Name: A Reporter Assay to Analyze Intronic microRNA Maturation in Mammalian Cells (Video) | JoVE Journal
Uploaded: 2022-06-16T12:50:00.000+00:00
Duration: 6 min 48 s
Description: Learn a reporter assay to analyze intronic microRNA maturation in mammalian cells using luciferase-based detection. This method helps researchers study RNA-binding protein effects on miRNA biogenesis.

ai_agent_IP

ai_agent

maintenance

instantTrialDurationMinutes

isBiopharma

enableNewMyJoveSectionDesign

educationFeatures

seoMetaApi

ai_copilot_institution_blacklist

ai_chat_institution_blacklist

freeAccessWindow

ssoRoleCapture

scheduledMaintenanceBanner

joveLabsFeatures

disable_autoplay_for_bots

extended_trial_duration

5 minutes

The authors are grateful to E. Makeyev (Nanyang Technological University, Singapore) for the HeLa-Cre cells and pRD-RIPE and pCAGGS-Cre plasmids. We thank Edna Kimura, Carolina Purcell Goes, Gisela Ramos, Lucia Rossetti Lopes, and Anselmo Moriscot for their support.

An overview of the protocol described here is depicted in Figure 1.
1. Plasmid construction
<ol>
	<li>pCAGGS-Cre: This plasmid was provided by Dr. E. Makeyev21.</li>
	<li>pRD-miR-17-92:
	<ol>
		<li>Amplify pre-miR-17-92 by PCR using 0.5 &#181;M of each specific primer (Table of Materials), 150 ng of cDNA, 1 mM dNTPs, 1x Taq PCR buffer, and 5 U of high-fidelity Taq DNA polymerase. Perform a no-template control PCR reaction (use water instead of cDNA) to check for DNA contamination.</li>
		<li>Ligate the PCR product into pRD-RIPE (kindly provided by Dr. E. Makeyev, Nanyang Technological University, Singapore)21 inside the intron between the EcoRI and EcoRV restriction sites using DNA ligase, creating pRD-miR-17-92. Confirm sequence integrity by Sanger sequencing.</li>
	</ol>
	</li>
	<li>pmiRGLO-RAP-IB
	<ol>
		<li>Design forward and reverse primers flanked by XhoI/XbaI restriction sites and with one NotI restriction site inside. Mix equimolar amounts of forward and reverse primers and incubate the mixture at 90 &#176;C for 5 min, then transfer to 37 &#176;C for 15 min. As controls, use primers with scrambled target sequences (Table of Materials).</li>
		<li>Cleave the annealed fragments using XhoI/XbaI restriction enzymes and ligate them downstream of the luc2 sequence into pmiR-GLO, generating pmiRGLO-RAP-IB-3&#697;-UTR (Luc-RAP-1B) and pmiRGLO-scrambled-3&#697;-UTR (Luc-scrambled) reporter constructs. Confirm ligation with NotI cleavage. 
		&#8203;NOTE: Ensure that the overhangs created after primer annealing are complementary to the vector after cleavage reaction.</li>
	</ol>
	</li>
	<li>pFLAG-HuR
	<ol>
		<li>To generate a HuR over-expressing plasmid, amplify the HuR sequence with specific primers. Mix 300 ng of cDNA, 0.5 &#181;M of each specific primer, 1 mM dNTPs mix, 1x PCR buffer, and 5 U of high-fidelity Taq DNA polymerase.</li>
		<li>Ligate the PCR product into pGEM-T and confirm the DNA sequence integrity by Sanger sequencing. Remove the HuR fragment from pGEM-T and subclone it into pFLAG-CMV-3 mammalian expression vector to generate the pFLAG-HuR vector.</li>
	</ol>
	</li>
</ol>
2. Cell culture
NOTE: The HeLa-Cre cell line was a gift from Dr. E. Makeyev21, and the papillary thyroid cancer cell (BCPAP) was kindly provided by Dr. Massimo Santoro (University &#34;Federico II&#34;, Naples, Italy). HeLa cell, papillary thyroid cancer cell (BCPAP), and HEK-293T were used to overexpress HuR.
<ol>
	<li>Maintain the cells in DMEM/high-glucose supplemented with 10% fetal bovine serum, 1 mM sodium pyruvate, 200 mM L-glutamine, and 1x penicillin-streptomycin (100 U/mL penicillin, 100 &#181;g/mL streptomycin) in 100 mm Petri dishes, unless otherwise indicated. Incubate the cells at 37 &#176;C in a humidified, controlled-atmosphere incubator (5% CO2).</li>
	<li>Incubate adherent cells with trypsin/EDTA (0.5% solution mixture) at 37 &#176;C for 3-5 min. Let them detach from the plate (incubation period can vary according to the cell type).</li>
	<li>Perform transfections with a lipid-based transfection reagent following the manufacturer&#39;s instructions. Ensure that the cell cultures are approximately 70% confluent. Use similar amounts of DNA for all transfection combinations, as described below, by adding the appropriate DNAs. Perform transfection experiments in replicates.
	<ol>
