Name: A Pipeline to Investigate the Structures and Signaling Pathways of Sphingosine 1-Phosphate Receptors (Video) | JoVE Journal
Uploaded: 2022-06-08T15:00:00.000+00:00
Duration: 12 min 27 s
Description: Explore a pipeline to investigate S1P receptor structures and signaling pathways using cryo-EM and protein purification. This method advances drug development for targeted therapies.

ai_agent_IP

ai_agent

maintenance

instantTrialDurationMinutes

isBiopharma

enableNewMyJoveSectionDesign

educationFeatures

seoMetaApi

ai_copilot_institution_blacklist

ai_chat_institution_blacklist

freeAccessWindow

ssoRoleCapture

scheduledMaintenanceBanner

joveLabsFeatures

disable_autoplay_for_bots

extended_trial_duration

5 minutes

The data of the S1PRs-Gi complex were harvested at the West China Cryo-EM Center in Sichuan University and Cryo-EM Center at the Southern University of Science and Technology (SUSTech) and processed at Duyu High-Performance Computing Center in Sichuan University. This work was supported by the Natural Science Foundation of China (32100965 to L.C., 32100988 to W.Y., 31972916 to Z.S.) and the full-time Postdoctoral Research Fund of Sichuan University (2021SCU12003 to L.C.)

