Name: Laser Microdissection for Species-Agnostic Single-Tissue Applications (Video) | JoVE Journal
Uploaded: 2022-03-31T14:30:00.000+00:00
Duration: 8 min 57 s
Description: Learn laser capture microdissection combined with CEL-Seq2 for transcriptomic analysis of small tissue samples in C. elegans. This species-agnostic method enables precise gene expression studies without requiring species-specific genetic tools.

ai_agent_IP

ai_agent

maintenance

instantTrialDurationMinutes

isBiopharma

enableNewMyJoveSectionDesign

educationFeatures

seoMetaApi

ai_copilot_institution_blacklist

ai_chat_institution_blacklist

freeAccessWindow

ssoRoleCapture

scheduledMaintenanceBanner

joveLabsFeatures

disable_autoplay_for_bots

extended_trial_duration

5 minutes

This work was funded by NIH (R01GM141395) and NSF (1656736) grants to DF and NIH fellowship (F32GM136170) to AW. Figure 1 was created with the help of BioRender.com.

<ol><li>Haag, E. S., Fitch, D. H. A., Delattre, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((From+%26%2334%3Bthe+worm%26%2334%3B+to+%26%2334%3Bthe+worms%26%2334%3B+and+back+again%3A+the+evolutionary+developmental+biology+of+nematodes%5BTitle%5D)+AND+%22Genetics%22%5BJournal%5D)">From &#34;the worm&#34; to &#34;the worms&#34; and back again: the evolutionary developmental biology of nematodes.</a> Genetics. 210 (2), 397-433 (2018).</li>
<li>Sommer, R. J., Bumbarger, D. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Nematode+model+systems+in+evolution+and+development%5BTitle%5D)+AND+%22Wiley+Interdisciplinary+Reviews%3A+Developmental+Biology%22%5BJournal%5D)">Nematode model systems in evolution and development.</a> Wiley Interdisciplinary Reviews: Developmental Biology. 1 (3), 389-400 (2012).</li>
<li>WormBase. , Available from: 
 <a target="_blank" href="https://wormbase.org/#012-3-6">https://wormbase.org/#012-3-6</a> (2022).</li>
<li>WormAtlas. , Available from: 
 <a target="_blank" href="https://wormatlas.org">https://wormatlas.org</a> (2022).</li>
<li>WormBook. , Available from: 
 <a target="_blank" href="http://wormbook.org">http://wormbook.org</a> (2022).</li>
<li>WormBook in Genetics. , Available from: 
 <a target="_blank" href="https://academic.oup.com/genetics/pages/wormbook">https://academic.oup.com/genetics/pages/wormbook</a> (2022).</li>
<li>Cao, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Comprehensive+single-cell+transcriptional+profiling+of+a+multicellular+organism%5BTitle%5D)+AND+%22Science%22%5BJournal%5D)">Comprehensive single-cell transcriptional profiling of a multicellular organism.</a> Science. 357 (6352), 661-667 (2017).</li>
<li>Kaletsky, R., Murphy, C. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Transcriptional+profiling+of+C.+elegans+adult+cells+and+tissues+with+age%5BTitle%5D)+AND+%22Methods+in+Molecular+Biology%22%5BJournal%5D)">Transcriptional profiling of C. elegans adult cells and tissues with age.</a> Methods in Molecular Biology. 2144, 177-186 (2020).</li>
<li>Kaletsky, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Transcriptome+analysis+of+adult+Caenorhabditis+elegans+cells+reveals+tissue-specific+gene+and+isoform+expression%5BTitle%5D)+AND+%22PLoS+Genetics%22%5BJournal%5D)">Transcriptome analysis of adult Caenorhabditis elegans cells reveals tissue-specific gene and isoform expression.</a> PLoS Genetics. 14 (8), 1007559(2018).</li>