		<li>Mix 200 ng of DNA and 1.25 &#181;L of transfection reagent in 100 &#181;L of the culture medium. Add the transfection mixture to the cells. Incubate the cells with the transfection mixtures for 4 h at 37 &#176;C. Then, replace the medium with medium containing 10% FBS, and incubate for another 24 h before adding the antibiotics for selection.</li>
	</ol>
	</li>
</ol>
3. HuR overexpression
<ol>
	<li>Transfect pFLAG-HuR and empty pFLAG into HeLa. Select cells by increasing the concentration of geneticin (G418) (1 &#181;g/mL) from 100 &#181;g/mL to 1000 &#181;g/mL, generating stable cell lines.</li>
	<li>Confirm overexpression with quantitative PCR using specific primers for HuR mRNA, as described in step 7.</li>
</ol>
4. Total RNA isolation
<ol>
	<li>Use freshly collected cells. Trypsinize 70% confluent cell cultures (for this assay, HeLa-Cre cells were used), as described in step 2.2.</li>
	<li>Collect the cell pellet by centrifugation for 5 min at 500 x g at 4 &#176;C and wash it with 1x PBS (phosphate-buffered saline); repeat the centrifugation.</li>
	<li>Resuspend the cell pellet in 1 mL of 1x PBS and transfer it to a 1.5 mL microcentrifuge tube.</li>
	<li>Centrifuge for 5 min at 500 x g at 4 &#176;C.</li>
	<li>Weigh the dry cell pellet, and adjust the volumes and size of tubes accordingly. 1 mg of cells yields approximately 1 &#181;g of total RNA.</li>
	<li>In a hood, add 500-1,000 &#181;L of phenol/chloroform to the cell pellet (ideally 750 &#181;L per 0.25 g of cells) and homogenize it by pipetting up and down and mixing with the vortex.</li>
	<li>Incubate the mixture for 5 min at room temperature (20 &#176;C to 25 &#176;C) to allow the complete dissociation of nucleoprotein complexes.</li>
	<li>Centrifuge the sample at 500 x g for 5 min at 4 &#176;C.</li>
	<li>Transfer the supernatant to a new 1.5 mL microcentrifuge tube and add 200 &#181;L of chloroform per 1 mL of phenol:chloroform used. Cap the sample tubes securely.</li>
	<li>Mix vigorously for 15 s (by hand or briefly vortexing at a lower speed) and incubate at room temperature (20 &#176;C to 25 &#176;C) for 2 min to 3 min.</li>
	<li>Centrifuge the samples at 12,000 x g for 15 min at 4 &#176;C.</li>
	<li>Check for the presence of a lower red phenol-chloroform phase, an intermediary phase, and a colorless upper aqueous phase. RNA remains in the upper aqueous phase. In a hood, collect the aqueous phase, avoiding contacting the intermediary phase, and transfer to a fresh tube.</li>
	<li>Precipitate RNA by mixing the aqueous phase with 400 &#181;L of molecular grade isopropanol (1:1 ratio to phenol/chloroform used) and 2 &#181;L of glycogen in each tube (it will help to visualize the presence of the pellet).</li>
	<li>Mix vigorously by hand or homogenize with the tip for ~10 s. Incubate for 15 min or overnight at &#8722;20 &#176;C.</li>
	<li>Centrifuge the sample at 12,000 x g for 20 min at 4 &#176;C and discard the supernatant.</li>
	<li>Wash the RNA pellet by adding 3 volumes of 100% ethanol (approximately 1 mL, diluted using DEPC water) and mix the sample by vortexing until the pellet is released and floats from the bottom.</li>
	<li>Centrifuge at 7,500 x g for 5 min at 4 &#176;C.</li>
	<li>Wash the RNA pellet 1x by adding 1 mL of 75% ethanol and mix the sample by vortexing until the pellet is released and floats from the bottom. Repeat the centrifugation as described in step 4.17.</li>
	<li>Perform an additional 5 s centrifugation spin to collect residual liquid from the side of the tube and remove any residual liquid with a pipette without disturbing the pellet.</li>
	<li>Briefly air-dry the RNA pellet by opening the cap of the tube at room temperature for 3-5 min and dissolve the RNA pellet in 20-50 &#181;L of RNase-free DEPC-treated water. Incubate the RNA for 10 min at 55-60 &#176;C to facilitate resuspension of the pellet.</li>
</ol>
5. Determination of total RNA concentration and quality
<ol>
	<li>Determine the RNA concentration by measuring the absorbance at 260 nm and 280 nm using a spectrophotometer. Obtain full-spectral data before using the samples in downstream applications.</li>
	<li>Control the RNA quality by resolving 800-1000 ng on a 1.5% agarose gel using 0.5X TBE buffer (45 mM Tris base, 45 mM boric acid, 1 mM EDTA). Total RNA separates into two bands referring to 28S and 18S rRNAs.
	<ol>
		<li>Make all reagents and wash all equipment used for running the gel with DEPC-treated water. DEPC-treated water is prepared in the hood by adding 1 mL of diethylpyrocarbonate to 1000 mL of ultra-pure water. Incubate for ~2 h at room temperature or at 37 &#176;C and autoclave. Store at room temperature for up to 10 months. 