<ol><li>Verstockt, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Sphingosine+1-phosphate+modulation+and+immune+cell+trafficking+in+inflammatory+bowel+disease%5BTitle%5D)+AND+%22Nature+Reviews%3A+Gastroenterology+%26+Hepatology%22%5BJournal%5D)">Sphingosine 1-phosphate modulation and immune cell trafficking in inflammatory bowel disease.</a> Nature Reviews: Gastroenterology & Hepatology. , 1-16 (2022).</li>
<li>Rosen, H., Stevens, R. C., Hanson, M., Roberts, E., Oldstone, M. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Sphingosine-1-phosphate+and+its+receptors%3A+structure%2C+signaling%2C+and+influence%5BTitle%5D)+AND+%22Annual+Review+of+Biochemistry%22%5BJournal%5D)">Sphingosine-1-phosphate and its receptors: structure, signaling, and influence.</a> Annual Review of Biochemistry. 82, 637-662 (2013).</li>
<li>Cartier, A., Hla, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Sphingosine+1-phosphate%3A+Lipid+signaling+in+pathology+and+therapy%5BTitle%5D)+AND+%22Science%22%5BJournal%5D)">Sphingosine 1-phosphate: Lipid signaling in pathology and therapy.</a> Science. 366 (6463), 5551(2019).</li>
<li>Jozefczuk, E., Guzik, T. J., Siedlinski, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Significance+of+sphingosine-1-phosphate+in+cardiovascular+physiology+and+pathology%5BTitle%5D)+AND+%22Pharmacological+Research%22%5BJournal%5D)">Significance of sphingosine-1-phosphate in cardiovascular physiology and pathology.</a> Pharmacological Research. 156, 104793(2020).</li>
<li>Kihara, Y., Maceyka, M., Spiegel, S., Chun, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Lysophospholipid+receptor+nomenclature+review%3A+IUPHAR+Review+8%5BTitle%5D)+AND+%22British+Journal+of+Pharmacology%22%5BJournal%5D)">Lysophospholipid receptor nomenclature review: IUPHAR Review 8.</a> British Journal of Pharmacology. 171 (15), 3575-3594 (2014).</li>
<li>Bryan, A. M., Del Poeta, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Sphingosine-1-phosphate+receptors+and+innate+immunity%5BTitle%5D)+AND+%22Cellular+Microbiology%22%5BJournal%5D)">Sphingosine-1-phosphate receptors and innate immunity.</a> Cellular Microbiology. 20 (5), 12836(2018).</li>
<li>Pelletier, D., Hafler, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Fingolimod+for+multiple+sclerosis%5BTitle%5D)+AND+%22New+England+Journal+of+Medicine%22%5BJournal%5D)">Fingolimod for multiple sclerosis.</a> New England Journal of Medicine. 366 (4), 339-347 (2012).</li>
<li>Obinata, H., Hla, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Sphingosine+1-phosphate+and+inflammation%5BTitle%5D)+AND+%22International+Immunology%22%5BJournal%5D)">Sphingosine 1-phosphate and inflammation.</a> International Immunology. 31 (9), 617-625 (2019).</li>
<li>Pyne, N. J., Pyne, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Sphingosine+1-phosphate+and+cancer%5BTitle%5D)+AND+%22Nature+Reviews%3A+Cancer%22%5BJournal%5D)">Sphingosine 1-phosphate and cancer.</a> Nature Reviews: Cancer. 10 (7), 489-503 (2010).</li>
<li>Abu-Farha, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+role+of+lipid+metabolism+in+COVID-19+virus+infection+and+as+a+drug+target%5BTitle%5D)+AND+%22International+Journal+of+Molecular+Sciences%22%5BJournal%5D)">The role of lipid metabolism in COVID-19 virus infection and as a drug target.</a> International Journal of Molecular Sciences. 21 (10), 3544(2020).</li>
<li>Chun, J., Kihara, Y., Jonnalagadda, D., Blaho, V. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Fingolimod%3A+lessons+learned+and+new+opportunities+for+treating+Multiple+Sclerosis+and+other+disorders%5BTitle%5D)+AND+%22Annual+Review+of+Pharmacology+and+Toxicology%22%5BJournal%5D)">Fingolimod: lessons learned and new opportunities for treating Multiple Sclerosis and other disorders.</a> Annual Review of Pharmacology and Toxicology. 59, 149-170 (2019).</li>
<li>Murakami, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Sphingosine+1-phosphate+%28S1P%29+regulates+vascular+contraction+via+S1P3+receptor%3A+investigation+based+on+a+new+S1P3+receptor+antagonist%5BTitle%5D)+AND+%22Molecular+Pharmacology%22%5BJournal%5D)">Sphingosine 1-phosphate (S1P) regulates vascular contraction via S1P3 receptor: investigation based on a new S1P3 receptor antagonist.</a> Molecular Pharmacology. 77 (4), 704-713 (2010).</li>
<li>Cao, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Siponimod+for+multiple+sclerosis%5BTitle%5D)+AND+%22Cochrane+Database+of+Systematic+Reviews%22%5BJournal%5D)">Siponimod for multiple sclerosis.</a> Cochrane Database of Systematic Reviews. 11, (2021).</li>
<li>Scott, L. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Siponimod%3A+a+review+in+secondary+progressive+Multiple+Sclerosis%5BTitle%5D)+AND+%22CNS+Drugs%22%5BJournal%5D)">Siponimod: a review in secondary progressive Multiple Sclerosis.</a> CNS Drugs. 34 (11), 1191-1200 (2020).</li>
<li>Lamb, Y. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Ozanimod%3A+first+approval%5BTitle%5D)+AND+%22Drugs%22%5BJournal%5D)">Ozanimod: first approval.</a> Drugs. 80 (8), 841-848 (2020).</li>
<li>Scott, F. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Ozanimod+%28RPC1063%29+is+a+potent+sphingosine-1-phosphate+receptor-1+%28S1P1%29+and+receptor-5+%28S1P5%29+agonist+with+autoimmune+disease-modifying+activity%5BTitle%5D)+AND+%22British+Journal+of+Pharmacology%22%5BJournal%5D)">Ozanimod (RPC1063) is a potent sphingosine-1-phosphate receptor-1 (S1P1) and receptor-5 (S1P5) agonist with autoimmune disease-modifying activity.</a> British Journal of Pharmacology. 173 (11), 1778-1792 (2016).</li>
