatant.
  4. Wash the DNA by adding 1.5 mL of 80% ethanol and gently invert the tube five times. Incubate for 10 min.
  5. Repeat the previous step twice. Do not centrifuge during the wash steps. Carefully remove as much ethanol as possible by pipetting after the last wash while trying not to disturb the DNA.
  6. Allow the DNA to air dry completely while inverting the tube. This step can take 30 min -1 h depending on the amount of DNA.
  7. Add 125 µL of TE buffer directly on the DNA pellet to fragment the DNA through restriction enzyme digestion or 100 µL of TE buffer to shear the DNA through sonication. Keep on ice for 1 h and gently resuspend the DNA by pipetting a few times with a wide bore 200 µL tip. Leave on ice for 1 h before starting the fragmentation step.

3. DNA fragmentation

NOTE: For restriction enzyme-based DRIP-seq, follow step 3.1. For sonication-based DRIP-seq, skip to step 3.2.

  1. Restriction enzyme (RE) fragmentation
    1. Digest the resuspended genomic DNA (very viscous) using a cocktail of REs according to supplier's instructions.
      1. Add 0.1 mM spermidine to the final reaction. Use a cocktail of 4-5 enzymes with 30 U of each enzyme in a total volume of 150 µL.
        NOTE: The initial cocktail for DRIP-seq (HindIII, SspI, EcoRI, BsrGI, XbaI)4 was developed to generate an average fragment length of 5 kilobases. Avoid any interference with CpG methylation and spare GC-rich regions of the genome. Other cocktails are also possible16). These cocktails are suitable for both the human and mouse genomes but can be adjusted as needed.
      2. Incubate the reaction mixture overnight at 37 °C.
        NOTE: The DNA mixture post digest should no longer be viscous. Any remaining viscosity at this step is indicative of an incomplete digestion.
      3. If observed, add an additional 10 U of each enzyme and incubate for another 2-4 h at 37 °C.
        NOTE: Users may not digest the entire pellet in the event they harvested more cells than recommended here.
    2. Gently pipette the overnight digested DNA (150 µL) into a pre-spun 2 mL phase lock gel light tube. Add 100 µL of water and one volume (250 µL) of Phenol/Chloroform Isoamyl alcohol (25:24:1). Gently invert five times and spin down at 16,000 x g for 10 min.
    3. Add 1.5 µL of glycogen, 1/10 volume of 3 M NaOAc (pH 5.2) and 2.5 volumes of 100% Ethanol to a new 1.5 mL tube. Pipette the DNA from the phase lock gel tube and mix by inverting five times. Incubate for 1 h at -20 °C.
    4. Spin at 16,000 x g for 35 min at 4 °C. Wash the DNA with 200 µL of 80% ethanol and spin at 16,000 x g for 10 min at 4 °C.
    5. Air dry the pellet and add 50 µL of TE buffer to the pellet. Leave the tube on ice for 30 min and gently resuspend the DNA.
    6. Measure the concentration (OD260) of the fragmented DNA using a spectrophotometer.
    7. Optional but recommended: Load 1 µg of digested DNA on a 0.8% agarose gel alongside a size marker to verify that the digestion is complete. Run the gel for an hour at 100 V.
      NOTE: If incomplete, additional enzyme can be added. Incomplete digestion can lead to the loss of resolution after immunoprecipitation.
    8. After this step, treat 10 µg of digested DNA with 4 µL of ribonuclease H (RNase H) for 1-2 h at 37 °C to ensure that the signal retrieved upon immunoprecipitation is derived from DNA:RNA hybrids. Then, proceed to S9.6 immunoprecipitation (step 4).
      ​NOTE: The digested DNAs can be kept frozen at -80 °C for up to one month without significant loss of yield.
  2. Sonication
    1. Sonicate all or a part of the extracted DNA in a 0.5 mL microcentrifuge tube in 100 µL total volume. Perform 15-20 cycles of 30 s ON / 30 s OFF on a sonicator (spin after 5, 10, and 15 cycles to ensure homogeneous sonication).
    2. Measure the concentration (OD260) of sonicated DNA on a spectrophotometer.
      NOTE: At this step, the viscosity of the DNA should have disappeared.
    3. Run an agarose gel to confirm the size distribution of the sonicated DNA (300-500 bp).
      ​NOTE: Over-sonicating the DNA can lead to significant reduction in yield resulting from breakage and dissociation of R-loop structures.
    4. After this step, treat 10 µg of sonicated DNA with 4 µL of RNase H for 1-2 h at 37 °C to ensure that the signal retrieved upon immunoprecipitation is derived from DNA:RNA hybrids. Then, proceed to S9.6 immunoprecipitation (step 4).