		NOTE: Electrophoresis of mammalian total RNAs leads to the separation of 28S and 18S rRNAs at a ratio of approximately 2:1. The bands should be intact and visible as two sharp bands. Degraded RNA will result in blurry bands.</li>
	</ol>
	</li>
</ol>
6. Reverse transcription
<ol>
	<li>Set the reverse transcription reaction using 1 &#181;g of total RNA.</li>
	<li>Perform reverse transcription (RT) using reverse transcriptase enzyme (see Table of Materials) and 50 ng/&#181;L random decamer primers.
	<ol>
		<li>Mix RNA, random primers, and 1 mM dNTP mix (10 mM) in 10 &#181;L. Incubate at 65 &#176;C for 5 min and on ice for 1 min. Add the following reagents: 1x RT buffer, 5 mM MgCl2, 10 mM DTT, 40 U of RNase inhibitor, and 200 U of Reverse Transcriptase.</li>
		<li>Incubate for 10 min at 25 &#176;C and for 1 h at 50 &#176;C (temperatures may change if different enzymes are used). Terminate the reaction by incubating at 85 &#176;C for 5 min. cDNAs can be stored at &#8722;20 &#176;C.</li>
	</ol>
	</li>
</ol>
7. Quantitative PCR
<ol>
	<li>To assemble the reaction in a final volume of 15 &#181;L, mix 3 &#181;L of cDNA (100 ng/&#181;L), 3.2 pmol of each primer, 6 &#181;L of master mix containing the dNTPs and enzyme, and 2.8 &#181;L of ultrapure water. 
	NOTE: Use primers for endogenous constitutive genes as controls (housekeeping genes) to normalize the expression levels of HuR mRNA and miRNAs. &#946;-Actin and snRNA U6 (RNU6B) are available options for the normalization of mRNAs and miRNAs, respectively, but other genes might also be suitable depending on the case.</li>
	<li>Quantify the expression levels using the delta-delta Ct (2-&#916;&#916;Ct) method20.</li>
</ol>
8. The reporter assay
<ol>
	<li>Cells used for the assay
	<ol>
		<li>Transfect the plasmids in HeLa-Cre cells as follows. Transfect with pTK-Renilla (40 ng), then pRD-miR-17-92, generating HeLa-Cre-miR-17-92, and selecting with 1 &#181;g/mL puromycin.</li>
		<li>Transfect HeLa-Cre-miR-17-92-pTK-Renilla with pmiRGLO-RAP-IB-3&#697;-UTR or pmiRGLO-scrambled-3&#697;-UTR, separately. Select using penicillin (100 U/mL) and streptomycin (100 &#181;g/mL). These transfections generate Luc-RAP-1-B and Luc-scrambled.</li>
		<li>Transfect the cells with pFLAG-HuR or empty pFLAG (step 3).</li>
		<li>Proceed to cell culture, as detailed in step 2.2., with HeLa-Cre miR-17-92-luc, HeLa-Cre miR-17-92-scrambled, HeLa-Cre miR-17-92-HuR, and HeLa-Cre miR-17-92-HuR-luc until approximately 80% of confluence. Induce with 1 &#181;L of doxycycline (1 &#181;g/mL) for 30 min at 37 &#176;C. Also, keep all the cells without doxycycline as controls, for the same period. 
		NOTE: The final concentration of doxycycline depends on the cell line of choice. An excess of doxycycline can be toxic for mammalian cells.</li>
	</ol>
	</li>
	<li>Luminescent assay
	<ol>
		<li>To quantify and compare different luminescence intensities, use the Dual-luciferase reporter assay kit. Thaw luciferase assay solutions and leave them at room temperature before beginning the assay.</li>
		<li>Prepare the mix Stop and Glo (blue cap tubes) by mixing 200 &#181;L of the substrate in 10 mL of Luciferase Assay Buffer II. Prepare the mix LAR II (green cap tubes) by mixing 10 mL of Luciferase Assay Buffer II into the amber vial of Luciferase Assay Substrate II and shake well.</li>
		<li>Transfer the solutions to 15 mL centrifuge tubes previously identified and protected from light. 
		NOTE: As an alternative, the solutions can be previously prepared in 1-2 mL aliquots and frozen at &#8722;80 &#176;C protected from light in aluminum foil.</li>
		<li>Perform the luminescence readings using an equipment such as Synergy; measure expressed luciferase as relative light units (RLU).</li>
		<li>Export the results to a spreadsheet for further statistical analysis.</li>
		<li>Perform normalization of firefly-luciferase activity by the control Renilla (luciferase/Renilla) and plot that as relative light units (RLU) in a graphic. Repeat this for groups with and without doxycycline induction.</li>
		<li>Calculate the mean and standard error of the mean (SEM). Perform a Student&#39;s t-test or two-way ANOVA followed by Tukey&#39;s post-test to allow group comparison. These analyses are available in a package such as GraphPad Prism. Differences at p-values &#60; 0.05 are considered significant.</li>
	</ol>
	</li>
</ol>

