Name: Single-Molecule Diffusion and Assembly on Polymer-Crowded Lipid Membranes (Video) | JoVE Journal
Uploaded: 2022-07-19T13:00:00.000+00:00
Duration: 10 min 43 s
Description: Learn single-molecule imaging on crowded supported lipid bilayers using smTIRF microscopy. This protocol analyzes binding, diffusion, and assembly of membrane biomolecules in polymer-crowded environments.

ai_agent_IP

ai_agent

maintenance

instantTrialDurationMinutes

isBiopharma

enableNewMyJoveSectionDesign

educationFeatures

seoMetaApi

ai_copilot_institution_blacklist

ai_chat_institution_blacklist

freeAccessWindow

ssoRoleCapture

scheduledMaintenanceBanner

joveLabsFeatures

disable_autoplay_for_bots

extended_trial_duration

5 minutes

The authors acknowledge Prof. Benjamin Schuler for sharing the expression plasmid for ClyA protein. This work was supported by Human Frontier Science Program (RGP0047-2020).

The authors have nothing to disclose.

Here, we demonstrate single-molecule experiments on supported lipid bilayers (SLBs) that manifest a crowded environment for membrane-embedded biomolecules. The crowded environment generates an excluded volume effect, leading to the enhancement of biomolecular reactions1,2,39,40. For the PEG-lipid system, where the polymer primarily occupies the volume outside the bilayer, this effect is especia...

Cellular membranes are highly crowded and complex systems1. Molecular crowding can have a considerable impact on the diffusion of membrane-bound entities like protein and lipids2,3,4. Similarly, bimolecular reactions on lipid membranes like receptor dimerization or the oligomerization of membrane complexes are influenced by crowding5,6,7. The nature, configuration, and concentration of crowders can govern the membrane binding, diffusivity, and protein-protein interaction in several ways8,9. Since controlling membrane crowding on cellular membranes and interpreting its influence on embedded biomolecules is challenging, researchers have tried to establish alternate in vitro systems10.
A popular approach for artificial crowded membranes is doping the bilayer membranes with polymer (such as polyethylene glycol, PEG)-grafted lipids11,12. During the visualization of protein and lipid dynamics on supported lipid bilayers (SLBs), these polymers additionally shield the membrane-embedded components from the underlying negatively charged substrate (such as glass) by effectively lifting the bilayer away from the underlying support. By varying the size and concentration of the polymer, one can control the extent of molecular crowding, as well as its separation from the underlying solid support13,14. This is clearly an advantage over lipid bilayers supported on solid substrates without polymer cushions15,16, where transmembrane biomolecules can lose their activity17,18,19. More importantly, it allows us to recapitulate the crowded environment of the cell membrane in vitro, which is critical for many membrane processes.
Surface-grafted polymers on membranes also undergo changes in their configuration depending on their grafting density12. At low concentrations, they remain in an entropically coiled configuration, known as a mushroom, above the membrane surface. With increasing concentration, they start to interact and tend to uncoil and extend, finally yielding a dense brush-like formation on the membrane21. Since the transition from the mushroom to the brush regime is highly heterogeneous and manifests in poorly characterized conditions of the polymer, it is important to use well-characterized conditions for crowding on polymer-grafted membranes. Compared to a recent study20, we identify and report crowded membrane compositions that maintain the diffusive transport and activity of transmembrane biomolecules.
In this protocol, we discuss how to generate PEGylated lipid membranes and provide recommendations for PEG densities that mimic crowding in two different regimes of polymer configuration (namely, mushroom and brush). The protocol also describes single-molecule binding, particle tracking, and photobleaching data acquisition and analysis for molecules embedded in these crowded membranes. First, we describe the thorough cleaning steps, the assembly of the imaging chamber, and the generation of PEG-SLBs. Second, we provide details for the single-molecule binding, particle tracking, and photobleaching experiments. Third, we discuss i) extracting the relative binding affinities, ii) characterizing molecular diffusion, and iii) counting subunits in a protein assembly from movies of single molecules on the membrane.
While we characterized this system with single-molecule imaging, the protocol is useful for all membrane biophysicists interested in understanding the effect of crowding on biomolecular reactions on lipid membranes. Overall, we present a robust pipeline for making crowded and supported lipid bilayers, along with various single-molecule assays conducted on them and the corresponding analysis routines.