<li>Packer, J. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+lineage-resolved+molecular+atlas+of+C.+elegans+embryogenesis+at+single-cell+resolution%5BTitle%5D)+AND+%22Science%22%5BJournal%5D)">A lineage-resolved molecular atlas of C. elegans embryogenesis at single-cell resolution.</a> Science. 365 (6459), 1971(2019).</li>
<li>Kulkarni, A., Anderson, A. G., Merullo, D. P., Konopka, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Beyond+bulk%3A+a+review+of+single+cell+transcriptomics+methodologies+and+applications%5BTitle%5D)+AND+%22Current+Opinion+in+Biotechnology%22%5BJournal%5D)">Beyond bulk: a review of single cell transcriptomics methodologies and applications.</a> Current Opinion in Biotechnology. 58, 129-136 (2019).</li>
<li>Von Stetina, S. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Cell-specific+microarray+profiling+experiments+reveal+a+comprehensive+picture+of+gene+expression+in+the+C.+elegans+nervous+system%5BTitle%5D)+AND+%22Genome+Biology%22%5BJournal%5D)">Cell-specific microarray profiling experiments reveal a comprehensive picture of gene expression in the C. elegans nervous system.</a> Genome Biology. 8 (7), 135(2007).</li>
<li>Baugh, L. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+homeodomain+protein+PAL-1+specifies+a+lineage-specific+regulatory+network+in+the+C.+elegans+embryo%5BTitle%5D)+AND+%22Development%22%5BJournal%5D)">The homeodomain protein PAL-1 specifies a lineage-specific regulatory network in the C. elegans embryo.</a> Development. 132 (8), 1843-1854 (2005).</li>
<li>Haenni, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Analysis+of+C.+elegans+intestinal+gene+expression+and+polyadenylation+by+fluorescence-activated+nuclei+sorting+and+3%27-end-seq%5BTitle%5D)+AND+%22Nucleic+Acids+Research%22%5BJournal%5D)">Analysis of C. elegans intestinal gene expression and polyadenylation by fluorescence-activated nuclei sorting and 3'-end-seq.</a> Nucleic Acids Research. 40 (13), 6304-6318 (2012).</li>
<li>Zhang, S., Banerjee, D., Kuhn, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Isolation+and+culture+of+larval+cells+from+C.+elegans%5BTitle%5D)+AND+%22PLoS+One%22%5BJournal%5D)">Isolation and culture of larval cells from C. elegans.</a> PLoS One. 6 (4), 19505(2011).</li>
<li>Emmert-Buck, M. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Laser+capture+microdissection%5BTitle%5D)+AND+%22Science%22%5BJournal%5D)">Laser capture microdissection.</a> Science. 274 (5289), 998-1001 (1996).</li>
<li>Hashimshony, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((CEL-Seq2%3A+sensitive+highly-multiplexed+single-cell+RNA-Seq%5BTitle%5D)+AND+%22Genome+Biology%22%5BJournal%5D)">CEL-Seq2: sensitive highly-multiplexed single-cell RNA-Seq.</a> Genome Biology. 17, 77(2016).</li>
<li>Yanai, I., Hashimshony, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((CEL-Seq2-single-cell+RNA+sequencing+by+multiplexed+linear+amplification%5BTitle%5D)+AND+%22Methods+in+Molecular+Biology%22%5BJournal%5D)">CEL-Seq2-single-cell RNA sequencing by multiplexed linear amplification.</a> Methods in Molecular Biology. 1979, 45-56 (2019).</li>
<li>Porta-de-la-Riva, M., Fontrodona, L., Villanueva, A., Ceron, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Basic+Caenorhabditis+elegans+methods%3A+synchronization+and+observation%5BTitle%5D)+AND+%22Journal+of+Visualized+Experiments%3A+JoVE%22%5BJournal%5D)">Basic Caenorhabditis elegans methods: synchronization and observation.</a> Journal of Visualized Experiments: JoVE. (64), e4019(2012).</li>
