Name: Postmortem Diagnosis of Rabies in Animals by the Updated, Multiplexed LN34 Real-Time Reverse Transcription-Polymerase Chain Reaction Assay (Video) | JoVE Journal
Uploaded: 2025-05-02T12:35:00.000+00:00
Duration: 9 min 54 s
Description: Learn the updated LN34 multiplex RT-PCR assay for postmortem rabies diagnosis in animals. This protocol covers tissue collection, RNA extraction, and result interpretation with quality controls.

ai_agent_IP

ai_agent

maintenance

instantTrialDurationMinutes

isBiopharma

enableNewMyJoveSectionDesign

educationFeatures

seoMetaApi

ai_copilot_institution_blacklist

ai_chat_institution_blacklist

freeAccessWindow

ssoRoleCapture

scheduledMaintenanceBanner

joveLabsFeatures

disable_autoplay_for_bots

extended_trial_duration

5 minutes

We acknowledge the efforts and collaboration of many rabies diagnostic testing laboratories who have contributed to the implementation, validation, and optimization of the LN34 assay through their open data sharing and feedback. Use of trade names and commercial sources is for identification only and does not imply endorsement by the Centers for Disease Control and Prevention, the U.S. Department of Health and Human Services, or the authors&#39; affiliated institutions. The conclusions, findings, and opinions expressed by authors do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Centers for Disease Control and Prevention, or the authors&#39; affiliated institutions.

<ol><li>Meechan, P. J., Potts, J. <a target="_blank" href="http://scholar.google.com/scholar?hl=en&safe=off&q=author%3aMeechan%2C+PJ+%22Biosafety+in+Microbiological+and+Biomedical+Laboratories%22">Biosafety in Microbiological and Biomedical Laboratories</a>. , Centers for Disease Control and Prevention. (2020).</li>
<li>Terrestrial Manual 2023. , World Organization for Animal Health. At
 <a target="_blank" href="https://www.woah.org/en/what-we-do/standards/codes-and-manuals">https://www.woah.org/en/what-we-do/standards/codes-and-manuals</a> (2023).</li>
<li>Laboratory Techniques in Rabies. Volume 1, World Health Organization. At
 <a target="_blank" href="https://iris.who.int/handle/10665/310836">https://iris.who.int/handle/10665/310836</a> (2018).</li>
<li>Laboratory Techniques in Rabies. Volume 2, World Health Organization. At
 <a target="_blank" href="https://iris.who.int/bitstream/handle/10665/310837/9789241515306-eng.pdf?ua=1">https://iris.who.int/bitstream/handle/10665/310837/9789241515306-eng.pdf?ua=1</a> (2019).</li>
<li>Genevie, R., et al. Protocol for postmortem diagnosis of rabies in animals by direct fluorescent antibody testing: A minimum standard for rabies diagnosis in the United States. , At
 <a target="_blank" href="https://www.cdc.gov/rabies/pdf/RabiesDFASPv2.pdf">https://www.cdc.gov/rabies/pdf/RabiesDFASPv2.pdf</a> (2003).</li>
<li>World Health Organization. <a target="_blank" href="http://scholar.google.com/scholar?hl=en&safe=off&q=%22WHO+Expert+Consultation+on+Rabies%3A+Third+Report%22">WHO Expert Consultation on Rabies: Third Report</a>. , World Health Organization. Geneva. (2018).</li>
<li>Gigante, C. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Multi-site+evaluation+of+the+LN34+pan-lyssavirus+real-time+RT-PCR+assay+for+postmortem+rabies+diagnostics%5BTitle%5D)+AND+%22PLoS+One%22%5BJournal%5D)">Multi-site evaluation of the LN34 pan-lyssavirus real-time RT-PCR assay for postmortem rabies diagnostics.</a> PLoS One. 13 (5), e0197074(2018).</li>
<li>Wadhwa, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+Pan-Lyssavirus+Taqman+Real-Time+RT-PCR+assay+for+the+detection+of+highly+variable+rabies+virus+and+other+lyssaviruses%5BTitle%5D)+AND+%22PLoS+Negl+Trop+Dis%22%5BJournal%5D)">A Pan-Lyssavirus Taqman Real-Time RT-PCR assay for the detection of highly variable rabies virus and other lyssaviruses.</a> PLoS Negl Trop Dis. 11 (1), e0005258(2017).</li>
<li>Gigante, C. M., Wicker, V., Wilkins, K., Seiders, M., Zhao, H., Patel, P., Orciari, L., Condori, R. E., Dettinger, L., Yager, P., Xia, D., Li, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Optimization+of+pan-lyssavirus+LN34+assay+for+streamlined+rabies+diagnostics+by+real-time+RT-PCR%5BTitle%5D)+AND+%22Journal+Virological+Methods%22%5BJournal%5D)">Optimization of pan-lyssavirus LN34 assay for streamlined rabies diagnostics by real-time RT-PCR.</a> Journal Virological Methods. , In press (2024).</li>
<li>Rao, A. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Use+of+a+modified+preexposure+prophylaxis+vaccination+schedule+to+prevent+human+rabies%3A+recommendations+of+the+advisory+committee+on+immunization+practices-United+States%2C+2022%5BTitle%5D)+AND+%22Morbidity+and+Mortality+Weekly+Report%22%5BJournal%5D)">Use of a modified preexposure prophylaxis vaccination schedule to prevent human rabies: recommendations of the advisory committee on immunization practices-United States, 2022.</a> Morbidity and Mortality Weekly Report. 71 (18), 619(2022).</li>
<li>Condori, R. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Using+the+LN34+Pan-Lyssavirus+Real-Time+RT-PCR+assay+for+rabies+diagnosis+and+rapid+genetic+typing+from+formalin-fixed+human+brain+tissue%5BTitle%5D)+AND+%22Viruses%22%5BJournal%5D)">Using the LN34 Pan-Lyssavirus Real-Time RT-PCR assay for rabies diagnosis and rapid genetic typing from formalin-fixed human brain tissue.</a> Viruses. 12 (1), 120(2020).</li>
</ol>