<li>McGowan, E. M., Haddadi, N., Nassif, N. T., Lin, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Targeting+the+SphK-S1P-SIPR+pathway+as+a+potential+therapeutic+approach+for+COVID-19%5BTitle%5D)+AND+%22International+Journal+of+Molecular+Sciences%22%5BJournal%5D)">Targeting the SphK-S1P-SIPR pathway as a potential therapeutic approach for COVID-19.</a> International Journal of Molecular Sciences. 21 (19), 7189(2020).</li>
<li>O'Sullivan, C., Dev, K. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+structure+and+function+of+the+S1P1+receptor%5BTitle%5D)+AND+%22Trends+in+Pharmacological+Sciences%22%5BJournal%5D)">The structure and function of the S1P1 receptor.</a> Trends in Pharmacological Sciences. 34 (7), 401-412 (2013).</li>
<li>Liao, M., Cao, E., Julius, D., Cheng, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Structure+of+the+TRPV1+ion+channel+determined+by+electron+cryo-microscopy%5BTitle%5D)+AND+%22Nature%22%5BJournal%5D)">Structure of the TRPV1 ion channel determined by electron cryo-microscopy.</a> Nature. 504 (7478), 107-112 (2013).</li>
<li>Bai, X. C., McMullan, G., Scheres, S. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((How+cryo-EM+is+revolutionizing+structural+biology%5BTitle%5D)+AND+%22Trends+in+Biochemical+Sciences%22%5BJournal%5D)">How cryo-EM is revolutionizing structural biology.</a> Trends in Biochemical Sciences. 40 (1), 49-57 (2015).</li>
<li>Murata, K., Wolf, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Cryo-electron+microscopy+for+structural+analysis+of+dynamic+biological+macromolecules%5BTitle%5D)+AND+%22Biochimica+et+Biophysica+Acta+General+Subjects%22%5BJournal%5D)">Cryo-electron microscopy for structural analysis of dynamic biological macromolecules.</a> Biochimica et Biophysica Acta General Subjects. 1862 (2), 324-334 (2018).</li>
<li>Zhang, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Cryo-EM+structure+of+an+activated+GPCR-G+protein+complex+in+lipid+nanodiscs%5BTitle%5D)+AND+%22Nature+Structural+%26+Molecular+Biology%22%5BJournal%5D)">Cryo-EM structure of an activated GPCR-G protein complex in lipid nanodiscs.</a> Nature Structural & Molecular Biology. 28 (3), 258-267 (2021).</li>
<li>Renaud, J. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Cryo-EM+in+drug+discovery%3A+achievements%2C+limitations+and+prospects%5BTitle%5D)+AND+%22Nature+Reviews%3A+Drug+Discovery%22%5BJournal%5D)">Cryo-EM in drug discovery: achievements, limitations and prospects.</a> Nature Reviews: Drug Discovery. 17 (7), 471-492 (2018).</li>
<li>Ishchenko, A., Gati, C., Cherezov, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Structural+biology+of+G+protein-coupled+receptors%3A+new+opportunities+from+XFELs+and+cryoEM%5BTitle%5D)+AND+%22Current+Opinion+in+Structural+Biology%22%5BJournal%5D)">Structural biology of G protein-coupled receptors: new opportunities from XFELs and cryoEM.</a> Current Opinion in Structural Biology. 51, 44-52 (2018).</li>
<li>Yang, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((G+protein-coupled+receptors%3A+structure-+and+function-based+drug+discovery%5BTitle%5D)+AND+%22Signal+Transduction+and+Targeted+Therapy%22%5BJournal%5D)">G protein-coupled receptors: structure- and function-based drug discovery.</a> Signal Transduction and Targeted Therapy. 6 (1), 7(2021).</li>
<li>Yuan, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Structures+of+signaling+complexes+of+lipid+receptors+S1PR1+and+S1PR5+reveal+mechanisms+of+activation+and+drug+recognition%5BTitle%5D)+AND+%22Cell+Research%22%5BJournal%5D)">Structures of signaling complexes of lipid receptors S1PR1 and S1PR5 reveal mechanisms of activation and drug recognition.</a> Cell Research. 31 (12), 1263-1274 (2021).</li>
<li>Zhao, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Structural+insights+into+sphingosine-1-phosphate+recognition+and+ligand+selectivity+of+S1PR3-Gi+signaling+complexes%5BTitle%5D)+AND+%22Cell+Research%22%5BJournal%5D)">Structural insights into sphingosine-1-phosphate recognition and ligand selectivity of S1PR3-Gi signaling complexes.</a> Cell Research. 32 (2), 218-221 (2022).</li>
<li>Xu, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Structural+basis+of+sphingosine-1-phosphate+receptor+1+activation+and+biased+agonism%5BTitle%5D)+AND+%22Nature+Chemical+Biology%22%5BJournal%5D)">Structural basis of sphingosine-1-phosphate receptor 1 activation and biased agonism.</a> Nature Chemical Biology. 18, 281-288 (2022).</li>
<li>Liu, Y. F., Ghahremani, M. H., Rasenick, M. M., Jakobs, K. H., Albert, P. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Stimulation+of+cAMP+synthesis+by+Gi-coupled+receptors+upon+ablation+of+distinct+Galphai+protein+expression.+Gi+subtype+specificity+of+the+5-HT1A+receptor%5BTitle%5D)+AND+%22Journal+of+Biological+Chemistry%22%5BJournal%5D)">Stimulation of cAMP synthesis by Gi-coupled receptors upon ablation of distinct Galphai protein expression. Gi subtype specificity of the 5-HT1A receptor.</a> Journal of Biological Chemistry. 274 (23), 16444-16450 (1999).</li>
<li>Buccioni, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Innovative+functional+cAMP+assay+for+studying+G+protein-coupled+receptors%3A+application+to+the+pharmacological+characterization+of+GPR17%5BTitle%5D)+AND+%22Purinergic+Signalling%22%5BJournal%5D)">Innovative functional cAMP assay for studying G protein-coupled receptors: application to the pharmacological characterization of GPR17.</a> Purinergic Signalling. 7 (4), 463-468 (2011).</li>
<li>Wang, F. I., Ding, G., Ng, G. S., Dixon, S. J., Chidiac, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Luciferase-based+GloSensor+cAMP+assay%3A+Temperature+optimization+and+application+to+cell-based+kinetic+studies%5BTitle%5D)+AND+%22Methods%22%5BJournal%5D)">Luciferase-based GloSensor cAMP assay: Temperature optimization and application to cell-based kinetic studies.</a> Methods. , (2021).</li>