<li>Baugh, L. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((To+grow+or+not+to+grow%3A+nutritional+control+of+development+during+Caenorhabditis+elegans+L1+arrest%5BTitle%5D)+AND+%22Genetics%22%5BJournal%5D)">To grow or not to grow: nutritional control of development during Caenorhabditis elegans L1 arrest.</a> Genetics. 194 (3), 539-555 (2013).</li>
<li>Baugh, L. R., Hu, P. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Starvation+responses+throughout+the+Caenorhabditis+elegans+life+cycle%5BTitle%5D)+AND+%22Genetics%22%5BJournal%5D)">Starvation responses throughout the Caenorhabditis elegans life cycle.</a> Genetics. 216 (4), 837-878 (2020).</li>
<li>Pepper, A. S., Killian, D. J., Hubbard, E. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Genetic+analysis+of+Caenorhabditis+elegans+glp-1+mutants+suggests+receptor+interaction+or+competition%5BTitle%5D)+AND+%22Genetics%22%5BJournal%5D)">Genetic analysis of Caenorhabditis elegans glp-1 mutants suggests receptor interaction or competition.</a> Genetics. 163 (1), 115-132 (2003).</li>
<li>Mok, D. Z., Sternberg, P. W., Inoue, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Morphologically+defined+sub-stages+of+C.+elegans+vulval+development+in+the+fourth+larval+stage%5BTitle%5D)+AND+%22BMC+Developmental+Biology%22%5BJournal%5D)">Morphologically defined sub-stages of C. elegans vulval development in the fourth larval stage.</a> BMC Developmental Biology. 15, 26(2015).</li>
<li>Lytal, N., Ran, D., An, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Normalization+methods+on+single-cell+RNA-seq+data%3A+an+empirical+survey%5BTitle%5D)+AND+%22Frontiers+in+Genetics%22%5BJournal%5D)">Normalization methods on single-cell RNA-seq data: an empirical survey.</a> Frontiers in Genetics. 11, 41(2020).</li>
<li>Vieth, B., Ziegenhain, C., Parekh, S., Enard, W., Hellmann, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((powsimR%3A+power+analysis+for+bulk+and+single+cell+RNA-seq+experiments%5BTitle%5D)+AND+%22Bioinformatics%22%5BJournal%5D)">powsimR: power analysis for bulk and single cell RNA-seq experiments.</a> Bioinformatics. 33 (21), 3486-3488 (2017).</li>
<li>Bolkova, J., Lanctot, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Quantitative+gene+expression+analysis+in+Caenorhabditis+elegans+using+single+molecule+RNA+FISH%5BTitle%5D)+AND+%22Methods%22%5BJournal%5D)">Quantitative gene expression analysis in Caenorhabditis elegans using single molecule RNA FISH.</a> Methods. 98, 42-49 (2016).</li>
<li>Ji, N., van Oudenaarden, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Single+molecule+fluorescent+in+situ+hybridization+%28smFISH%29+of+C.+elegans+worms+and+embryos%5BTitle%5D)+AND+%22WormBook%22%5BJournal%5D)">Single molecule fluorescent in situ hybridization (smFISH) of C. elegans worms and embryos.</a> WormBook. , 1-16 (2012).</li>
<li>Lee, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Single-molecule+RNA+fluorescence+in+situ+hybridization+%28smFISH%29+in+Caenorhabditis+elegans%5BTitle%5D)+AND+%22Bio-Protocol%22%5BJournal%5D)">Single-molecule RNA fluorescence in situ hybridization (smFISH) in Caenorhabditis elegans.</a> Bio-Protocol. 7 (12), 2357(2017).</li>