None to disclose

A successful LN34 assay run requires a positive control, extraction control, and no template control reactions perform as expected in each assay run or the run must be invalidated and repeated. All three LN34 positive control replicate reactions should cross the threshold within the specified range, or the run should be repeated. The positive control RNA described in previous publications7,8 will not amplify in the &#946;A assay. The no template control reactions should not exhibit amplification curves that cross the threshold line for either the LN34 or the &#946;A assay. The extraction control should not exhibit amplification for LN34. If unexpected amplification is observed in the NTC or extraction control, it may indicate contamination and invalidate the run and repeat testing for all samples (see Table 5). Users may consider adding additional controls, including a no-process control or no-sample extraction control, to monitor for host &#946;A contamination of extraction reagents.
As rabies fatality approaches 100%, it is recommended that any weak or abnormal amplification be investigated further, even if it does not produce a Ct value. Negative or NTC reactions should not exhibit any amplification, and fluorescence should appear as a flat line parallel to the ROX fluorescence in the multicomponent view. Observations of curves, especially in multiple replicates, may indicate cross-contamination or a weak positive result. All replicates for a positive sample should be amplified for a valid positive result. If only a subset of replicates amplifies in either assay, the sample should be retested. Furthermore, any sample producing highly variable results (Ct value differences &#62; &#177;1.5 between replicates) should be considered invalid, and the sample should be retested. If the issue persists, the sample should be re-extracted.
A rabies-positive sample extracted from properly collected and stored brain stem and cerebellum tissue is expected to have a Ct value of less than 35 cycles for the LN34 assay. All inconclusive samples must be retested by LN34 real-time RT-PCR. If the sample is inconclusive upon repeat testing and all controls performed as expected, re-extraction of RNA is recommended. Samples with low viral RNA (LN34 Ct &#62; 35) may indicate potential problems such as contamination, low virus load, PCR inhibition, or failed extraction. Collect fresh pieces of the brain from the original tissue, perform RNA extraction, and retest the sample. Likewise, Ct values &#62; 33 (singleplex), 37 (LN34M), or no amplification in the &#946;A assay may indicate failed RNA extraction. Repeat extraction for such samples, then repeat testing for both LN34 and actin. If a sample produces an inconclusive result again after repeated testing, use a secondary method such as the DFA (also called FAT) test, DRIT, or virus isolation. If continued discordant results or inconclusive results are observed, please consult with a rabies reference laboratory for confirmatory testing.
If inhibitors are present in an RNA extraction, PCR assays may produce a false negative result. If inhibition is suspected or inhibition of the &#946;A control reactions (such as Ct value &#62; 33 or Ct value &#62; 37) is noted for a particular sample, extracted RNA should be tested at 2 or more dilutions (e.g., 1:10 and 1:100 in nuclease-free water) to dilute out any potential PCR inhibitors. For difficult samples, RNA input can be increased to 8.5 &#181;L in the RT-PCR reaction by not adding any water. This may reveal increased inhibition (later Ct value compared to 2 &#181;L input RNA) or low RNA level in the original sample (earlier Ct value when using 8.5 &#181;L compared to 2 &#181;L input RNA).
The LN34 assay does not differentiate between lyssaviruses or determine rabies virus variants. The LN34 assay amplicon can be sequenced for low-resolution rabies virus variant typing or identification of lyssavirus species11.