<ol><li>Wilkinson, M. E., Charenton, C., Nagai, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((RNA+splicing+by+the+spliceosome%5BTitle%5D)+AND+%22Annual+Review+of+Biochemistry%22%5BJournal%5D)">RNA splicing by the spliceosome.</a> Annual Review of Biochemistry. 89, 359-388 (2020).</li>
<li>Will, C. L., Luhrmann, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Spliceosome+structure+and+function%5BTitle%5D)+AND+%22Cold+Spring+Harbor+Perspectives+in+Biology%22%5BJournal%5D)">Spliceosome structure and function.</a> Cold Spring Harbor Perspectives in Biology. 3 (7), 003707(2011).</li>
<li>Zhang, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((An+atomic+structure+of+the+human+spliceosome%5BTitle%5D)+AND+%22Cell%22%5BJournal%5D)">An atomic structure of the human spliceosome.</a> Cell. 169 (5), 918-929 (2017).</li>
<li>Staley, J. P., Guthrie, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Mechanical+devices+of+the+spliceosome%3A+Motors%2C+clocks%2C+springs%2C+and+things%5BTitle%5D)+AND+%22Cell%22%5BJournal%5D)">Mechanical devices of the spliceosome: Motors, clocks, springs, and things.</a> Cell. 92 (3), 315-326 (1998).</li>
<li>Kornblihtt, A. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Alternative+splicing%3A+a+pivotal+step+between+eukaryotic+transcription+and+translation%5BTitle%5D)+AND+%22Nature+Reviews+Molecular+Cell+Biology%22%5BJournal%5D)">Alternative splicing: a pivotal step between eukaryotic transcription and translation.</a> Nature Reviews Molecular Cell Biology. 14 (3), 153-165 (2013).</li>
<li>Wang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+complex+network+of+factors+with+overlapping+affinities+represses+splicing+through+intronic+elements%5BTitle%5D)+AND+%22Nature+Structural+%26+Molecular+Biology%22%5BJournal%5D)">A complex network of factors with overlapping affinities represses splicing through intronic elements.</a> Nature Structural & Molecular Biology. 20 (1), 36-45 (2013).</li>
<li>Mukherjee, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Integrative+regulatory+mapping+indicates+that+the+RNA-binding+protein+HuR+couples+pre-mRNA+processing+and+mRNA+stability%5BTitle%5D)+AND+%22Molecular+Cell%22%5BJournal%5D)">Integrative regulatory mapping indicates that the RNA-binding protein HuR couples pre-mRNA processing and mRNA stability.</a> Molecular Cell. 43 (3), 327-339 (2011).</li>
<li>Pandit, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Genome-wide+analysis+reveals+SR+protein+cooperation+and+competition+in+regulated+splicing%5BTitle%5D)+AND+%22Molecular+Cell%22%5BJournal%5D)">Genome-wide analysis reveals SR protein cooperation and competition in regulated splicing.</a> Molecular Cell. 50 (2), 223-235 (2013).</li>
<li>Gatti da Silva, G. H., Dos Santos, M. G. P., Nagasse, H. Y., Coltri, P. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Human+antigen+R+%28HuR%29+facilitates+miR-19+synthesis+and+affects+cellular+kinetics+in+papillary+thyroid+cancer%5BTitle%5D)+AND+%22Cellular+Physiology+and+Biochemistry%22%5BJournal%5D)">Human antigen R (HuR) facilitates miR-19 synthesis and affects cellular kinetics in papillary thyroid cancer.</a> Cellular Physiology and Biochemistry. 56, 105-119 (2022).</li>
<li>Westholm, J. O., Lai, E. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Mirtrons%3A+MicroRNA+biogenesis+via+splicing%5BTitle%5D)+AND+%22Biochimie%22%5BJournal%5D)">Mirtrons: MicroRNA biogenesis via splicing.</a> Biochimie. 93 (11), 1897-1904 (2011).</li>
<li>Michlewski, G., Cáceres, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Post-transcriptional+control+of+miRNA+biogenesis%5BTitle%5D)+AND+%22RNA%22%5BJournal%5D)">Post-transcriptional control of miRNA biogenesis.</a> RNA. 25 (1), 1-16 (2019).</li>
<li>Bartel, D. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((MicroRNAs%3A+Target+recognition+and+regulatory+functions%5BTitle%5D)+AND+%22Cell%22%5BJournal%5D)">MicroRNAs: Target recognition and regulatory functions.</a> Cell. 136 (2), 215-233 (2009).</li>
<li>Esquela-Kerscher, A., Slack, F. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Oncomirs+-+MicroRNAs+with+a+role+in+cancer%5BTitle%5D)+AND+%22Nature+Reviews+Cancer%22%5BJournal%5D)">Oncomirs - MicroRNAs with a role in cancer.</a> Nature Reviews Cancer. 6 (4), 259-269 (2006).</li>
<li>Lin, S., Gregory, R. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((MicroRNA+biogenesis+pathways+in+cancer%5BTitle%5D)+AND+%22Nature+Reviews+Cancer%22%5BJournal%5D)">MicroRNA biogenesis pathways in cancer.</a> Nature Reviews Cancer. 15 (6), 321-333 (2015).</li>
<li>Curtis, H. J., Sibley, C. R., Wood, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Mirtrons%2C+an+emerging+class+of+atypical+miRNA%5BTitle%5D)+AND+%22Wiley+Interdisciplinary+Reviews.+RNA%22%5BJournal%5D)">Mirtrons, an emerging class of atypical miRNA.</a> Wiley Interdisciplinary Reviews. RNA. 3 (5), 617-632 (2012).</li>
<li>Alarcon, C. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((HNRNPA2B1+is+a+mediator+of+m%286%29A-dependent+nuclear+RNA+processing+events%5BTitle%5D)+AND+%22Cell%22%5BJournal%5D)">HNRNPA2B1 is a mediator of m(6)A-dependent nuclear RNA processing events.</a> Cell. 162 (6), 1299-1308 (2015).</li>