<li>Baird, S. E., Chamberlin, H. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Caenorhabditis+briggsae+methods%5BTitle%5D)+AND+%22WormBook%22%5BJournal%5D)">Caenorhabditis briggsae methods.</a> WormBook. , 1-9 (2006).</li>
<li>Felix, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Oscheius+tipulae%5BTitle%5D)+AND+%22WormBook%22%5BJournal%5D)">Oscheius tipulae.</a> WormBook. , 1-8 (2006).</li>
<li>Han, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Improving+transgenesis+efficiency+and+CRISPR-associated+tools+through+codon+optimization+and+native+intron+addition+in+Pristionchus+nematodes%5BTitle%5D)+AND+%22Genetics%22%5BJournal%5D)">Improving transgenesis efficiency and CRISPR-associated tools through codon optimization and native intron addition in Pristionchus nematodes.</a> Genetics. 216 (4), 947-956 (2020).</li>
<li>Fernandes Povoa, E. E., Ebbing, A. L. P., Betist, M. C., vander Veen, C., Korswagen, H. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((An+optimized+dissociation+protocol+for+FACS-based+isolation+of+rare+cell+types+from+Caenorhabditis+elegans+L1+larvae%5BTitle%5D)+AND+%22MethodsX%22%5BJournal%5D)">An optimized dissociation protocol for FACS-based isolation of rare cell types from Caenorhabditis elegans L1 larvae.</a> MethodsX. 7, 100922(2020).</li>
<li>Han, M., Wei, G., McManus, C. E., Hillier, L. W., Reinke, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Isolated+C.+elegans+germ+nuclei+exhibit+distinct+genomic+profiles+of+histone+modification+and+gene+expression%5BTitle%5D)+AND+%22BMC+Genomics%22%5BJournal%5D)">Isolated C. elegans germ nuclei exhibit distinct genomic profiles of histone modification and gene expression.</a> BMC Genomics. 20 (1), 500(2019).</li>
<li>Steiner, F. A., Henikoff, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Cell+type-specific+affinity+purification+of+nuclei+for+chromatin+profiling+in+whole+animals%5BTitle%5D)+AND+%22Methods+in+Molecular+Biology%22%5BJournal%5D)">Cell type-specific affinity purification of nuclei for chromatin profiling in whole animals.</a> Methods in Molecular Biology. 1228, 3-14 (2015).</li>
<li>Ebbing, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Spatial+transcriptomics+of+C.+elegans+males+and+hermaphrodites+identifies+sex-specific+differences+in+gene+expression+patterns%5BTitle%5D)+AND+%22Developmental+Cell%22%5BJournal%5D)">Spatial transcriptomics of C. elegans males and hermaphrodites identifies sex-specific differences in gene expression patterns.</a> Developmental Cell. 47 (6), 801-813 (2018).</li>
<li>Rödelsperger, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Spatial+transcriptomics+of+nematodes+identifies+sperm+cells+as+a+source+of+genomic+novelty+and+rapid+evolution%5BTitle%5D)+AND+%22Molecular+Biology+and+Evolution%22%5BJournal%5D)">Spatial transcriptomics of nematodes identifies sperm cells as a source of genomic novelty and rapid evolution.</a> Molecular Biology and Evolution. 38 (1), 229-243 (2021).</li>
<li>Amini, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((An+optimised+protocol+for+isolation+of+RNA+from+small+sections+of+laser-capture+microdissected+FFPE+tissue+amenable+for+next-generation+sequencing%5BTitle%5D)+AND+%22BMC+Molecular+Biology%22%5BJournal%5D)">An optimised protocol for isolation of RNA from small sections of laser-capture microdissected FFPE tissue amenable for next-generation sequencing.</a> BMC Molecular Biology. 18 (1), 22(2017).</li>
</ol>