This protocol describes the procedure for rabies diagnostic testing using the LN34 pan-lyssavirus real-time reverse transcription-polymerase chain reaction (RT-PCR) assay from sample collection through result interpretation. The procedure will be broken into three sections: brain sample collection as relevant to the LN34 assay (Section 1), manual column-based RNA extraction using the Direct-zol RNA Miniprep kit (Zymo Research R2051) (Section 2), and LN34 real-time RT-PCR assay set up using the AgPath-ID One-Step RT-PCR kit (ThermoFisher Scientific AM1005) (Section 3). RNA extraction and RT-PCR may be performed using other products, but kits should be validated prior to use to ensure that Lyssavirus RNA is extracted and amplified appropriately.
Section 1 describes the collection of the proper brain tissues to be used in the LN34 real-time RT-PCR assay. Description of animal necropsy, decapitation, and removal of brain are not included. Samples may contain infectious agents. Biosafety procedures detailed in the Biosafety in Microbiological and Biomedical Laboratories 6th Edition1 should be followed to mitigate risk. Samples should be considered infectious until completion of inactivation. Viral inactivation and assay validation should be performed in each laboratory according to that institution&#39;s standards. Laboratories should follow standard safety and quality procedures determined by their institution when implementing a new diagnostic test.
Based on what is known about the spread of rabies virus during infection, the brain stem and cerebellum are the best tissues for rabies diagnosis, and these tissues are recommended for rabies testing by the World Health Organization and the World Organization for Animal Health2,3,4,5. Because virus spread may be unilateral (Figure 1), especially in larger animals, a complete cross-section of the brain stem and three lobes of the cerebellum should be examined for rabies rule-out. For samples that do not meet these minimum criteria, the laboratory may reject the sample as insufficient for testing or opt to test for surveillance or rule-in purposes. If the required tissues are not received, but the laboratory opts to test the sample, a negative test result should be interpreted as inconclusive for rabies for that animal because viral RNA presence in other tissues can be delayed, low abundance, intermittent, or not existent. Collection of the required samples or additional testing is needed to rule out rabies in that case. However, identification of lyssavirus RNA in any tissue is diagnostic of rabies infection3,6. Examples of samples that may be tested for rabies virus RNA for rule-in or surveillance (but not rule out) rabies infection are cortex, hippocampus, spinal cord, degraded samples, skin, saliva, and cornea. A qualitative assessment of the condition of each sample should be made upon arrival in the laboratory. Refrigeration can preserve a sample for at least 72 h but should not be used long term. Repeated freeze-thaw cycles may reduce test sensitivity, and more than five freeze-thaw cycles should be avoided. If the condition of the tissue prevents the confident identification of brain structures, the sample should be identified as unsatisfactory. In the case of an unsatisfactory specimen, testing can still be performed to rule in (but not rule out) rabies. Positive test results are reported as such. Negative or inconclusive results on unsatisfactory tissue should be reported as inconclusive to prevent misinterpretation as a negative diagnosis.
This protocol was developed from published procedures7,8,9 and includes updated primers targeting the lyssavirus genome leader region and nucleoprotein coding sequence. The probe targets a short, highly conserved sequence and uses locked nucleotides to allow for broad detection. The assay detects RNA from diverse lyssaviruses at varying concentrations8. This protocol demonstrates the laboratory procedures to perform the LN34 real-time PCR assay, but accurate and sensitive detection of lyssavirus RNA is dependent on other elements that are not extensively covered in this protocol, such as specimen storage, record keeping, personnel training/competency, result tracking, result interpretation, quality assurance, laboratory safety measures, and troubleshooting. PCR-based assays are prone to cross-contamination due to their high sensitivity. Cross-contamination can be avoided by adhering to good laboratory practices, such as frequently switching gloves, handling one sample at a time, disinfecting work surfaces with effective decontaminating agents between samples, and keeping tubes closed and samples separate from PCR reagents. PCR reagents and samples can be easily separated by employing a unilateral workflow and separating pre-amplification and post-amplification work areas. For instance, prepare PCR mastermixes in a location physically separate from where samples are handled. Change gloves often to avoid contamination of PCR reagents with samples, debris or positive control RNA. The PCR plate or tubes should be moved after mastermix addition to a second location where sample and control RNA can be added. Importantly, PCR products should not be manipulated in areas where samples or mastermixes are prepared.
There is no substitute for hands-on practice and experience when performing diagnostic tests. All new employees should be trained, and testing personnel should be evaluated for competency at least once per year following the requirements of the relevant laboratory director. Any observations of unusual results or assay failure should be noted, investigated, and corrected immediately. Each new lot of reagents should be validated using samples with known Ct values (such as a positive control or archived sample). All equipment should undergo routine maintenance, as suggested by the manufacturer, and assay performance should be verified after any maintenance or repair. Temperature levels should be monitored on applicable equipment to ensure refrigerators and freezers stay within the criteria set for an acceptable temperature range for reagents used in diagnostic testing.
Procedural modifications can affect assay performance and may lead to false positive, false negative, or uninterpretable results. The recommendations should be closely followed to ensure high assay sensitivity and specificity. A laboratory wishing to incorporate modifications to this protocol should validate and confirm the modified methods in consultation with the CDC.