<li>Paiva, M. M., Kimura, E. T., Coltri, P. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((miR18a+and+miR19a+recruit+specific+proteins+for+splicing+in+thyroid+cancer+cells%5BTitle%5D)+AND+%22Cancer+Genomics+and+Proteomics%22%5BJournal%5D)">miR18a and miR19a recruit specific proteins for splicing in thyroid cancer cells.</a> Cancer Genomics and Proteomics. 14 (5), 373-381 (2017).</li>
<li>He, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+microRNA+polycistron+as+a+potential+human+oncogene%5BTitle%5D)+AND+%22Nature%22%5BJournal%5D)">A microRNA polycistron as a potential human oncogene.</a> Nature. 435 (7043), 828-833 (2005).</li>
<li>Olive, V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((miR-19+is+a+key+oncogenic+component+of+mir-17-92%5BTitle%5D)+AND+%22Genes+%26+Development%22%5BJournal%5D)">miR-19 is a key oncogenic component of mir-17-92.</a> Genes & Development. 23 (24), 2839-2849 (2009).</li>
<li>Livak, K. J., Schmittgen, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Analysis+of+relative+gene+expression+data+using+real-time+quantitative+PCR+and+the+2%28-Delta+Delta+C%28T%29%29+Method%5BTitle%5D)+AND+%22Methods%22%5BJournal%5D)">Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method.</a> Methods. 25 (4), 402-408 (2001).</li>
<li>Khandelia, P., Yap, K., Makeyev, E. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Streamlined+platform+for+short+hairpin+RNA+interference+and+transgenesis+in+cultured+mammalian+cells%5BTitle%5D)+AND+%22Proceedings+of+the+National+Academy+of+Sciences+of+the+United+States+of+America%22%5BJournal%5D)">Streamlined platform for short hairpin RNA interference and transgenesis in cultured mammalian cells.</a> Proceedings of the National Academy of Sciences of the United States of America. 108 (31), 12799-12804 (2011).</li>
<li>Huelga, S. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Integrative+genome-wide+analysis+reveals+cooperative+regulation+of+alternative+splicing+by+hnRNP+proteins%5BTitle%5D)+AND+%22Cell+Reports%22%5BJournal%5D)">Integrative genome-wide analysis reveals cooperative regulation of alternative splicing by hnRNP proteins.</a> Cell Reports. 1 (2), 167-178 (2012).</li>
<li>Karni, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+gene+encoding+the+splicing+factor+SF2%2FASF+is+a+proto-oncogene%5BTitle%5D)+AND+%22Nature+Structural+%26+Molecular+Biology%22%5BJournal%5D)">The gene encoding the splicing factor SF2/ASF is a proto-oncogene.</a> Nature Structural & Molecular Biology. 14 (3), 185-193 (2007).</li>
<li>Franca, G. S., Vibranovski, M. D., Galante, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Host+gene+constraints+and+genomic+context+impact+the+expression+and+evolution+of+human+microRNAs%5BTitle%5D)+AND+%22Nature+Communications%22%5BJournal%5D)">Host gene constraints and genomic context impact the expression and evolution of human microRNAs.</a> Nature Communications. 7, 11438(2016).</li>
<li>Havens, M. A., Reich, A. A., Hastings, M. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Drosha+promotes+splicing+of+a+pre-microRNA-like+alternative+exon%5BTitle%5D)+AND+%22PLoS+Genetics%22%5BJournal%5D)">Drosha promotes splicing of a pre-microRNA-like alternative exon.</a> PLoS Genetics. 10 (5), 1004312(2014).</li>
<li>Grammatikakis, I., Abdelmohsen, K., Gorospe, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Posttranslational+control+of+HuR+function%5BTitle%5D)+AND+%22Wiley+Interdisciplinary+Reviews.+RNA%22%5BJournal%5D)">Posttranslational control of HuR function.</a> Wiley Interdisciplinary Reviews. RNA. 8 (1), (2017).</li>
<li>Chang, S. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((ELAVL1+regulates+alternative+splicing+of+eIF4E+transporter+to+promote+postnatal+angiogenesis%5BTitle%5D)+AND+%22Proceedings+of+the+National+Academy+of+Sciences+of+the+United+States+of+America%22%5BJournal%5D)">ELAVL1 regulates alternative splicing of eIF4E transporter to promote postnatal angiogenesis.</a> Proceedings of the National Academy of Sciences of the United States of America. 111 (51), 18309-18314 (2014).</li>
<li>Huang, Y. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Delivery+of+therapeutics+targeting+the+mRNA-binding+protein+HuR+using+3DNA+nanocarriers+suppresses+ovarian+tumor+growth%5BTitle%5D)+AND+%22Cancer+Research%22%5BJournal%5D)">Delivery of therapeutics targeting the mRNA-binding protein HuR using 3DNA nanocarriers suppresses ovarian tumor growth.</a> Cancer Research. 76 (6), 1549-1559 (2016).</li>
<li>Wang, W., Caldwell, M. C., Lin, S., Furneaux, H., Gorospe, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((HuR+regulates+cyclin+A+and+cyclin+B1+mRNA+stability+during+cell+proliferation%5BTitle%5D)+AND+%22The+EMBO+Journal%22%5BJournal%5D)">HuR regulates cyclin A and cyclin B1 mRNA stability during cell proliferation.</a> The EMBO Journal. 19 (10), 2340-2350 (2000).</li>
<li>Guo, X., Connick, M. C., Vanderhoof, J., Ishak, M. A., Hartley, R. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((MicroRNA-16+modulates+HuR+regulation+of+cyclin+E1+in+breast+cancer+cells%5BTitle%5D)+AND+%22International+Journal+of+Molecular+Sciences%22%5BJournal%5D)">MicroRNA-16 modulates HuR regulation of cyclin E1 in breast cancer cells.</a> International Journal of Molecular Sciences. 16 (4), 7112-7132 (2015).</li>
</ol>