All authors declare that they have no conflicts of interest.

Critical steps of the method 
If performed correctly, the method described here will obtain robust RNA profiles with a relatively small number of laser-dissected samples (70 tail tips in this example). However, for samples from developing animals, tight synchronization is critical to reducing the variability between samples. For this reason, the protocol recommends the hatch-off method for worm-synchronization. Here, the researcher can determine and precisely control the age difference between indiv...

Nematodes&#8212;particularly the rhabditid nematodes related to the model system Caenorhabditis elegans&#8212;are a wonderful group of animals for evolutionary developmental biology (EDB) for many reasons1,2. Advantages include their small number of cells, defined and consistent cell lineages, transparency, and ease of culture and husbandry. There are also many resources available, including high-quality genomes for multiple species, and for C. elegans, extensive molecular genetic tools and knowledge about development, genetics, anatomy, and physiology3,4,5,6.
As with many other organisms, the ability to characterize transcriptome dynamics in single tissues or single cells has revolutionized the analysis of development in C. elegans7,8,9,10. Being able to compare single-cell transcriptomes across nematodes would similarly transform EDB using these organisms. For example, such comparisons would provide insight into how gene regulatory networks have evolved for characters (traits) that have been conserved, for characters that have diverged, or for characters that evolved independently.

However, isolating particular tissues or cells from nematodes is one of the big challenges. For many organisms, single cells can be dissociated from tissues and harvested in an unbiased way or can be labeled with tissue-specific expression of a fluorescent protein and sorted by fluorescence-activated cell sorting (FACS)11. In C. elegans, high-throughput (HTP) isolation of cells has been limited mostly to embryos because the tough outer cuticle (and hydrostatic skeleton) has hampered cell isolation from larvae and adults. To get around this challenge, some methods have employed genetic tools in whole C. elegans worms, such as tissue-specific mRNA-tagging12, and differential expression comparisons between wild-type and mutants affecting a cell type13. More recent methods have overcome the challenge by dissolving the cuticle to isolate nuclei14 or entire cells8,9,15. Cell isolation and cell culture have the obvious disadvantages, however, that cells are removed from their natural developmental or anatomical context&#8212;e.g., away from cell-cell signaling and contact with the extracellular matrix&#8212;which are expected to impact the gene expression profile15. Moreover, the genetic tools and tissue-specific markers are species-specific (i.e., they can only be used in C. elegans).
LMD provides an alternative method for isolating tissues without disrupting the natural context of cells. Significantly for EDB, LMD also allows transcriptomes from homologous tissues of different species to be compared without the need for species-specific genetic toolkits if genome or whole transcriptome sequences of these species are available. LMD involves targeting tissues by direct microscopical observation and using a laser microbeam&#8212;integrated into the microscope&#39;s optics&#8212;to cut out and harvest (capture) the tissue of interest16. Limitations of LMD are that it is not conducive to very HTP approaches (although the transcription profiles for tail tips, as described in this protocol, were robust with ~70 samples), certain samples might be difficult to dissect out, and cuts are limited to the precision of the laser and what can be visualized in the microscope.
The purpose of the present protocol is to describe how LMD, followed by single-tissue RNA-Seq, can be used to obtain stage- and tissue-specific transcriptome data from nematodes. Specifically, it demonstrates LMD for isolating tail tips from fourth-stage larvae (L4) of C. elegans. However, this method can be adapted to other tissues and, of course, different species.
In C. elegans, there are 4 cells that make the tail tip in both males and hermaphrodites. During the L4 stage in males&#8212;but not in hermaphrodites&#8212;the tail tip cells change their shape and migrate anteriorly and inwardly. This process also occurs in some but not all other rhabditid nematode species. Therefore, the tail tip is a good model for the evolution of sexual dimorphic morphogenesis. Because of its position, the tail tip is also easy to isolate by LMD.
To obtain transcriptome profiles from tail tips, the present protocol uses CEL-Seq2, an RNA-seq method developed for single cells17,18. This method has several advantages for LMD-derived tissues. CEL-Seq2 is highly sensitive and efficient, using unique molecular identifiers (UMIs) to allow straightforward quantification of mRNA reads, in vitro transcription to ensure linear amplification, and barcoding that allows multiplexing of individual tissue samples. The only limitation of CEL-Seq2 is that recovered reads are biased to the 3&#39; end of mRNAs, and most isoforms thus cannot be distinguished.