<li>Audet, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Small-scale+approach+for+precrystallization+screening+in+GPCR+X-ray+crystallography%5BTitle%5D)+AND+%22Nature+Protocols%22%5BJournal%5D)">Small-scale approach for precrystallization screening in GPCR X-ray crystallography.</a> Nature Protocols. 15 (1), 144-160 (2020).</li>
<li>Sgro, G. G., Costa, T. R. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Cryo-EM+grid+preparation+of+membrane+protein+samples+for+single+particle+analysis%5BTitle%5D)+AND+%22Frontiers+in+Molecular+Biosciences%22%5BJournal%5D)">Cryo-EM grid preparation of membrane protein samples for single particle analysis.</a> Frontiers in Molecular Biosciences. 5, 74(2018).</li>
<li>White, J. B. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Single+particle+cryo-electron+microscopy%3A+from+sample+to+structure%5BTitle%5D)+AND+%22Journal+of+Visualized+Experiments%22%5BJournal%5D)">Single particle cryo-electron microscopy: from sample to structure.</a> Journal of Visualized Experiments. (171), e62415(2021).</li>
<li>Thompson, R. F., Iadanza, M. G., Hesketh, E. L., Rawson, S., Ranson, N. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Collection%2C+pre-processing+and+on-the-fly+analysis+of+data+for+high-resolution%2C+single-particle+cryo-electron+microscopy%5BTitle%5D)+AND+%22Nature+Protocols%22%5BJournal%5D)">Collection, pre-processing and on-the-fly analysis of data for high-resolution, single-particle cryo-electron microscopy.</a> Nature Protocols. 14 (1), 100-118 (2019).</li>
<li>Fernandez-Leiro, R., Scheres, S. H. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+pipeline+approach+to+single-particle+processing+in+RELION%5BTitle%5D)+AND+%22Acta+Crystallographica+Section+D%22%5BJournal%5D)">A pipeline approach to single-particle processing in RELION.</a> Acta Crystallographica Section D. 73 (6), 496-502 (2017).</li>
<li>Punjani, A., Rubinstein, J. L., Fleet, D. J., Brubaker, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((cryoSPARC%3A+algorithms+for+rapid+unsupervised+cryo-EM+structure+determination%5BTitle%5D)+AND+%22Nature+Methods%22%5BJournal%5D)">cryoSPARC: algorithms for rapid unsupervised cryo-EM structure determination.</a> Nature Methods. 14 (3), 290-296 (2017).</li>
<li>Brilot, A. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Beam-induced+motion+of+vitrified+specimen+on+holey+carbon+film%5BTitle%5D)+AND+%22Journal+of+Structural+Biology%22%5BJournal%5D)">Beam-induced motion of vitrified specimen on holey carbon film.</a> Journal of Structural Biology. 177 (3), 630-637 (2012).</li>
<li>Zheng, S. Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((MotionCor2%3A+anisotropic+correction+of+beam-induced+motion+for+improved+cryo-electron+microscopy%5BTitle%5D)+AND+%22Nature+Methods%22%5BJournal%5D)">MotionCor2: anisotropic correction of beam-induced motion for improved cryo-electron microscopy.</a> Nature Methods. 14 (4), 331-332 (2017).</li>
<li>Zhang, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Gctf%3A+Real-time+CTF+determination+and+correction%5BTitle%5D)+AND+%22Journal+of+Structural+Biology%22%5BJournal%5D)">Gctf: Real-time CTF determination and correction.</a> Journal of Structural Biology. 193 (1), 1-12 (2016).</li>
<li>Scheres, S. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Semi-automated+selection+of+cryo-EM+particles+in+RELION-1.3%5BTitle%5D)+AND+%22Journal+of+Structural+Biology%22%5BJournal%5D)">Semi-automated selection of cryo-EM particles in RELION-1.3.</a> Journal of Structural Biology. 189 (2), 114-122 (2015).</li>
<li>Liu, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Differential+activation+mechanisms+of+lipid+GPCRs+by+lysophosphatidic+acid+and+sphingosine+1-phosphate%5BTitle%5D)+AND+%22Nature+Communications%22%5BJournal%5D)">Differential activation mechanisms of lipid GPCRs by lysophosphatidic acid and sphingosine 1-phosphate.</a> Nature Communications. 13 (1), 731(2022).</li>
<li>Duan, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Cryo-EM+structure+of+an+activated+VIP1+receptor-G+protein+complex+revealed+by+a+NanoBiT+tethering+strategy%5BTitle%5D)+AND+%22Nature+Communications%22%5BJournal%5D)">Cryo-EM structure of an activated VIP1 receptor-G protein complex revealed by a NanoBiT tethering strategy.</a> Nature Communications. 11 (1), 4121(2020).</li>
<li>DiIorio, M. C., Kulczyk, A. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+robust+single-particle+cryo-electron+microscopy+%28cryo-EM%29+processing+workflow+with+cryoSPARC%2C+RELION%2C+and+Scipion%5BTitle%5D)+AND+%22Journal+of+Visualized+Experiments%22%5BJournal%5D)">A robust single-particle cryo-electron microscopy (cryo-EM) processing workflow with cryoSPARC, RELION, and Scipion.</a> Journal of Visualized Experiments. (179), e63387(2022).</li>
<li>Pradelles, P., Grassi, J., Chabardes, D., Guiso, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Enzyme+immunoassays+of+adenosine+cyclic+3%27%2C5%27-monophosphate+and+guanosine+cyclic+3%27%2C5%27-monophosphate+using+acetylcholinesterase%5BTitle%5D)+AND+%22Analytical+Chemistry%22%5BJournal%5D)">Enzyme immunoassays of adenosine cyclic 3',5'-monophosphate and guanosine cyclic 3',5'-monophosphate using acetylcholinesterase.</a> Analytical Chemistry. 61 (5), 447-453 (1989).</li>
<li>Jiang, L. I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Use+of+a+cAMP+BRET+sensor+to+characterize+a+novel+regulation+of+cAMP+by+the+sphingosine+1-phosphate%2FG13+pathway%5BTitle%5D)+AND+%22Journal+of+Biological+Chemistry%22%5BJournal%5D)">Use of a cAMP BRET sensor to characterize a novel regulation of cAMP by the sphingosine 1-phosphate/G13 pathway.</a> Journal of Biological Chemistry. 282 (14), 10576-10584 (2007).</li>
</ol>