4. S9.6 immunoprecipitation

NOTE: The immunoprecipitation steps are similar regardless of whether DNA was fragmented through REs or sonication.

  1. Prepare three tubes and aliquot 4.4 µg of fragmented DNA in a final volume of 500 µL of TE buffer per tube. Save 50 µL (1/10 of the volume) from each tube to use later as an input DNA.
  2. Add 50 µL of 10x binding buffer (100 mM NaPO4 pH 7, 1.4 M NaCl, 0.5% Triton X-100) and 10 µL of S9.6 antibody (1 mg/mL) to the 450 µL of the diluted DNA.
  3. Incubate overnight at 4 °C on a mini-tube rotator at 7-10 rpm.
  4. For each tube, wash 50 µL of Protein A/G agarose bead slurry with 700 µL of 1x binding buffer by inverting the tubes on a mini-rotator at 7-10 rpm at room temperature for 10 min. Spin down the beads at 1,100 x g for 1 min and discard the supernatant. Repeat this step once.
  5. Add the DNA from step 4.3 to the 50 µL of beads and incubate for 2 h at 4 °C while inverting at 7-10 rpm on a mini-rotator.
  6. Spin down the beads for 1 min at 1,100 x g and discard the supernatant.
  7. Wash the beads with 750 µL of 1x binding buffer by inverting at 7-10 rpm on a mini-rotator for 15 min. Spin down for 1 min at 1,100 x g and discard the supernatant. Repeat this step once.
  8. Add 250 µL of the elution buffer (50 mM Tris-Cl pH 8, 10 mM EDTA pH 8, 0.5% SDS) and 7 µL of proteinase K (20 mg/mL stock) to the beads and incubate with rotation at 55 °C (12 rpm) for 45 min.
  9. Spin down the beads for 1 min at 1,100 x g. Transfer the supernatant to a pre-spun 2 mL phase lock gel light tube and add one volume (250 µL) of Phenol/Chloroform Isoamyl alcohol (25:24:1). Invert the tubes five times and spin down for 10 min at 16,000 x g at room temperature.
  10. Add 1.5 µL of glycogen, 1/10 volume 3M NaOAc (pH 5.2) and 2.5 volumes of 100% Ethanol to a new 1.5 mL tube. Pipette the DNA from the phase lock gel tube and mix by inverting five times. Incubate for 1 h at -20 °C.
  11. Spin at 16,000 x g for 35 min at 4 °C. Wash the DNA with 200 µL of 80% ethanol and spin at 16,000 x g for 10 min at 4 °C.
  12. Air dry the pellets and add 15 µL of 10 mM Tris-Cl (pH 8) in each tube. Leave the tubes on ice for 20 min and gently resuspend. Combine the contents of the three tubes into one tube (45 µL).
  13. Check the DRIP efficiency by qPCR using 5 µL of the 45 µL resuspended DNA (see Representative Results). Dilute the 5 µL in 10 µL of water and use 2 µL per reaction.

5. Pre-library step for sonicated DNA only

NOTE: Sonication leads the displaced ssDNA strand of R-loops to break. Thus, three-stranded R-loop structures are converted into two-stranded DNA:RNA hybrids upon sonication. As a result, these DNA:RNA hybrids must be converted back to double-stranded DNA prior to library construction. Here, a second strand synthesis step is employed. An alternative approach that has been successfully used is to instead perform a single-stranded DNA ligation followed by a second strand synthesis53.

  1. To the 40 µL of DRIP'ed DNA from step 4.12, add 20 µL of 5x second strand buffer (200 mM Tris pH 7, 22 mM MgCl2, 425 mM KCl), 10 mM dNTP mix (dATP, dCTP, dGTP, and dTTT or dUTP if the user is planning to achieve strand-specific DRIP sequencing), 1 µL 16 mM NAD, and 32 µL water. Mix well and incubate for 5 min on ice.
  2. Add 1 µL of DNA polymerase I (10 units), 0.3 µL of RNase H (1.6 units) and 0.5 µL of E. coli DNA ligase. Mix and incubate at 16 °C for 30 min.
  3. Immediately clean up the reaction using paramagnetic beads with a ratio of 1.6x. Elute the DNA in 40 µL of 10 mM Tris-Cl (pH 8).