<table><tbody><tr><td>&amp;nbsp;0.5 &amp;micro;M PEN membrane glass slides RNase free</td><td>Leica</td><td>11600288</td><td>for LMD</td></tr><tr><td>500 &amp;micro;L PCR tubes (nuclease-free)</td><td>Axygen</td><td>732-0675</td><td>to cut the tail tips into</td></tr><tr><td>Compound microscope with 40x objective and DIC</td><td>any</td><td></td><td>to check age of worms</td></tr><tr><td>Desktop humidifier</td><td>any</td><td></td><td></td></tr><tr><td>Dissection microscope with transmitted light base</td><td>any</td><td></td><td>for all worm work</td></tr><tr><td>glass pasteur pipets</td><td>any</td><td></td><td>handle of worm pick</td></tr><tr><td>glass slides and coverslips</td><td>any</td><td></td><td>to check age of worms</td></tr><tr><td>LMD6 microdissection system</td><td>Leica</td><td>multiple</td><td>to cut tail tips</td></tr><tr><td>LoBind tubes 0.5 mL</td><td>Eppendorf</td><td>22431005</td><td></td></tr><tr><td>M9 Buffer</td><td></td><td></td><td>Recipe in WormBook</td></tr><tr><td>Methanol 99.8%</td><td>Sigma</td><td>322415</td><td>to fix worms</td></tr><tr><td>NGM growth medium</td><td>US Biological</td><td>N1000</td><td>Buffers and salts need to be added: Recipe in WormBook</td></tr><tr><td>P10 pipette variablle volume</td><td>e.g. Gilson</td><td></td><td></td></tr><tr><td>P1000 pipette variable volume</td><td>e.g. Gilson</td><td></td><td></td></tr><tr><td>P2 pipette variable volume</td><td>e.g. Gilson</td><td></td><td></td></tr><tr><td>Pipette tips 1,000 &amp;micro;L</td><td>any</td><td></td><td></td></tr><tr><td>Pipette tips 1-10 &amp;micro;L filtered</td><td>any</td><td></td><td></td></tr><tr><td>platinum iridium wire</td><td>Tritech</td><td>PT-9010</td><td>to make worm pick</td></tr><tr><td>sterile and nuclease-free 1 mL centrfuge tubes</td><td>any</td><td></td><td></td></tr><tr><td>Tween 20</td><td>Sigma</td><td>P9416</td><td>Add a very small amount to M9 buffer to prevent worms from sticking to the pipet tips</td></tr><tr><td>vented 6 mm plastic Petri dishes</td><td>any</td><td></td><td></td></tr><tr><td>&lt;strong&gt;For CEL-Seq2&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>4200 TapeStation System with reagents for high-sensitivity RNA and DNA detection</td><td>Aligent</td><td></td><td>automated electrophoresis system</td></tr><tr><td>AMPure XP beads</td><td>Beckman Coulter</td><td>A63880</td><td>DNA cleanup beads</td></tr><tr><td>Bead binding buffer&amp;nbsp; 20% PEG8000, 2.5 M NaCl</td><td></td><td></td><td></td></tr><tr><td>CEL-Seq2 primers (see Table S1)</td><td>Sigma Genosys Mastercycler Nexus GX2 Eppendorf</td><td>6335000020</td><td>Thermal cycler with programmable lid and block for 200 &amp;micro;l tubes.</td></tr><tr><td>DNA Polymerase I (&lt;em&gt;E. coli&lt;/em&gt;)</td><td>Invitrogen</td><td>18052-025</td><td></td></tr><tr><td>dNTP mix 10 mM</td><td>any</td><td></td><td></td></tr><tr><td>&lt;em&gt;E. coli&lt;/em&gt; DNA ligase</td><td>Invitrogen</td><td>18052-019</td><td></td></tr><tr><td>Ethanol</td><td></td><td></td><td></td></tr><tr><td>ExoSAP-IT For PCR Product Clean-Up</td><td>Affymetrix</td><td>78200</td><td>exonuclease solution</td></tr><tr><td>MEGAscript T7 Transcription Kit</td><td>Ambion</td><td>AM1334</td><td>For step 4.6.1</td></tr><tr><td>Nuclease-free water</td><td>any</td><td></td><td></td></tr><tr><td>Phusion High-Fidelity PCR Master Mix with HF Buffer</td><td>NEB</td><td>M0531</td><td>PCR mix step 4.9.7</td></tr><tr><td>random hexamer RT primer GCCTTGGCACCCGAGAATTCCA&lt;br/&gt; NNNNNN</td><td>IDT</td><td></td><td>a primer with 6 nucleotides that are random</td></tr><tr><td>RNA Fragmentation buffer</td><td>NEB</td><td>E6150S</td><td></td></tr><tr><td>RNA Fragmentation stop buffer</td><td>NEB</td><td>E6150S</td><td></td></tr><tr><td>RNA PCR Index Primers (RPI1&amp;ndash;RPI48)</td><td>Illumina, NEB, or IDT</td><td></td><td>RPIX in protocol step 4.9.7, sequences available from Illumina</td></tr><tr><td>RNAClean XP beads</td><td>Beckman Coulter</td><td>A63987</td><td></td></tr><tr><td>RNase AWAY Surface Decontaminant</td><td>Thermo Scientific</td><td>7000TS1</td><td>or any other similar product</td></tr><tr><td>RNaseH (&lt;em&gt;E. coli&lt;/em&gt;)</td><td>Invitrogen</td><td>18021-071</td><td></td></tr><tr><td>RNaseOUT Recombinant Ribonuclease Inhibitor</td><td>Invitrogen</td><td>10777-019</td><td></td></tr><tr><td>Second strand buffer</td><td>Invitrogen</td><td>10812-014</td><td></td></tr><tr><td>Superscripit II</td><td>Invitrogen</td><td>18064-014</td><td>reverse transcriptase</td></tr></tbody></table>