Authors have no conflicts of interest.

This protocol describes a primary pipeline for determining the structures of S1PRs by cryo-EM and measuring the activation potency of S1PRs by Gi-mediated cAMP inhibition assay. Some steps are crucial to the experiment's success.
To purify the S1PRs-Gi complex, the quality of the virus and the health of sf9 cells should be paid more attention to. The expression of the receptor is dramatically reduced in poor sf9 cells. The health of sf9 cells was assessed by measurin...

Sphingosine-1-phosphate (S1P), a metabolic product of sphingolipids in the cell membrane, is a ubiquitous lysophosphatidic signaling molecule that involves various biological activities, including lymphocyte trafficking, vascular development, endothelial integrity, and heart rate1,2,3. S1P exerts its diverse physiological effects through five S1P receptor subtypes (S1PRs 1-5); S1PRs are found in a variety of tissues and exhibit unique preferences for downstream G proteins4,5. S1PR1 is primarily coupled with the Gi protein, which subsequently inhibits cAMP production; S1PR2 and S1PR3 are coupled with Gi, Gq, and G12/13, and S1PR4 and S1PR5 transduce signal through Gi and G12/136.
S1P-S1PR signaling is a critical therapeutic target for multiple diseases, including autoimmune disorders7, inflammation8, cancer9, and even COVID-1910. In 2010, fingolimod (FTY720) was licensed as a first-in-class drug targeting S1PRs to treat relapse multiple sclerosis (MS)11. However, it is capable of binding to all S1PRs except S1PR2, while nonspecific binding to S1PR3 results in edema of the cerebral cortex, vascular and bronchial constriction, and lung epithelial leakage12. As an alternate strategy for increasing therapeutic selectivity, subtype-specific ligands for the receptor have been produced. Siponimod (BAF312) was approved in 2019 for the relapse MS treatment13; it effectively targets S1PR1 and S1PR5, whereas it has no affinity for S1PR3, exhibiting fewer side effects in clinical practice14. In 2020, the US Food and Drug Administration authorized ozanimod for MS therapy15. It has been reported that ozanimod holds a 25-fold greater selectivity for S1PR1 than for S1PR516. Notably, in the context of the current COVID-19 pandemic, it has been discovered that agonist drugs targeting S1PRs may be utilized to treat COVID-19 by using immunomodulatory therapy techniques17. In comparison with fingolimod, the ozanimod has shown superiority in lowering symptoms in COVID-19 patients and is now undergoing clinical trials10. Understanding the structural basis and function of S1PRs lays a significant foundation for developing a drug that selectively targets S1PRs18.
Many techniques are used to investigate the structural information of biomacromolecules, including X-ray crystallography, nuclear magnetic resonance (NMR), and electron microscopy (EM). As of March 2022, there are more than 180,000 structures deposited on the Protein Databank (PDB), and most of them have been resolved by X-ray crystallography. However, with the first near-atomic resolution structure of TPRV1 (3.4 &#197; resolution) reported by Yifan Cheng and David Julius in 201319, cryo-electron microscopy (cryo-EM) has become a mainstream technique for protein structures, and the total number of EM PDB structures was more than 10,000. The critical breakthrough areas are the development of new cameras for imaging known as direct electron detection cameras and new image processing algorithms. Cryo-EM has revolutionized structure biology and structure-based drug discovery in the past decade20. As understanding how macromolecular complexes fulfill their complicated roles in the living cell is a central theme in biological sciences, cryo-EM has the potential to reveal conformations of dynamic molecular complexes, particularly for transmembrane proteins21. G-protein coupled receptors (GPCRs) are the largest superfamily of transmembrane proteins and the targets of more than 30% of currently marketed pharmaceuticals22. The development of cryo-EM has contributed to a burst of high-resolution structures of GPCR-G protein complexes, enabling structural determination for &#39;intractable&#39; targets that are still not accessible to X-ray crystallographic analysis in drug design23. Hence, the cryo-EM application provides a chance to determine the three-dimensional structure of GPCRs in near-native conditions at close to atomic resolution24. Advancements in cryo-EM make it possible to visualize mechanistic underpinnings of GPCR stimulation or inhibition, and further benefit in uncovering the novel binding sites for GPCR-targeted drug creation25.
Relying on the tremendous strides of cryo-EM technology, we have identified structures of agonized S1PR1-, S1PR3-, and S1PR5-Gi signaling complexes recently26,27. In humans, S1PRs are found in various tissues and exhibit unique preferences for downstream G proteins4,5. S1PR1 is primarily coupled with the Gi protein, which subsequently inhibits 3&#8242;,5&#8242;-cyclic adenosine monophosphate (cAMP) production. S1PR3 and S1PR5 are also capable of coupling with Gi6,28. Since Gi-coupled receptor activation decreases the production of cAMP29, a Gi-inhibition cAMP assay was introduced to measure cAMP inhibition effects for capturing functional alterations26,27. Using a mutant version of Photinus pyralis luciferase wherein a cAMP-binding protein moiety has been inserted, this cAMP assay offers a simple and reliable method for monitoring GPCR activity through changes in intracellular cAMP concentration30. It is a sensitive and non-radioactive functional assay and can be applied to monitor the real-time downstream signaling of a wide range of GPCRs for drug discovery purposes31.
Here, a summary is provided of the critical methods in resolving the activation and drug recognition modes of S1PRs, primarily including cryo-EM manipulations and a Gi-inhibition cAMP assay. This article aims to provide comprehensive experimental guidance for further explorations into the structures and functions of GPCRs.