6. Pre-library sonication step for RE DNA only

NOTE: DRIP leads to the recovery of RE fragments that are often kilobases in length and thus not suited for immediate library construction.

  1. To reduce the size of the material for library construction, sonicate the immunoprecipitated DNA in a 0.5 mL microcentrifuge tube. Perform 12 cycles of 15 s ON / 60 s OFF on a sonicator (spin after six cycles to ensure homogeneous sonication). Proceed to step 7.
    NOTE: The immunoprecipitated material still carries the three-stranded R-loops which respond to sonication differently than the flanking double-stranded DNA.
  2. Optional step: To even out DRIP profiles, treat the immunoprecipitated material with 1 µL of RNase H in 1x RNase H buffer for 1 h at 37 °C prior to sonication.

7. Library construction

  1. Perform end repair by adding to the 40 µL from step 4.12 (RE fragmentation) or step 5.3 (sonication shearing) 5 µL of 10x end repair module buffer, 2.5 µL of 10 mM ATP and 2.5 µL of End repair module enzyme (50 µL total). Mix well and incubate for 30 min at room temperature. Include 1 µg of RE-digested and sonicated (DRIP) or sonicated (sDRIP) input DNA to create control sequencing libraries corresponding to the input DNA.
  2. Clean up the reaction using paramagnetic beads (1.6x ratio) and elute in 34 µL of 10 mM Tris-Cl (pH 8).
  3. Perform A-tailing by adding 5 µL of buffer 2, 10 µL of 1 mM dATP, and 1 µL of Klenow exo- (50 µL total). Mix well and incubate the mixture for 30 min at 37 °C.
  4. Clean up the reaction using paramagnetic beads (1.6x ratio) and elute in 12 µL of 10 mM Tris-Cl (pH 8).
  5. Ligate adapters by adding 15 µL of 2x quick ligation buffer, 1 µL of 15 µM adapters, and 2 µL of quick ligase (30 µL total). Mix well and incubate for 20 min at room temperature.
  6. Clean up the reaction using paramagnetic beads (1x ratio) and elute in 20 µL of 10 mM Tris-Cl (pH 8).
  7. If sonication shearing was performed and dUTP was used in step 5.1, add 1.5 µL (1.5 U) of Uracil N-glycosylase and incubate for 30 min at 37 °C to obtain a strand-specific DRIP.
  8. PCR amplify 10 µL of the library from step 6.6 or 6.7. Add 1 µL of PCR primer 1.0 P5 (see Table of Materials), 1 µL of PCR primer 2.0 P7 (see Table of Materials), 15 µL of master mix, and 3 µL of water. Mix well.
  9. In a thermo cycler, run the program as shown in Table 1.
  10. Proceed to a two-step clean-up of the library using paramagnetic beads. First use a ratio of 0.65x to remove fragments over 500 bp. Keep the supernatant. Proceed to a 1x ratio on the supernatant to remove fragments under 200 bp. Elute in 12 µL of 10 mM Tris-HCl (pH 8).

8. Quality control

  1. To check R-loop enrichments with qPCR on two negative and three positive loci using the Pfaffl method, use 1 µL of the clean-up library from step 6.10. Dilute 1 µL of the library in 10 µL of water and use 2 µL per locus.
  2. Check the size distribution of the cleaned-up library from step 6.10 using a high sensitivity DNA kit.

Access restricted. Please log in or start a trial to view this content.

Results

DRIP as well as sDRIP can be analyzed through qPCR (Figure 2A) and/or sequencing (Figure 2B). After the immunoprecipitation step, the quality of the experiment must be first confirmed by qPCR on positive and negative control loci, as well as with RNase H-treated controls. Primers corresponding to frequently used loci in multiple human cell lines are provided in Table 2. The results from qPCR should be displayed as a percentage of input, which co...

Access restricted. Please log in or start a trial to view this content.

Discussion

Described here are two protocols to map R-loop structures in potentially any organism using the S9.6 antibody. DRIP-seq represents the first genome-wide R-loop mapping technique developed. It is an easy, robust, and reproducible technique that allows one to map the distribution of R-loops along any genome. The second technique, termed sDRIP-seq, is also robust and reproducible but achieves higher resolution and strand-specificity owing to the inclusion of a sonication step and a stranded sequencing library construction p...

Access restricted. Please log in or start a trial to view this content.

Disclosures

The authors declare no conflicts of interest.

Acknowledgements

Work in the Chedin lab is supported by a grant from the National Institutes of Health (R01 GM120607).