laser microdissection for species-agnostic single-tissue applications

Laser Microdissection for Species-Agnostic Single-Tissue Applications

Single-cell methodologies have revolutionized the analysis of the transcriptomes of specific cell types. However, they often require species-specific genetic &#34;toolkits,&#34; such as promoters driving tissue-specific expression of fluorescent proteins. Further, protocols that disrupt tissues to isolate individual cells remove cells from their native environment (e.g., signaling from neighbors) and may result in stress responses or other differences from native gene expression states. In the present protocol, laser microdissection (LMD) is optimized to isolate individual nematode tail tips for the study of gene expression during male tail tip morphogenesis.
LMD allows the isolation of a portion of the animal without the need for cellular disruption or species-specific toolkits and is thus applicable to any species. Subsequently, single-cell RNA-seq library preparation protocols such as CEL-Seq2 can be applied to LMD-isolated single tissues and analyzed using standard pipelines, given that a well-annotated genome or transcriptome is available for the species. Such data can be used to establish how conserved or different the transcriptomes are that underlie the development of that tissue in different species.
Limitations include the ability to cut out the tissue of interest and the sample size. A power analysis shows that as few as 70 tail tips per condition are required for 80% power. Tight synchronization of development is needed to obtain this number of animals at the same developmental stage. Thus, a method to synchronize animals at 1 h intervals is also described.

Following laser capture microdissection, individual tail tips of males and hermaphrodites at 4 time points (L3 22 h after hatch; L4 24, 26, and 28 h after hatch) were prepared for RNA sequencing using the CEL-Seq2 protocol. CEL-Seq2 primers contain unique barcodes that enable sequencing reads from a particular sample (in this case an individual tail tip) to be identified bioinformatically. Sequencing data were generated with this method for a total of 557 tail tips (266 hermaphrodites and 291 males across 4 developmental...

A protocol is described that uses laser microdissection to isolate individual nematode tissues for RNA-sequencing. The protocol does not require species-specific genetic toolkits, allowing gene expression profiles to be compared between different species at the level of single-tissue samples.

Single-cell methodologies have revolutionized the analysis of the transcriptomes of specific cell types. However, they often require species-specific ...

laser-microdissection-for-species-agnostic-single-tissue-applications

Research

JoVE Journal

Biology

Laser capture microscopy, also known as laser microdissection (LMD), enables the user to isolate small numbers of cells or tissues from frozen or ...

Laser Capture Microdissection of Mammalian Tissue

The video describes the laser dissection of the 3D organotypic co-culture model with micron-level precision. In 3D organotypic models, stromal constituents such as fibroblasts are 3-dimensionally co-cultured with cancer epithelial cells. The 3D model serves as an experimental tool that enables invasion and cancer-stroma interactions to be studied in near-physiological conditions.