The authors have no conflicts of interest.

Pre-mRNA splicing is an important process for gene expression regulation, and its control can trigger strong effects on cell phenotypic modifications22,23. More than 70% of miRNAs are transcribed from introns in humans, and we hypothesized that their processing and maturation could be facilitated by splicing regulatory proteins24,25. We developed a method to analyze intronic miRNA processing and function ...

Precursor mRNA splicing is an important process for gene expression regulation in eukaryotes1. The removal of introns and the union of exons in mature RNA is catalyzed by the spliceosome, a 2 megadalton ribonucleoprotein complex composed of 5 snRNAs (U1, U2, U4, U5, and U6) along with more than 100 proteins2,3. The splicing reaction occurs co-transcriptionally, and the spliceosome is assembled at each new intron guided by the recognition of conserved splice sites at exon-intron boundaries and within the intron4. Different introns might have different splicing rates despite the remarkable conservation of the spliceosome complex and its components. In addition to the differences in splice site conservation, regulatory sequences distributed on introns and exons can guide RNA-binding proteins (RBP) and stimulate or repress splicing5,6. HuR is a ubiquitously expressed RBP and is an important factor to control mRNA stability7. Previous results from our group showed that HuR can bind to introns containing miRNAs, indicating this protein might be an important factor to facilitate miRNA processing and maturation, also leading to the generation of alternative splicing isoforms6,8,9.
Many microRNAs (miRNAs) are coded from intronic sequences. Whereas some are part of the intron, others are known as "mirtrons" and are formed by the entire intron10,11. miRNAs are short non-coding RNAs, ranging from 18 to 24 nucleotides in length12. Their mature sequence shows partial or total complementarity with target sequences in mRNAs, therefore affecting translation and/or mRNA decay rates. The combinations of miRNAs and targets drive the cell to different outcomes. Several miRNAs can drive cells to pro- or anti-tumoral phenotypes13. Oncogenic miRNAs usually target mRNAs that trigger a suppressive characteristic, leading to increased cellular proliferation, migration, and invasion14. On the other hand, tumor-suppressive miRNAs might target oncogenic mRNAs or mRNAs related to increased cell proliferation. 
The processing and maturation of miRNAs are also dependent on their origin. Most intronic miRNAs are processed with the participation of the microprocessor, formed by the ribonuclease Drosha and protein co-factors12. Mirtrons are processed with the activity of the spliceosome independently of Drosha15. Considering the high frequency of miRNAs found within introns, we hypothesized that RNA-binding proteins involved with splicing could also facilitate the processing and maturation of these miRNAs. Notably, the RBP hnRNP A2/B1 has already been associated with the microprocessor and miRNA biogenesis16. 
We have previously reported that several RNA-binding proteins, such as hnRNPs and HuR, are associated with intronic miRNAs by mass spectrometry17. HuR's (ELAVL1) association with miRNAs from the miR-17-92 intronic cluster was confirmed using immunoprecipitation and in silico analysis9. miR-17-92 is an intronic miRNA cluster composed of six miRNAs with increased expression in different cancers18,19. This cluster is also known as "oncomiR-1" and is composed of miR-17, miR-18a, miR-19a, miR-20, miR-19b, and miR-92a. miR-19a and miR-19b are among the most oncogenic miRNAs of this cluster19. The increased expression of HuR stimulates miR-19a and miR-19b synthesis9. Since intronic regions flanking this cluster are associated with HuR, we developed a method to investigate if this protein could regulate miR-19a and miR-19b expression and maturation. One important prediction of our hypothesis was that, as a regulatory protein, HuR could facilitate miRNA biogenesis, leading to phenotypic alterations. One possibility was that miRNAs were processed by the stimulation of HuR but would not be mature and functional and, therefore, the effects of the protein would not directly impact the phenotype. Therefore, we developed a splicing reporter assay to investigate whether an RBP such as HuR could affect the biogenesis and maturation of an intronic miRNA. By confirming miRNA processing and maturation, our assay shows the interaction with the target sequence and the generation of a mature and functional miRNA. In our assay, we couple the expression of an intronic miRNA cluster with a luciferase plasmid to check for miRNA target-binding in cultured cells.