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
15 mL tube High density Maxtract phase lock gelQiagen129065
2 mL tube phase lock gel lightVWR10847-800
Agarose A/G beadsThermoFisher Scientific20421
Agencourt AMPure XP beadsBeckman CoulterA63881
AmpErase Uracil N-glycosylaseThermoFisher ScientificN8080096
Index adaptersIlluminaCorresponds to the TrueSeq Single indexes
Klenow fragment (3’ to 5’ exo-)New England BioLabsM0212S
NEBNext End repair moduleNew England BioLabsE6050
PCR primers for library amplificationprimer 1.0 P5 (5’ AATGATACGGCGACCACCGAGA
TCTACACTCTTTCCCTACACGA 3’)
PCR primers for library amplificationPCR primer 2.0 P7 (5’ CAAGCAGAAGACGGCATACG
AGAT 3’)
Phenol/Chloroform Isoamyl alcohol 25:24:1Affymetrix75831-400ML
Phusion Flash High-Fidelity PCR master mixThermoFisher ScientificF548S
Quick Ligation KitNew England BioLabsM2200S
Ribonuclease HNew England BioLabsM0297S
S9.6 AntibodyKerafastENH001These three sources are equivalent
S9.6 AntibodyMillipore/SigmaMABE1095
S9.6 AntibodyAbcamab234957