<table><tbody><tr><td>7500 Fast</td><td>Applied Biosystems</td><td>N/A</td><td>Do not substitute without validation</td></tr><tr><td>7500 Fast Dx&amp;nbsp;</td><td>Applied Biosystems</td><td>N/A</td><td>Do not substitute without validation</td></tr><tr><td>ABI ViiA 7</td><td>Applied Biosystems</td><td>N/A</td><td>Do not substitute without validation</td></tr><tr><td>AgPath-ID One-Step RT-PCR Kit&amp;nbsp;</td><td>ThermoFisher Scientific&amp;nbsp;</td><td>AM1005</td><td>Do not substitute without validation</td></tr><tr><td>Beadbug6</td><td>Benchmark Scientific</td><td>D1036</td><td></td></tr><tr><td>Direct-zol RNA MiniPrep kit&amp;nbsp;</td><td>Zymo Research</td><td>R2052</td><td></td></tr><tr><td>MagNA Lyser green beads&amp;nbsp;</td><td>Roche</td><td>3358941001</td><td></td></tr><tr><td>Microcentrifuge</td><td>Eppendorf&amp;nbsp;</td><td>5425 R</td><td></td></tr><tr><td>Optical 96-well Reaction Plates</td><td>ThermoFisher Scientific&amp;nbsp;</td><td>4346907</td><td></td></tr><tr><td>Optical Adhesive covers</td><td>ThermoFisher Scientific&amp;nbsp;</td><td>4311971</td><td>Alternative: caps</td></tr><tr><td>Polyester fiber-tipped applicator swabs&amp;nbsp;</td><td>BD BBL Polyester Fiber Tipped Application Swab</td><td>220690</td><td></td></tr><tr><td>QuantStudio 6Flex</td><td>Applied Biosystems</td><td>4485691</td><td>Do not substitute without validation</td></tr><tr><td>Quaternary ammonium disinfectant (1:256)</td><td>LYSOL</td><td>WBB56939</td><td>Do not substitute without validation</td></tr><tr><td>RNase AWAY</td><td>ThermoFisher Scientific&amp;nbsp;</td><td>7002PK</td><td></td></tr><tr><td>RNaseZap</td><td>ThermoFisher Scientific&amp;nbsp;</td><td>AM9780</td><td></td></tr><tr><td>Single-use scalpel, a scalpel with a safety mechanism&amp;nbsp;</td><td>Integra Miltex&amp;nbsp;</td><td>4-510</td><td></td></tr><tr><td>Sterile polyproylene microcentrifuge tubes (1.5 mL), nuclease free</td><td>Sarstedt</td><td>72.692.405</td><td></td></tr><tr><td>Sterile polyproylene microcentrifuge tubes (2 mL), nuclease free</td><td>Sarstedt</td><td>72.694.600</td><td></td></tr><tr><td>TRIzol Reagent</td><td>ThermoFisher Scientific&amp;nbsp;</td><td>15596026</td><td>Do not substitute without validation</td></tr></tbody></table>

postmortem diagnosis of rabies in animals by the updated, multiplexed ln34 real-time reverse transcription-polymerase chain reaction assay