<table><tbody><tr><td>&lt;strong&gt;Recombinant DNA&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>pCAGGS-Cre (Cre- encoding plasmid)</td><td></td><td></td><td>A kind gift from E. Makeyev from Khandelia et al., 2011</td></tr><tr><td>pFLAG-HuR</td><td></td><td></td><td>Generated during this work</td></tr><tr><td>pmiRGLO-RAP-IB</td><td></td><td></td><td>Generated during this work</td></tr><tr><td>pmiRGLO-scrambled</td><td></td><td></td><td>Generated during this work</td></tr><tr><td>pRD-miR-17-92</td><td></td><td></td><td>Generated during this work</td></tr><tr><td>pRD-RIPE-donor</td><td></td><td></td><td>A kind gift from E. Makeyev from Khandelia et al., 2011</td></tr><tr><td>pTK-Renilla</td><td>Promega</td><td>E2241</td><td></td></tr><tr><td>&lt;strong&gt;Antibodies&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>anti-B-actin</td><td>Sigma Aldrich</td><td>A5316</td><td></td></tr><tr><td>anti-HuR</td><td>Cell Signaling</td><td>mAb&amp;nbsp;12582</td><td></td></tr><tr><td>IRDye 680CW Goat anti-mouse IgG</td><td>Li-Cor Biosciences</td><td>926-68070</td><td></td></tr><tr><td>IRDye 800CW Goat anti-rabbit IgG</td><td>Li-Cor Biosciences</td><td>929-70020</td><td></td></tr><tr><td>&lt;strong&gt;Experimental Models: Cell Lines&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>HeLa-Cre</td><td></td><td></td><td>A kind gift from E. Makeyev from Khandelia et al., 2011</td></tr><tr><td>HeLa-Cre miR17-92</td><td></td><td></td><td>Generated during this work</td></tr><tr><td>HeLa-Cre miR17-92-HuR</td><td></td><td></td><td>Generated during this work</td></tr><tr><td>HeLa-Cre miR17-92-HuR-luc</td><td></td><td></td><td>Generated during this work</td></tr><tr><td>HeLa-Cre miR17-92-luc</td><td></td><td></td><td>Generated during this work</td></tr><tr><td>HeLa-Cre miR17-92-scrambled</td><td></td><td></td><td>Generated during this work</td></tr><tr><td>&lt;strong&gt;Chemicals and Peptides&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>DMEM/high-glucose</td><td>Thermo Fisher Scientific</td><td>12800-017</td><td></td></tr><tr><td>Doxycycline</td><td>BioBasic</td><td>MB719150</td><td></td></tr><tr><td>Dual-Glo Luciferase Assay System</td><td>Promega</td><td>E2940</td><td></td></tr><tr><td>EcoRI</td><td>Thermo Fisher Scientific</td><td>ER0271</td><td></td></tr><tr><td>EcoRV</td><td>Thermo Fisher Scientific</td><td>ER0301</td><td></td></tr><tr><td>Geneticin</td><td>Thermo Fisher Scientific</td><td>E859-EG</td><td></td></tr><tr><td>L-glutamine</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Opti-MEM I</td><td>Life Technologies</td><td>31985-070</td><td></td></tr><tr><td>pFLAG-CMV&amp;trade;-3 Expression Vector</td><td>Sigma Aldrich</td><td>E6783</td><td></td></tr><tr><td>pGEM-T</td><td>Promega</td><td>A3600</td><td></td></tr><tr><td>Platinum Taq DNA polymerase</td><td>Thermo Fisher Scientific</td><td>10966-030</td><td></td></tr><tr><td>pmiR-GLO</td><td>Promega</td><td>E1330</td><td></td></tr><tr><td>Puromycin</td><td>Sigma Aldrich</td><td>P8833</td><td></td></tr><tr><td>RNAse OUT</td><td>Thermo Fisher Scientific</td><td>752899</td><td></td></tr><tr><td>SuperScript IV kit</td><td>Thermo Fisher Scientific</td><td>18091050</td><td></td></tr><tr><td>Trizol-LS reagent</td><td>Thermo Fisher</td><td>10296-028</td><td></td></tr><tr><td>trypsin/EDTA 10X</td><td>Life Technologies</td><td>15400-054</td><td></td></tr><tr><td>XbaI</td><td>Thermo Fisher Scientific</td><td>10131035</td><td></td></tr><tr><td>XhoI</td><td>Promega</td><td>R616A</td><td></td></tr><tr><td>&lt;strong&gt;Oligonucleotides&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>forward RAP-1B pmiRGLO</td><td>Exxtend</td><td>TCGAGTAGCGGCCGCTAGTAAG&lt;br/&gt; CTACTATATCAGTTTGCACAT</td><td></td></tr><tr><td>reverse RAP-1B pmiRGLO</td><td>Exxtend</td><td>CTAGATGTGCAAACTGATATAGT&lt;br/&gt; AGCTTACTAGCGGCCGCTAC</td><td></td></tr><tr><td>forward scrambled pmiRGLO</td><td>Exxtend</td><td>TCGAGTAGCGGCCGCTAGTAA&lt;br/&gt; GCTACTATATCAGGGGTAAAAT</td><td></td></tr><tr><td>reverse scrambled pmiRGLO</td><td>Exxtend</td><td>CTAGATTTTACCCCTGATATAGT&lt;br/&gt; AGCTTACTAGCGGCCGCTAC</td><td></td></tr><tr><td>forward HuR pFLAG</td><td>Exxtend</td><td>GCCGCGAATTCAATGTCTAAT&lt;br/&gt; GGTTATGAAGAC</td><td></td></tr><tr><td>reverse HuR pFLAG</td><td>Exxtend</td><td>GCGCTGATATCGTTATTTGTG&lt;br/&gt; GGACTTGTTGG</td><td></td></tr><tr><td>forward pre-miR-1792 pRD-RIPE</td><td>Exxtend</td><td>ATCCTCGAGAATTCCCATTAG&lt;br/&gt; GGATTATGCTGAG</td><td></td></tr><tr><td>reverse pre-miR-1792 pRD-RIPE</td><td>Exxtend</td><td>ACTAAGCTTGATATCATCTTG&lt;br/&gt; TACATTTAACAGTG</td><td></td></tr><tr><td>forward snRNA U6 (RNU6B)</td><td>Exxtend</td><td>CTCGCTTCGGCAGCACATATAC</td><td></td></tr><tr><td>reverse snRNA U6 (RNU6B)</td><td>Exxtend</td><td>GGAACGCTTCACGAATTTGCGTG</td><td></td></tr><tr><td>forward B-Actin qPCR</td><td>Exxtend</td><td>ACCTTCTACAATGAGCTGCG</td><td></td></tr><tr><td>reverse B-Actin qPCR</td><td>Exxtend</td><td>CCTGGATAGCAACGTACATGG</td><td></td></tr><tr><td>forward HuR qPCR</td><td>Exxtend</td><td>ATCCTCTGGCAGATGTTTGG</td><td></td></tr><tr><td>reverse HuR qPCR</td><td>Exxtend</td><td>CATCGCGGCTTCTTCATAGT</td><td></td></tr><tr><td>forward pre-miR-1792 qPCR</td><td>Exxtend</td><td>GTGCTCGAGACGAATTCGTCA&lt;br/&gt; GAATAATGTCAAAGTG</td><td></td></tr><tr><td>reverse pre-miR-1792 qPCR</td><td>Exxtend</td><td>TCCAAGCTTAAGATATCCCAAAC&lt;br/&gt; TCAACAGGCCG</td><td></td></tr><tr><td>&lt;strong&gt;Software and Algorithms&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Prism 8 for Mac OS X</td><td>Graphpad</td><td>https://www.graphpad.com</td><td></td></tr><tr><td>ImageJ</td><td>National Institutes of Health</td><td>http://imagej.nih.gov/ij</td><td></td></tr></tbody></table>

a reporter assay to analyze intronic microrna maturation in mammalian cells

A Reporter Assay to Analyze Intronic microRNA Maturation in Mammalian Cells

MicroRNAs (miRNAs) are short RNA molecules that are widespread in eukaryotes. Most miRNAs are transcribed from introns, and their maturation involves different RNA-binding proteins in the nucleus. Mature miRNAs frequently mediate gene silencing, and this has become an important tool for comprehending post-transcriptional events. Besides that, it can be explored as a promising methodology for gene therapies. However, there is currently a lack of direct methods for assessing miRNA expression in mammalian cell cultures. Here, we describe an efficient and simple method that aids in determining miRNA biogenesis and maturation through confirmation of its interaction with target sequences. Also, this system allows the separation of exogenous miRNA maturation from its endogenous activity using a doxycycline-inducible promoter capable of controlling primary miRNA (pri-miRNA) transcription with high efficiency and low cost. This tool also allows modulation with RNA-binding proteins in a separate plasmid. In addition to its use with a variety of different miRNAs and their respective targets, it can be adapted to different cell lines, provided these are amenable to transfection.