<table><tbody><tr><td>2.5 ml Syringes</td><td>HMD Healthcare</td><td>Dispo Van, 2.5 ml Tuberculin</td><td>Plastic syringe</td></tr><tr><td>Acetone</td><td>Finar Chemicals</td><td>10020LL025</td><td></td></tr><tr><td>Acrylic Sheet</td><td></td><td></td><td>2 mm thick</td></tr><tr><td>Acrylic Sheet</td><td>BigiMall</td><td></td><td>2 mm, Clear</td></tr><tr><td>Bath Sonicator</td><td>Branson</td><td>CPX-1800</td><td></td></tr><tr><td>Calcium Chloride</td><td></td><td></td><td></td></tr><tr><td>Chloroform</td><td>Sigma</td><td>528730</td><td>&amp;nbsp;HPLC grade</td></tr><tr><td>Cholesterol</td><td>Avanti</td><td>700100</td><td></td></tr><tr><td>Coplin Jar</td><td>Duran Wheaton Kimble</td><td>S6016</td><td>8 Slide Jar with Glass Cover</td></tr><tr><td>Coverslips</td><td>VWR</td><td>631-1574</td><td>24 mm X 50 mm</td></tr><tr><td>Cy3-DNA Strand</td><td>IDT</td><td></td><td>GCTGCTATTGCGTCCGTTTGGTT&lt;br/&gt; GGTGTGGTTGG-Cy3</td></tr><tr><td>Cyanine Dye (Cy3)</td><td>Cytiva Life Sciences</td><td>PA23001</td><td></td></tr><tr><td>DiI</td><td>Invitrogen</td><td>D3911</td><td>Dil Stain (1,1&#039;-Dioctadecyl-3,3,3&#039;,3&#039;-Tetramethylindocarbocyanine Perchlorate (&#039;DiI&#039;; DiIC18(3)))</td></tr><tr><td>DNA Connector Strand 1</td><td>Sigma Aldrich</td><td></td><td>GCTGCTATTGCGTCCGTTTAGCT&lt;br/&gt; GGGGGAGTATTGCGGAGGAAGC&lt;br/&gt; T</td></tr><tr><td>DNA Connector Strand 2</td><td>Sigma Aldrich</td><td></td><td>CGGACGCAATAGCAGCTCACAG&lt;br/&gt; TCGGTCACAT</td></tr><tr><td>DNA Tocopherol Strand</td><td>Biomers</td><td></td><td>Toco-CCCAATGTGACCGACTGTGA</td></tr><tr><td>DOPE-PEG2000</td><td>Avanti</td><td>880130</td><td>1,2-dioleoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000] (ammonium salt)</td></tr><tr><td>Double Sided Tape</td><td>3M</td><td>LF93010LE</td><td></td></tr><tr><td>Drill Bits (Diamond Coated)</td><td></td><td></td><td>0.5 - 1 mm</td></tr><tr><td>Drilling Machine</td><td>Dremel</td><td>220</td><td>Workstation</td></tr><tr><td>EMCCD</td><td>Andor</td><td>DU-897U-CS0-#BV</td><td></td></tr><tr><td>Fluorescence Beads</td><td>Invitrogen</td><td>F10720</td><td></td></tr><tr><td>Glass Slides</td><td>Blue Star</td><td></td><td>Micro Slides, PIC-1</td></tr><tr><td>Glass Vials</td><td>Sigma</td><td>854190</td><td></td></tr><tr><td>Hydrogen Peroxide</td><td>Lobachemie</td><td>00182</td><td>30% Solution, AR Grade</td></tr><tr><td>Labolene</td><td>Thermo-Fischer Scientific</td><td></td><td>&amp;nbsp;Detergent</td></tr><tr><td>Laser 532 nm</td><td>Coherent</td><td>Sapphire</td><td></td></tr><tr><td>Laser Cutter</td><td>Universal Laser Systems</td><td>ILS12.75</td><td></td></tr><tr><td>Lissamine Rhodamine DOPE</td><td>Avanti</td><td>810150</td><td>1,2-dioleoyl-sn-glycero-3-phosphoethanolamine-N-(lissamine rhodamine B sulfonyl) (ammonium salt)</td></tr><tr><td>Methanol</td><td>Finar Chemicals</td><td>30932LL025</td><td></td></tr><tr><td>Microscope</td><td>Olympus</td><td>IX81</td><td></td></tr><tr><td>Phosphate Buffer Saline (PBS)</td><td></td><td></td><td>1X</td></tr><tr><td>Plasma Cleaner</td><td>Harrick Plasma Inc</td><td>PDC-002</td><td></td></tr><tr><td>POPC</td><td>Avanti</td><td>850457</td><td>1-palmitoyl-2-oleoyl-glycero-3-phosphocholine</td></tr><tr><td>Programmable Syringe Pump</td><td>New Era Pump Systems</td><td>NE1010</td><td>High Pressure Syringe Pump</td></tr><tr><td>PTFE Caps</td><td>Sigma</td><td>27141</td><td></td></tr><tr><td>PTFE Tubing</td><td>Cole-Parmer</td><td>WW-06417-21</td><td>Masterflex, 0.022&quot; ID x 0.042&quot; OD</td></tr><tr><td>Sulphuric Acid</td><td>SD Fine Chemicals</td><td></td><td>98%, AR Grade</td></tr><tr><td>TIRF Objective</td><td>Olympus</td><td>UPLAPO100XOHR</td><td></td></tr><tr><td>Vacuum Desiccator</td><td>Tarsons</td><td></td><td></td></tr><tr><td>Vortex Mixer</td><td>Tarsons</td><td></td><td></td></tr></tbody></table>