Postmortem Diagnosis of Rabies in Animals by the Updated, Multiplexed LN34 Real-Time Reverse Transcription-Polymerase Chain Reaction Assay

Rabies is a fatal zoonotic disease caused by Lyssavirus rabies (RABV) and related negative strand RNA viruses from the Lyssavirus genus (family Rhabdoviridae). The LN34 assay targets the highly conserved leader region and nucleoprotein gene of the lyssavirus genome and utilizes degenerate primers and a TaqMan probe containing locked nucleotides to detect RNA across the diverse Lyssavirus genus. A negative finding for rabies should be made only if a full cross-section of the brain stem and three lobes of the cerebellum are examined; however, identification of lyssavirus RNA in any tissue is diagnostic of rabies infection. Tissue is collected and homogenized in TRIzol reagent, which also inactivates the virus. RNA extraction is performed using a spin column-based commercial extraction kit. Master mixes are prepared in a clean space and aliquoted into a 96 well plate before adding sample RNA. In clinical settings, each sample is tested by real-time RT-PCR for the presence of lyssavirus RNA in triplicate and singly for host &#946; -actin mRNA. Positive and negative controls are included at extraction and real-time RT-PCR steps of the protocol. Data analysis involves manual adjustment of the thresholds to standardize Ct values across instrument runs. Positive results are determined by the presence of typical amplification in the pan-lyssavirus assay (Ct &#8804; 35). Negative results are determined by the absence of typical amplification in the pan-lyssavirus assay and detection of host &#946;-actin mRNA (Ct &#8804; 33). Observation of values outside of these ranges or failure of the assay controls can invalidate the run or result in inconclusive results for a specimen. The protocol should be closely followed to ensure high assay sensitivity and specificity. Procedural modifications can affect assay performance and lead to false positive, false negative, or uninterpretable results.