Our initial hypothesis was that HuR could facilitate intronic miRNA biogenesis by binding to its pre-miRNA sequence. Thus, the connection of HuR expression and miR-17-92 cluster biogenesis could point to a new mechanism governing the maturation of these miRNAs. Overexpression of HuR upon transfection of pFLAG-HuR was confirmed in three different cell lines: HeLa, BCPAP, and HEK-293T (Figure 2). As controls, untransfected cells and cells transfected with empty pFLAG vectors were used...

We developed an intronic microRNA biogenesis reporter assay to be used in cells in vitro with four plasmids: one with intronic miRNA, one with the target, one to overexpress a regulatory protein, and one for Renilla luciferase. The miRNA was processed and could control luciferase expression by binding to the target sequence.

MicroRNAs (miRNAs) are short RNA molecules that are widespread in eukaryotes. Most miRNAs are transcribed from introns, and their maturation involves ...

a-reporter-assay-to-analyze-intronic-microrna-maturation-mammalian

Research

JoVE Journal

Cancer Research

Here we describe an assay that employs the power of microinjection coupled with fluorescent in situ hybridization in order to accurately measure the nuclear export kinetics of mRNA in mammalian somatic cells.

Analysis of mRNA Nuclear Export Kinetics in Mammalian Cells by Microinjection

MicroRNAs (miRNAs) are important regulators of gene expression and have been shown to play a role in numerous biological processes. To better understand miRNA-UTR interactions, we have created a genome-wide collection of 3  UTR luciferase reporters paired with a novel luciferase gene and assay reagent, the LightSwitch system.

Identifying Targets of Human microRNAs with the LightSwitch Luciferase Assay System using 3'UTR-reporter Constructs and a microRNA Mimic in Adherent Cells

We describe a fluorescence reporter assay to quickly identify and characterize genes that regulate mouse embryonic stem cell maintenance and self-renewal.

Oct4GiP Reporter Assay to Study Genes that Regulate Mouse Embryonic Stem Cell Maintenance and Self-renewal

The genetic reporter assay is a well-established and powerful tool for dissecting the relationship between DNA sequences and their gene regulatory activities. Coupling candidate regulatory elements to reporter genes that carry identifying sequence tags enables massive parallelization of these assays.

Massively Parallel Reporter Assays in Cultured Mammalian Cells

With the intent of characterizing changes in miRNAs on differentiated human neural stem cells (hNSCs) we describe hNSC differentiation on a three dimensional system,the evaluation of changes in microRNA expression by miRNA PCR array, and computational analysis for miRNA target prediction and its validation by dual luciferase assay.

Differentiation of a Human Neural Stem Cell Line on Three Dimensional Cultures, Analysis of MicroRNA and Putative Target Genes

Herein we propose a strategy to study the effect of a transcription factor of interest on the microRNA transcriptome using publically available data, computational resources and high throughput data from microRNA arrays after transfecting cells with small hairpin (sh)RNA targeting a transcription factor of interest.

Describing a Transcription Factor Dependent Regulation of the MicroRNA Transcriptome

This report describes a fast and reliable method for validating mRNA targets of cellular miRNAs. The method uses synthetic biotinylated Locked Nucleic Acid (LNA)-based miRNA mimics to capture target mRNA. Subsequently, streptavidin-coated magnetic beads are employed to pulldown the target mRNA for quantification by qPCR polymerase chain reaction.

Biotin-based Pulldown Assay to Validate mRNA Targets of Cellular miRNAs

micro-RNAs (miRNAs) are short and highly homologous RNA sequences, serving as post-transcriptional regulators of messenger RNAs (mRNAs). Current miRNA detection methods vary in sensitivity and specificity. We describe a protocol that combines in situ hybridization and immunostaining for concurrent detection of miRNA and protein molecules on mouse heart tissue sections.

Tissue-specific miRNA Expression Profiling in Mouse Heart Sections Using In Situ Hybridization

This protocol uses a probe-based real-time polymerase chain reaction (PCR), a sulforhodamine B (SRB) assay, 3’ untranslated regions (3’ UTR) cloning, and a luciferase assay to verify the target genes of a miRNA of interest and to understand the functions of miRNAs.

An In Vitro Protocol for Evaluating MicroRNA Levels, Functions, and Associated Target Genes in Tumor Cells

This protocol describes a reporter assay to study the regulation of mRNA translation in single oocytes during in vitro maturation.

Defining the Program of Maternal mRNA Translation during In vitro Maturation using a Single Oocyte Reporter Assay

This protocol describes a minigene reporter assay to monitor the impact of 5´-splice site mutations on splicing and develops suppressor U1 snRNA for the rescue of mutation-induced splicing inhibition. The reporter and suppressor U1 snRNA constructs are expressed in HeLa cells, and splicing is analyzed by primer extension or RT-PCR.

A Reporter Based Cellular Assay for Monitoring Splicing Efficiency

Learn a reporter assay to analyze intronic microRNA maturation in mammalian cells using luciferase-based detection. This method helps researchers study RNA-binding protein effects on miRNA biogenesis.

A Reporter Assay to Analyze Intronic microRNA Maturation in Mammalian Cells

Explore More Videos