single-molecule diffusion and assembly on polymer-crowded lipid membranes

Single-Molecule Diffusion and Assembly on Polymer-Crowded Lipid Membranes

Cellular membranes are highly crowded environments for biomolecular reactions and signaling. Yet, most in vitro experiments probing protein interaction with lipids employ naked bilayer membranes. Such systems lack the complexities of crowding by membrane-embedded proteins and glycans and exclude the associated volume effects encountered on cellular membrane surfaces. Also, the negatively charged glass surface onto which the lipid bilayers are formed prevents the free diffusion of transmembrane biomolecules. Here, we present a well-characterized polymer-lipid membrane as a mimic for crowded lipid membranes. This protocol utilizes polyethylene glycol (PEG)-conjugated lipids as a generalized approach for incorporating crowders into the supported lipid bilayer&#160;(SLB). First, a cleaning procedure of the microscopic slides and coverslips for performing single-molecule experiments is presented. Next, methods for characterizing the PEG-SLBs and performing single-molecule experiments of the binding, diffusion, and assembly of biomolecules using single-molecule tracking and photobleaching are discussed. Finally, this protocol demonstrates how to monitor the nanopore assembly of bacterial pore-forming toxin Cytolysin A (ClyA) on crowded lipid membranes with single-molecule photobleaching analysis. MATLAB codes with example datasets are also included to perform some of the common analyses such as particle tracking, extracting diffusive behavior, and subunit counting.

Monitoring the binding of ClyA protein on PEGylated membranes 
After step 4.5, the binding kinetics are estimated by plotting the number of particles binding to the membrane surface over time (Video 1). As ClyA protein binds to a membrane with 5 mol% PEG2000 lipids,the particle density increases and reaches saturation (Figure 5). An exponential decay fit to the bound particles (cyan circles) gives the time constant (τb) for the membrane binding...

Here, a protocol to perform and analyze the binding, mobility, and assembly of single molecules on artificial crowded lipid membranes using single-molecule total internal reflection fluorescence (smTIRF) microscopy is presented.