References

  1. Reaban, M. E., Lebowitz, J., Griffin, J. A. Transcription induces the formation of a stable RNA.DNA hybrid in the immunoglobulin alpha switch region. The Journal of Biological Chemistry. 269 (34), 21850-21857 (1994).
  2. Daniels, G. A., Lieber, M. R. RNA:DNA complex formation upon transcription of immunoglobulin switch regions: implications for the mechanism and regulation of class switch recombination. Nucleic Acids Research. 23 (24), 5006-5011 (1995).
  3. Yu, K., Chedin, F., Hsieh, C. L., Wilson, T. E., Lieber, M. R. R-loops at immunoglobulin class switch regions in the chromosomes of stimulated B cells. Nature Immunology. 4 (5), 442-451 (2003).
  4. Ginno, P. A., Lott, P. L., Christensen, H. C., Korf, I., Chedin, F. R-loop formation is a distinctive characteristic of unmethylated human CpG island promoters. Molecular Cell. 45 (6), 814-825 (2012).
  5. Stolz, R., et al. Interplay between DNA sequence and negative superhelicity drives R-loop structures. Proceedings of the National Academy of Sciences of the United States of America. 116 (13), 6260-6269 (2019).
  6. Duquette, M. L., Handa, P., Vincent, J. A., Taylor, A. F., Maizels, N. Intracellular transcription of G-rich DNAs induces formation of G-loops, novel structures containing G4 DNA. Genes & Development. 18 (13), 1618-1629 (2004).
  7. Carrasco-Salas, Y., et al. The extruded non-template strand determines the architecture of R-loops. Nucleic Acids Research. 47 (13), 6783-6795 (2019).
  8. Huppert, J. L. Thermodynamic prediction of RNA-DNA duplex-forming regions in the human genome. Molecular Biosystems. 4 (6), 686-691 (2008).
  9. Hartono, S. R., Korf, I. F., Chedin, F. GC skew is a conserved property of unmethylated CpG island promoters across vertebrates. Nucleic Acids Research. 43 (20), 9729-9741 (2015).
  10. Green, P., Ewing, B., Miller, W., Thomas, P. J., Green, E. D. Transcription-associated mutational asymmetry in mammalian evolution. Nature Genetics. 33 (4), 514-517 (2003).
  11. Polak, P., Arndt, P. F. Transcription induces strand-specific mutations at the 5' end of human genes. Genome Research. 18 (8), 1216-1223 (2008).
  12. Malig, M., Hartono, S. R., Giafaglione, J. M., Sanz, L. A., Chedin, F. Ultra-deep Coverage Single-molecule R-loop Footprinting Reveals Principles of R-loop Formation. Journal of Moleclar Biology. 432 (7), 2271-2288 (2020).
  13. Masse, E., Phoenix, P., Drolet, M. DNA topoisomerases regulate R-loop formation during transcription of the rrnB operon in Escherichia coli. The Journal of Biological Chemistry. 272 (19), 12816-12823 (1997).
  14. Drolet, M., et al. The problem of hypernegative supercoiling and R-loop formation in transcription. Frontiers in Bioscience: A Journal and Virtual Library. 8, 210-221 (2003).
  15. Chedin, F., Benham, C. J. Emerging roles for R-loop structures in the management of topological stress. The Journal of Biological Chemistry. 295 (14), 4684-4695 (2020).
  16. Ginno, P. A., Lim, Y. W., Lott, P. L., Korf, I., Chedin, F. GC skew at the 5' and 3' ends of human genes links R-loop formation to epigenetic regulation and transcription termination. Genome Research. 23 (10), 1590-1600 (2013).
  17. Sanz, L. A., et al. conserved R-Loop structures associate with specific epigenomic signatures in mammals. Molecular Cell. 63 (1), 167-178 (2016).
  18. El Hage, A., Webb, S., Kerr, A., Tollervey, D. Genome-wide distribution of RNA-DNA hybrids identifies RNase H targets in tRNA genes, retrotransposons and mitochondria. PLoS Genetics. 10 (10), 1004716(2014).
  19. Hartono, S. R., et al. The affinity of the S9.6 Antibody for Double-Stranded RNAs impacts the accurate mapping of R-loops in fission yeast. Journal of Molecular Biology. 430 (3), 272-284 (2018).
  20. Wahba, L., Costantino, L., Tan, F. J., Zimmer, A., Koshland, D. S1-DRIP-seq identifies high expression and polyA tracts as major contributors to R-loop formation. Genes & Development. 30 (11), 1327-1338 (2016).
  21. Alecki, C., et al. RNA-DNA strand exchange by the Drosophila Polycomb complex PRC2. Nature Communications. 11 (1), 1781(2020).
  22. Xu, W., et al. The R-loop is a common chromatin feature of the Arabidopsis genome. Nature Plants. 3 (9), 704-714 (2017).
  23. Chedin, F. Nascent connections: R-Loops and chromatin patterning. Trends in Genetics: TIG. 32 (12), 828-838 (2016).
  24. Skourti-Stathaki, K., Proudfoot, N. J., Gromak, N. Human senataxin resolves RNA/DNA hybrids formed at transcriptional pause sites to promote Xrn2-dependent termination. Molecular Cell. 42 (6), 794-805 (2011).
  25. Kreuzer, K. N., Brister, J. R. Initiation of bacteriophage T4 DNA replication and replication fork dynamics: a review in the Virology Journal series on bacteriophage T4 and its relatives. Virology Journal. 7, 358(2010).
  26. Carles-Kinch, K., Kreuzer, K. N. RNA-DNA hybrid formation at a bacteriophage T4 replication origin. Journal of Molecular Biology. 266 (5), 915-926 (1997).
  27. Masukata, H., Tomizawa, J. A mechanism of formation of a persistent hybrid between elongating RNA and template DNA. Cell. 62 (2), 331-338 (1990).
  28. Itoh, T., Tomizawa, J. Formation of an RNA primer for initiation of replication of ColE1 DNA by ribonuclease H. Proceedings of the National Academy of Sciences of the United States of America. 77 (5), 2450-2454 (1980).