Representative images from a successful LN34 assay run on an ABI ViiA7 real-time PCR instrument are shown in Figure 2. Viewing results plotted on a logarithmic scale allows for easy viewing of the Ct value, the point at which the curve crosses the threshold line (Figure 2A,C). When plotted on a linear scale, successful amplification will appear as a sigmoidal (or "S"-shaped) curve (Figure 2B,D), while negative results should appear as a straight, flat line. Viewing results in both linear and log scale views is recommended to identify possible anomalies or errors. Typical positive and negative results in the multicomponent plot view can be seen in Figure 2E,F, respectively, where the fluorescence level of the dye labeling the probe (FAM for LN34, VIC/HEX for βA) can be observed relative to the passive dye in the reaction buffer (ROX).
Examples of abnormal results are shown in Figure 3. Comparisons between the graphs of successful runs (Figure 2) and abnormal graphs (Figure 3) can be used to isolate atypical runs and instrument issues. Figure 3A shows a signal crossing the threshold, producing a Ct value for LN34, but the amplification curve is very atypical, increasing linearly. The multicomponent (Figure 3B) plot also shows a wavy line that is not typical of a positive sample. This example highlights the importance of viewing the amplification plots and not simply copying Ct values. Always ensure the amplification curves look normal for all samples. Viewing the multicomponent plot is also advised to ensure that no irregularities are present. On occasion, messy baseline signals can generate Ct values in cases where no amplification has occurred. If amplification signals appear linear, it is suggested that the baseline be adjusted to see if the curve disappears. In the case of any unusual signal, the entire run should be repeated. Cleaning and running a background plate on your real-time PCR instrument is recommended if issues persist. If available, PCR products can be run on an agarose gel and/or sequenced to troubleshoot any unusual results. It is not recommended to use the results of gel electrophoresis or sequencing to determine diagnostic results.
Previous studies have shown low variability between replicates, assay run, operator, and laboratory for the LN34 assay7. If high variability (&gt;±1.5 Ct difference) between replicates of the same sample is observed, that RNA should be retested. High variability can be caused by issues with pipettes, laboratory practices, mis-pipetting, or real-time PCR machines. Repeated observation of high variability across several samples or across assay runs may indicate systemic issues. Samples with low RNA, approaching the assay threshold for a positive sample (Ct 35), may exhibit higher variability in Ct values between replicates. Consultation with CDC and troubleshooting may be necessary to address the cause of the persistent variability, inconsistent results, or assay failure.
The high sensitivity of PCR-based assays makes them inherently susceptible to contamination. Strict adherence to good laboratory practices is the best way to mitigate cross-contamination. Knowing how to identify potential contamination is important. Reagent contamination should be suspected if no template control and suspect negative sample wells in an assay run all produce similar Ct values. Repeat testing with new aliquots of PCR reagents (buffer, water, primers, and enzyme) and the same RNA. If all samples and extraction control produce similar CT values but NTC is negative, contamination of extraction reagents should be investigated, and extraction should be repeated using new reagents. It is good practice to make small aliquots of reagents in order to reduce the risk of contamination and avoid the possibility of discarding large volumes of expensive reagents. Sample cross-contamination is more difficult to identify. If sample contamination is suspected, repeat sample collection starting from the original tissues. In some cases, sequencing of the viral RNA can confirm contamination, especially when the contaminating RNA is very different from the expected viral variant (such as a control virus used in the laboratory). Sequencing of two samples processed at the same time can determine if the viral sequences are identical but may be uninformative if the sequences are expected to be very similar (for example, the same variant collected in the same county). If sample contamination with the positive control RNA is suspected, one can run the LN34 assay amplicons on an agarose gel to differentiate lyssavirus RNA (165 bp) from positive control RNA (99 bp). The sequence of the template used to generate the positive control RNA provided by CDC8. 
For other pathogens, laboratorians may be used to set the threshold manually to get rid of "noise" such as the weak amplification shown in cyan in Figure 4. This practice is NOT recommended for rabies diagnosis because it can lead to false negative results with dire consequences since rabies is almost 100% fatal. Do NOT manually change the threshold to produce negative results for weak or late amplification samples. These samples must be re-extracted and/or retested to rule out rabies.
<img alt="Microscope image of cellular structure; fluorescence microscopy; optical analysis; cellular study." class="xfigimg" src="/files/ftp_upload/66761/66761fig01.jpg" data-altupdatedat="1783396841000" data-alt="Figure 1"> 
Figure 1: Field of view showing unilateral spread of rabies virus antigen in an infected donkey by direct fluorescent antibody test. <a href="https://www.jove.com/files/ftp_upload/66761/66761fig01large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Real-time PCR amplification, multicomponent plots; gene expression analysis; cyclic amplification." class="xfigimg" src="/files/ftp_upload/66761/66761fig02.jpg" data-altupdatedat="1783396841000" data-alt="Figure 2"> 