Cellular membranes are highly crowded environments for biomolecular reactions and signaling. Yet, most in vitro experiments probing protein interaction ...

single-molecule-diffusion-assembly-on-polymer-crowded-lipid

Research

JoVE Journal

Biochemistry

We demonstrate a storable, transportable lipid bilayer formation system. A lipid bilayer membrane can be formed within 1 hr with over 80% success rate when a frozen membrane precursor is brought to ambient temperature. This system will reduce laborious processes and expertise associated with ion channels.

Automated Lipid Bilayer Membrane Formation Using a Polydimethylsiloxane Thin Film

A protocol for the synthesis and characterization of diffusive motion of cyclic polymers at the single molecule level is presented.

Synthesis of Cyclic Polymers and Characterization of Their Diffusive Motion in the Melt State at the Single Molecule Level

We present a protocol to functionalize glass with nanometric protein patches surrounded by a fluid lipid bilayer. These substrates are compatible with advanced optical microscopy and are expected to serve as platform for cell adhesion and migration studies.

Ligand Nano-cluster Arrays in a Supported Lipid Bilayer

At the interface of organic and aqueous solvents, tailored amphiphilic elastin-like proteins assemble into complex supramolecular structures such as vesicles, fibers and coacervates triggered by environmental parameters. The described assembly protocols yield Protein Membrane-Based Compartments (PMBCs) with tunable properties, enabling the encapsulation of various cargo.

Directed Assembly of Elastin-like Proteins into defined Supramolecular Structures and Cargo Encapsulation In Vitro

Mitochondrial fusion is an important homeostatic reaction underlying mitochondrial dynamics. Described here is an in vitro reconstitution system to study mitochondrial inner-membrane fusion that can resolve membrane tethering, docking, hemifusion, and pore opening. The versatility of this approach in exploring cell membrane systems is discussed.

A Model Membrane Platform for Reconstituting Mitochondrial Membrane Dynamics

This protocol describes the formation of cell mimicking uni-lipid and multi-lipid vesicles, supported lipid bilayers, and suspended lipid bilayers. These in vitro models can be adapted to incorporate a variety of lipid types and can be used to investigate various molecule and macromolecule interactions.

Assembly of Cell Mimicking Supported and Suspended Lipid Bilayer Models for the Study of Molecular Interactions

This protocol describes the formation of supported lipid bilayers and the addition of cytoskeletal filaments and motor proteins to study the dynamics of reconstituted, membrane-tethered cytoskeletal networks using fluorescence microscopy.

Reconstitution of Membrane-Tethered Minimal Actin Cortices on Supported Lipid Bilayers

Cell-free reconstitution has been a key tool to understand the cytoskeleton assembly, and work in the last decade has established approaches to study septin dynamics in minimal systems. Presented here are three complementary methods to observe septin assembly in different membrane contexts: planar bilayers, spherical supports, and rod supports.

Reconstitution of Septin Assembly at Membranes to Study Biophysical Properties and Functions

This protocol describes how to use TIRF microscopy to track individual ion channels and determine their activity in supported lipid membranes, thereby defining the interplay between lateral membrane movement and channel function. It describes how to prepare the membranes, record the data, and analyze the results.

Single-Molecule Imaging of Lateral Mobility and Ion Channel Activity in Lipid Bilayers using Total Internal Reflection Fluorescence (TIRF) Microscopy

The present protocol describes octanol-assisted liposome assembly (OLA), a microfluidic technique to generate biocompatible liposomes. OLA produces monodispersed, micron-sized liposomes with efficient encapsulation, allowing immediate on-chip experimentation. This protocol is anticipated to be particularly suitable for synthetic biology and synthetic cell research.

On-Chip Octanol-Assisted Liposome Assembly for Bioengineering

Learn single-molecule imaging on crowded supported lipid bilayers using smTIRF microscopy. This protocol analyzes binding, diffusion, and assembly of membrane biomolecules in polymer-crowded environments.

Single-Molecule Diffusion and Assembly on Polymer-Crowded Lipid Membranes

Explore More Videos