<table><tbody><tr><td>0.05% trypsin-EDTA</td><td>GIBCO</td><td>Cat# 25300054</td><td></td></tr><tr><td>0.22 &amp;micro;M filter</td><td>Thermo Fisher Scientific</td><td>Cat# 42213-PS</td><td></td></tr><tr><td>100 kDa cut-off concentrator</td><td>Thermo Fisher Scientific</td><td>Cat# 88533</td><td></td></tr><tr><td>6-well plate</td><td>Corning</td><td>Cat# 43016</td><td></td></tr><tr><td>96-well plate</td><td>Corning</td><td>Cat# 3917</td><td></td></tr><tr><td>Aprotinin</td><td>Sigma-Aldrich</td><td>Cat# 9087-70-1</td><td></td></tr><tr><td>Apyrase</td><td>NEB</td><td>Cat# M0398S</td><td></td></tr><tr><td>Baculovirus transfection reagent</td><td>Thermo Fisher Scientific</td><td>Cat# 10362100</td><td>For the preparation of P0 baculovirus</td></tr><tr><td>Benzamidine</td><td>Sigma-Aldrich</td><td>Cat# B6506</td><td></td></tr><tr><td>CHO-K1</td><td>ATCC</td><td>N/A</td><td></td></tr><tr><td>CHS</td><td>Sigma-Aldrich</td><td>Cat# C6512</td><td></td></tr><tr><td>CryoSPARC</td><td>Punjani, A., et al.,2017</td><td>https://cryosparc.com/</td><td></td></tr><tr><td>DH5&amp;alpha; competent E.coli</td><td>Thermo Fisher Scientific</td><td>Cat# EC0112</td><td></td></tr><tr><td>D-Luciferin-Potassium Salt</td><td>Sigma- Aldrich</td><td>Cat# 50227</td><td></td></tr><tr><td>DMSO</td><td>Sigma- Aldrich</td><td>Cat# D2438</td><td></td></tr><tr><td>EDTA</td><td>Thermo Fisher Scientific</td><td>Cat# S311-500</td><td></td></tr><tr><td>ESF921 cell culture medium</td><td>Expression Systems</td><td>Cat#&amp;nbsp; 96-001</td><td></td></tr><tr><td>Excel</td><td>microsoft</td><td>N/A</td><td></td></tr><tr><td>F12 medium</td><td>Invitrogen</td><td>Cat# 11765</td><td></td></tr><tr><td>FBS</td><td>Cell Box</td><td>Cat# SAG-01U-02</td><td></td></tr><tr><td>Flag resin</td><td>Sigma- Aldrich</td><td>Cat# A4596</td><td></td></tr><tr><td>Forskolin</td><td>APExBIO</td><td>Cat# B1421</td><td></td></tr><tr><td>Gctf</td><td>Zhang, 2016</td><td>&amp;nbsp;https://www.mrc-lmb.cam.ac.uk/kzhang/Gctf/</td><td></td></tr><tr><td>GDN</td><td>Anatrace</td><td>Cat# GDN101</td><td></td></tr><tr><td>Gel filtration column</td><td>GE healthcare</td><td>Cat# 28990944</td><td></td></tr><tr><td>Gen5 3.11</td><td>BIO-TEK</td><td>N/A</td><td></td></tr><tr><td>Gentamicin</td><td>Solarbio</td><td>Cat# L1312</td><td></td></tr><tr><td>GloSensor cAMP assay kit</td><td>Promega</td><td>Cat# E1291</td><td>Gi-inhibition cAMP assay kit</td></tr><tr><td>GloSensor plasmid</td><td>Promega</td><td>Cat# E2301</td><td>Sensor plasmid</td></tr><tr><td>Grace&amp;rsquo;s medium</td><td>GIBCO</td><td>Cat# 11595030</td><td></td></tr><tr><td>GraphPad Prism 8</td><td>Graphpad</td><td>N/A</td><td></td></tr><tr><td>HBSS</td><td>Thermo Fisher Scientific</td><td>Cat# 88284</td><td></td></tr><tr><td>HEPES</td><td>Sigma- Aldrich</td><td>Cat# H4034</td><td></td></tr><tr><td>jetPRIME Reagent</td><td>Polyplus Transfection</td><td>Cat# 114-15</td><td>transfection reagent</td></tr><tr><td>Janamycin</td><td>Solarbio</td><td>Cat# K1030</td><td></td></tr><tr><td>LB medium</td><td>Invitrogen</td><td>Cat# 12780052</td><td></td></tr><tr><td>Leupeptin</td><td>Sigma-Aldrich</td><td>Cat# L2884</td><td></td></tr><tr><td>LMNG</td><td>Anatrace</td><td>Cat# NG310</td><td></td></tr><tr><td>MotionCor2</td><td>(Zheng et al., 2017)</td><td>https://emcore.ucsf.edu/ucsf-software</td><td></td></tr><tr><td>NanoCab</td><td>Thermo Fisher Scientific</td><td>Cat# 1121822</td><td></td></tr><tr><td>PBS</td><td>Invitrogen</td><td>Cat# 14190-144</td><td></td></tr><tr><td>pcDNA3.1-HA-FLAG-S1PRs</td><td>GenScript</td><td>N/A</td><td></td></tr><tr><td>pFastBac1-G&amp;alpha;&lt;sub&gt;i&lt;/sub&gt;</td><td>GenScript</td><td>N/A</td><td></td></tr><tr><td>pFastBac1-HA-FLAG-T4L-S1PRs-His10</td><td>GenScript</td><td>N/A</td><td></td></tr><tr><td>pFastBacdual-G&amp;beta;1&amp;gamma;2</td><td>GenScript</td><td>N/A</td><td></td></tr><tr><td>PureLink HiPure Plasmid Miniprep Kit</td><td>Invitrogen</td><td>Cat# K210003</td><td>For the preparation of plasmids and P0 baculovirus</td></tr><tr><td>Q5 site-Directed Mutagenesis kit</td><td>NEB</td><td>Cat# E0554S</td><td>For the preparation of plasmids</td></tr><tr><td>Quantifoil</td><td>Quantifoil</td><td>Cat# 251448</td><td></td></tr><tr><td>RELION-3.1</td><td>(Zivanov et al., 2018)</td><td>https://www2.mrc-lmb.cam.ac.uk/relion</td><td></td></tr><tr><td>S1PRs cDNA</td><td>addgene</td><td>N/A</td><td></td></tr><tr><td>scFv16</td><td>Invitrogen</td><td>Cat# 703976</td><td></td></tr><tr><td>Sf9</td><td>Expression Systems</td><td>N/A</td><td></td></tr><tr><td>Siponimod</td><td>Selleck</td><td>Cat# S7179</td><td></td></tr><tr><td>sodium cholate</td><td>Sigma-Aldrich</td><td>Cat# C1254</td><td></td></tr><tr><td>Synergy H1 microplate reader</td><td>BIO-TEK</td><td>N/A</td><td></td></tr><tr><td>Synthetic T4L DNA (sequence)</td><td>N/A</td><td>N/A</td><td>Aacatcttcgagatgctgcgcatcgacgaagg&lt;br/&gt; cctgcgtctcaagatttacaagaataccgaagg&lt;br/&gt; ttattacacgattggcatcggccacctcctgaca&lt;br/&gt; aagagcccatcactcaacgctgccaagtctga&lt;br/&gt; actggacaaagccattggtcgcaacaccaac&lt;br/&gt; ggtgtcattacaaaggacgaggcggagaaac&lt;br/&gt; tcttcaaccaagatgtagatgcggctgtccgtgg&lt;br/&gt; catcctgcgtaatgccaagttgaagcccgtgt&lt;br/&gt; atgactcccttgatgctgttcgccgtgcagcctt&lt;br/&gt; gatcaacatggttttccaaatgggtgagaccgg&lt;br/&gt; agtggctggttttacgaactccctgcgcatgctcc&lt;br/&gt; agcagaagcgctgggacgaggccgcagtga&lt;br/&gt; atttggctaaatctcgctggtacaatcagacacc&lt;br/&gt; taaccgtgccaagcgtgtcatcactaccttccg&lt;br/&gt; tactggaacttgggacgcttac</td></tr><tr><td>TCEP</td><td>Thermo Fisher Scientific</td><td>Cat# 77720</td><td></td></tr><tr><td>Tetracycline</td><td>Solarbio</td><td>Cat# T8180</td><td></td></tr><tr><td>Vitrobot Mark IV</td><td>Thermo Fisher Scientific</td><td>N/A</td><td></td></tr></tbody></table>