Laser Microdissection: A Technique to Isolate Invading Colorectal Cancer cells from a 3D Organotypic Culture Model

This video describes the technique for obtaining a single cell from a heterogeneous cell population using laser capture microdissection. The single isolated cell can be used for further genomic studies or cancer research.

Single Cell Sampling Using Laser Capture Microdissection: A Technique to Harvest Target Cells from a Heterogeneous Cell Population

SIVQ-LCM is an innovative approach that harnesses a computer algorithm, Spatially Invariant Vector Quantization (SIVQ), to drive the laser capture microdissection (LCM) process. The SIVQ-LCM workflow greatly improves the speed and accuracy of microdissection, with applications in both the research and clinical settings.

SIVQ-LCM Protocol for the ArcturusXT Instrument

Microdissection has been extensively employed for the examination of DNA, RNA, and protein within tissue.   Laser capture microscopy (LCM) is the most commonly used method, but a new milling technique, mesodissection, is recently available.  We demonstrate RNA extraction from mesodissected formalin fixed paraffin embedded tissue slides of Mycobacterium tuberculosis granulomas.

A Novel Microdissection Approach to Recovering Mycobacterium tuberculosis Specific Transcripts from Formalin Fixed Paraffin Embedded Lung Granulomas

The isolation of individual dopamine neurons or the ventral tegmental area with direct or indirect immunohistochemistry is demonstrated using laser capture microdissection. Parameters for isolation of tissue from a glass slide using an infrared laser and from membrane slides using the combination of an infrared and ultraviolet laser are discussed.

Laser Capture Microdissection - A Demonstration of the Isolation of Individual Dopamine Neurons and the Entire Ventral Tegmental Area

Here we present a protocol for laser-assisted microdissection of specific plant cell types for transcriptional profiling. While the protocol is suitable for different species and cell types, the focus is on highly inaccessible cells of the female germline important for sexual and apomictic reproduction in the crucifer genus Boechera.

Laser-assisted Microdissection (LAM) as a Tool for Transcriptional Profiling of Individual Cell Types

Laser microdissection (LMD) is a sensitive and highly reproducible technique that can be used to uncover pathways that mediate glioma heterogeneity and invasion. Here, we describe an optimized protocol to isolate discrete areas from glioma tissue using laser LMD followed by transcriptomic analysis.

Laser Capture Microdissection of Glioma Subregions for Spatial and Molecular Characterization of Intratumoral Heterogeneity, Oncostreams, and Invasion

This protocol describes a high-throughput workflow for artificial intelligence-driven segmentation of pathology-confirmed regions of interest from stained, thin tissue section images for enrichment of histology-resolved cell populations using laser microdissection. This strategy includes a novel algorithm enabling the transfer of demarcations denoting cell populations of interest directly to laser microscopes.

Industrialized, Artificial Intelligence-guided Laser Microdissection for Microscaled Proteomic Analysis of the Tumor Microenvironment

Laser capture microdissection of oral submucous fibrosis tissues allows for precise extraction of cells from histological regions of interest for the analysis of multi-omics data with morphological and spatial information.

Isolation of Cells with Morphological and Spatial Information from Oral Submucous Fibrosis Samples by Laser Capture Microdissection

This protocol describes a method to isolate RNA from defined histological regions of paraformaldehyde-fixed, Optimal Cutting Temperature compound-embedded mouse liver tissue using laser capture microdissection, enabling targeted downstream gene expression analysis.

Laser Capture Microdissection of Paraformaldehyde-Fixed Mouse Liver Tissue for RNA Analysis

Learn laser capture microdissection combined with CEL-Seq2 for transcriptomic analysis of small tissue samples in C. elegans. This species-agnostic method enables precise gene expression studies without requiring species-specific genetic tools.

Laser Microdissection for Species-Agnostic Single-Tissue Applications

Explore More Videos