  29. Stuckey, R., Garcia-Rodriguez, N., Aguilera, A., Wellinger, R. E. Role for RNA:DNA hybrids in origin-independent replication priming in a eukaryotic system. Proceedings of the National Academy of Sciences of the United States of America. 112 (18), 5779-5784 (2015).
  30. Lee, D. Y., Clayton, D. A. Initiation of mitochondrial DNA replication by transcription and R-loop processing. The Journal of Biological Chemistry. 273 (46), 30614-30621 (1998).
  31. Xu, B., Clayton, D. A. A persistent RNA-DNA hybrid is formed during transcription at a phylogenetically conserved mitochondrial DNA sequence. Molecular and Cellular Biology. 15 (1), 580-589 (1995).
  32. Cadoret, J. C., et al. Genome-wide studies highlight indirect links between human replication origins and gene regulation. Proceedings of the National Academy of Sciences of the United States of America. 105 (41), 15837-15842 (2008).
  33. Sequeira-Mendes, J., et al. Transcription initiation activity sets replication origin efficiency in mammalian cells. PLoS Genetics. 5 (4), 1000446(2009).
  34. Picard, F., et al. The spatiotemporal program of DNA replication is associated with specific combinations of chromatin marks in human cells. PLoS Genetics. 10 (5), 1004282(2014).
  35. Mukhopadhyay, R., et al. Allele-specific genome-wide profiling in human primary erythroblasts reveal replication program organization. PLoS Genetics. 10 (5), 1004319(2014).
  36. Huang, F. T., Yu, K., Hsieh, C. L., Lieber, M. R. Downstream boundary of chromosomal R-loops at murine switch regions: implications for the mechanism of class switch recombination. Proceedings of the National Academy of Sciences of the United States of America. 103 (13), 5030-5035 (2006).
  37. Huang, F. T., et al. Sequence dependence of chromosomal R-loops at the immunoglobulin heavy-chain Smu class switch region. Molecular and Cellular Biology. 27 (16), 5921-5932 (2007).
  38. Yu, K., Lieber, M. R. Current insights into the mechanism of mammalian immunoglobulin class switch recombination. Critical Reviews in Biochemistry and Molecular Biology. 54 (4), 333-351 (2019).
  39. Crossley, M. P., Bocek, M., Cimprich, K. A. R-Loops as cellular regulators and genomic threats. Molecular Cell. 73 (3), 398-411 (2019).
  40. Santos-Pereira, J. M., Aguilera, A. R loops: new modulators of genome dynamics and function. Nature Reviews. Genetics. 16 (10), 583-597 (2015).
  41. Garcia-Muse, T., Aguilera, A. R Loops: From physiological to pathological roles. Cell. 179 (3), 604-618 (2019).
  42. Skourti-Stathaki, K., Proudfoot, N. J. A double-edged sword: R loops as threats to genome integrity and powerful regulators of gene expression. Genes & Development. 28 (13), 1384-1396 (2014).
  43. Costantino, L., Koshland, D. The Yin and Yang of R-loop biology. Current Opinion in Cell Biology. 34, 39-45 (2015).
  44. Boguslawski, S. J., et al. Characterization of monoclonal antibody to DNA.RNA and its application to immunodetection of hybrids. Journal of Immunological Methods. 89 (1), 123-130 (1986).
  45. Sanz, L. A., Chedin, F. High-resolution, strand-specific R-loop mapping via S9.6-based DNA-RNA immunoprecipitation and high-throughput sequencing. Nature Protocols. 14 (6), 1734-1755 (2019).
  46. Halasz, L., et al. RNA-DNA hybrid (R-loop) immunoprecipitation mapping: an analytical workflow to evaluate inherent biases. Genome Research. 27 (6), 1063-1073 (2017).
  47. Phillips, D. D., et al. The sub-nanomolar binding of DNA-RNA hybrids by the single-chain Fv fragment of antibody S9.6. Journal of Molecular Recognition. 26 (8), 376-381 (2013).
  48. Chedin, F., Hartono, S. R., Sanz, L. A., Vanoosthuyse, V. Best practices for the visualization, mapping, and manipulation of R-loops. The EMBO Journal. 40 (4), 106394(2021).
  49. Smolka, J. A., Sanz, L. A., Hartono, S. R., Chedin, F. Recognition of RNAs by the S9.6 antibody creates pervasive artefacts when imaging RNA:DNA hybrids. Journal of Cell Biology. 220 (6), 202004079(2021).
  50. Chen, J. Y., Zhang, X., Fu, X. D., Chen, L. R-ChIP for genome-wide mapping of R-loops by using catalytically inactive RNASEH1. Nature Protocols. 14 (5), 1661-1685 (2019).
  51. Yan, Q., Sarma, K. MapR: A Method for Identifying native R-loops genome wide. Current Protocols in Molecular Biology. 130 (1), 113(2020).
  52. Wang, K., et al. Genomic profiling of native R loops with a DNA-RNA hybrid recognition sensor. Science Advances. 7 (8), (2021).
  53. Crossley, M. P., Bocek, M. J., Hamperl, S., Swigut, T., Cimprich, K. A. qDRIP: a method to quantitatively assess RNA-DNA hybrid formation genome-wide. Nucleic Acids Research. 48 (14), 84(2020).
  54. Svikovic, S., et al. R-loop formation during S phase is restricted by PrimPol-mediated repriming. The EMBO Journal. 38 (3), 99793(2019).
  55. Yang, X., et al. m(6)A promotes R-loop formation to facilitate transcription termination. Cell Research. 29 (12), 1035-1038 (2019).
  56. Vanoosthuyse, V. Strengths and weaknesses of the current strategies to map and characterize R-Loops. Non-coding RNA. 4 (2), 9(2018).

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Tags

DRIP SeqS9 6 ImmunoprecipitationGenomic InstabilityHigh Throughput SequencingsDRIP SeqStrand Specific MappingDNA StructureSonication Fragmentation
Video Coming Soon