a pipeline to investigate the structures and signaling pathways of sphingosine 1-phosphate receptors

A Pipeline to Investigate the Structures and Signaling Pathways of Sphingosine 1-Phosphate Receptors

Lysophospholipids (LPLs) are bioactive lipids that include sphingosine 1-phosphate (S1P), lysophosphatidic acid, etc. S1P, a metabolic product of sphingolipids in the cell membrane, is one of the best-characterized LPLs that regulates a variety of cellular physiological responses via signaling pathways mediated by sphingosine 1-phosphate receptors (S1PRs). This implicated that the S1P-S1PRs signaling system is a remarkable potential therapeutic target for disorders, including multiple sclerosis (MS), autoimmune disorders, cancer, inflammation, and even COVID-19. S1PRs, a small subset of the class A G-protein coupled receptor (GPCR) family, are composed of five subtypes: S1PR1, S1PR2, S1PR3, S1PR4, and S1PR5. The lack of detailed structural information, however, impedes the drug discovery targeting S1PRs. Here, we applied the cryo-electron microscopy method to solve the structure of the S1P-S1PRs complex, and elucidated the mechanism of activation, selective drug recognition, and G-protein coupling by using cell-based functional assays. Other lysophospholipid receptors (LPLRs) and GPCRs can also be studied using this strategy.

Before freezing the sample of S1PRs-Gi complex, the purified sample needs to be separated by size-exclusion chromatography (SEC) and analyzed with gel filtration chromatography. Figure 2 shows the S1PR3-Gi complex as an example. The peak fraction of the homogeneous GPCR-G protein complex was usually located at ~10.5 mL of the size-exclusion chromatography (Figure 2A). SDS-page analysis of the S1PR3-Gi complex (Figure 2B) reveals fou...

S1P exerts its diverse physiological effects through the S1P receptors (S1PRs) subfamily. Here, a pipeline is described to expound on the structures and function of S1PRs.

Lysophospholipids (LPLs) are bioactive lipids that include sphingosine 1-phosphate (S1P), lysophosphatidic acid, etc. S1P, a metabolic product of ...

a-pipeline-to-investigate-structures-signaling-pathways-sphingosine-1

Research

JoVE Journal

Biochemistry

Live imaging of cells exposed to the lipophilic dye FM1-43 allows precise determination of the kinetics by which pore-forming toxins are removed from the plasma membrane. This is a sensitive assay that can be used to assess requirements for Ca2+, sphingomyelinase and other factors on plasma membrane repair.

Live Imaging Assay for Assessing the Roles of Ca2+ and Sphingomyelinase in the Repair of Pore-forming Toxin Wounds

Phosphoinositides are signaling lipids whose relative abundance rapidly changes in response to various stimuli. This article describes a method to measure the abundance of phosphoinositides by metabolically labeling cells with 3H-myo-inositol, followed by extraction and deacylation. Extracted glycero-inositides are then separated by high-performance liquid chromatography and quantified by flow scintillation.

Radiolabeling and Quantification of Cellular Levels of Phosphoinositides by High Performance Liquid Chromatography-coupled Flow Scintillation

PI(4,5)P2 regulates various cellular functions, but its nanoscale organization in the cell plasma membrane is poorly understood. By labeling PI(4,5)P2 with a dual-color fluorescent probe fused to the Pleckstrin Homology domain, we describe a novel approach to study the PI(4,5)P2 spatial distribution in the plasma membrane at the nanometer scale.

Single-molecule Super-resolution Imaging of Phosphatidylinositol 4,5-bisphosphate in the Plasma Membrane with Novel Fluorescent Probes

Here, we present a protocol to quantify and qualify each sphingomyelin species using multiple reaction monitoring and MS/MS/MS mode, respectively.

Quantitative and Qualitative Method for Sphingomyelin by LC-MS Using Two Stable Isotopically Labeled Sphingomyelin Species

Here, we describe protocols using fluorescent lipid sensors and liposomes to determine whether a protein extracts and transports phosphatidylserine or phosphatidylinositol 4-phosphate in vitro.

Fluorescence-Based Measurements of Phosphatidylserine/Phosphatidylinositol 4-Phosphate Exchange Between Membranes

Sphingolipids are bioactive metabolites with well-established roles in human disease. Characterizing alterations in tissues with mass-spectrometry can reveal roles in disease etiology or identify therapeutic targets. However, the OCT-compound used for cryopreservation in biorepositories interferes with mass-spectrometry. We outline methods to analyze sphingolipids in human tissues embedded in OCT with LC-ESI-MS/MS.

Preparation of Human Tissues Embedded in Optimal Cutting Temperature Compound for Mass Spectrometry Analysis

This protocol utilizes agarose swelling as a powerful and generalizable technique for incorporating integral membrane proteins (IMPs) into giant unilamellar lipid vesicles (GUVs), as described here for the reconstitution of the human 1A serotonin receptor protein (5-HT1AR), one of the classes of pharmacologically important G protein-coupled receptors.

Construction of Model Lipid Membranes Incorporating G-protein Coupled Receptors (GPCRs)

We present a cost-effective method for assessing liposomal membrane permeability with superior sensitivity and resolution over conventional techniques. Using a novel encapsulated ligand substitution reaction, this technique detects phospholipase A2-induced changes in model membranes. Easily integrated with standard analyses, this accessible approach enhances resolution for studying membrane biophysics and toxin interactions.

A Liposome Membrane Permeability Assay for Investigating the Effects of Phosphatidylinositol Phosphate Groups on Membranotropic Action of Venom PLA2

We present guidelines for developing synthetic 'chemical transducers' that can induce communication between naturally unrelated proteins. In addition, detailed protocols are presented for synthesizing and testing a specific 'transducer' that enables a growth factor to activate a detoxifying enzyme and consequently, to regulate the cleavage of an anticancer prodrug.

Mimicking the Function of Signaling Proteins: Toward Artificial Signal Transduction Therapy

Guanosine triphosphate (GTP) binding is one of the earliest events in G-Protein-Coupled Receptor (GPCR) activation. This protocol describes how to pharmacologically characterize specific GPCR-ligand interactions by monitoring the binding of the radio-labeled GTP analog, [35S]guanosine-5'-O-(3-thio)triphosphate ([35S]GTPγS), in response to a ligand of interest.

Measuring G-protein-coupled Receptor Signaling via Radio-labeled GTP Binding

Explore a pipeline to investigate S1P receptor structures and signaling pathways using cryo-EM and protein purification. This method advances drug development for targeted therapies.

A Pipeline to Investigate the Structures and Signaling Pathways of Sphingosine 1-Phosphate Receptors

Explore More Videos