Figure 2: Amplification and multicomponent plots from a successful LN34 assay run. (A-D) Result data are plotted on a (A,C) log scale and (B,D) linear scale for the LN34 and βA assay. Panels A and B depict LN34 results from two samples (in pink and cyan) compared to the positive control (in yellow). In panel B, there is a flat green line that depicts an additional negative sample in the run. In A, the green line(s) do not show any amplification and are depicted as broken segments. The threshold for the LN34 assay was set manually to 0.2 and is shown by the red horizontal line. (C,D) Results from the βA assay for two samples (red and cyan). The threshold for the βA assay was manually set at 0.05. (E,F) Multicomponent plots depict the fluorescence (RFU) at each cycle for FAM (LN34), VIC (βA), and ROX (passive dye present in AgPath-ID buffer). ROX levels should stay flat across all cycles. A typical positive sample is shown in panel E; FAM fluorescence increases as a sigmoidal curve starting at cycle 18 for this sample. A typical negative sample is shown in panel F, where the FAM level stays parallel to the ROX level across all cycles. Data are from an ABI ViiA7 real-time PCR instrument. <a href="https://www.jove.com/files/ftp_upload/66761/66761fig02large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="PCR amplification and multicomponent plots; ΔRn vs. Cycle; Fluorescence vs. Cycle; FAM, ROX indicators." class="xfigimg" src="/files/ftp_upload/66761/66761fig03.jpg" data-altupdatedat="1783396841000" data-alt="Figure 3"> 
Figure 3: Representative images of the rare, atypical signal observed in LN34 assay runs on a ViiA7 real-time PCR instrument. (A-F) Amplification (A,C,E) and multicomponent (B,D,F) plots produced due to well contamination. The linear increase (A,C) and wavy fluctuations (B,D) in FAM fluorescence do not represent true amplification based on the shape of the curves and the magnitude of the fluorescence change. Panels A through D likely represent negative samples even though a Ct value was produced for the replicate shown in panels A and B. Panels E and F show an odd wavy signal that is more easily seen in the multicomponent plot. This type of signal should be investigated and may indicate instrument issues, even though all controls performed as expected in this run. <a href="https://www.jove.com/files/ftp_upload/66761/66761fig03large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="qPCR amplification plot, ΔRn vs. cycle number, dual sample comparison, fluorescence detection." class="xfigimg" src="/files/ftp_upload/66761/66761fig04.jpg" data-altupdatedat="1783396841000" data-alt="Figure 4"> 
Figure 4: LN34 real-time RT-PCR curves from 2 rabies suspect samples showing two methods of setting threshold values. (A) LN34 threshold was set to 0.2 (recommended for all runs). (B) Manually determining a different threshold for each run to mask signal determined to be "noise" (late amplification signal). The method used in panel B is NOT recommended for rabies due to the severe consequences of missing a true positive result. Late amplification could indicate a weak positive sample, PCR inhibition, or failed extraction in a positive case. It could also indicate cross-contamination. The golden sample (indicated by black arrows) produces a Ct value at the assay's cutoff and should not be considered negative. Samples with late amplification should be re-extracted and retested. <a href="https://www.jove.com/files/ftp_upload/66761/66761fig04large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
Table 1: Primer and probe sequences and concentrations used in the LN34lys (singleplex LN34), LN34M (LN34 and βA multiplexed) real-time RT-PCR assays. LN34 probes are labeled with the fluorescent FAM dye at the 5ʹend and Black Hole quencher (BHQ1) at the 3ʹend. The βA probe is labeled with the fluorescent HEX dye at the 5ʹend and Black Hole quencher (BHQ1) at the 3ʹend. Locked nucleotide-modified bases are indicated by a plus preceding the base in the sequence. <a href="https://www.jove.com/files/ftp_upload/66761/Table%201.xlsx" target="_blank">Please click here to download this Table.</a>
Table 2: Assay set up for LN34lys, Actin3, and LN34M assays. Primer and probe names, sequences, and concentrations can be found in Table 1. LN34_F1 corresponds to ACGCTTAACAACCAGATCAAAGAA7. <a href="https://www.jove.com/files/ftp_upload/66761/Table%202.xlsx" target="_blank">Please click here to download this Table.</a>
Table 3: Cycling parameters for ABI instruments. IMPORTANT: Make sure to run in STANDARD mode, not FAST mode. ROX should be selected as the passive reference dye. <a href="https://www.jove.com/files/ftp_upload/66761/Table%203.xlsx" target="_blank">Please click here to download this Table.</a>
Table 4: Algorithm for interpretation of LN34 real-time RT-PCR results for singleplex (top, blue table) and multiplex (bottom, red table) formats. A positive LN34 result should be considered positive, even if the βA result is negative or inconclusive. If LN34 amplicon is not detected, the βA Ct must be ≤ the Ct value cutoff listed to be considered negative. βA Ct values indicate the quality of the sample being tested and identify possible inhibition. Low concentration in the original clinical specimen may impact βA growth curves, leading to no discernable amplification. Additional contributing factors in the failure to detect β-actin include poor extraction of RNA due to loss of RNA or carryover of PCR inhibitors, incorrect assay setup and technique, unsatisfactory sample type or quality, and malfunction of reagents or equipment. <a href="https://www.jove.com/files/ftp_upload/66761/Table%204.xlsx" target="_blank">Please click here to download this Table.</a>
Table 5: Actions and interpretations of common results for LN34 assay controls. All three controls (rabies positive control RNA, rabies negative extraction control, and no template control must produce expected results for a run to pass. Failure in the positive control or no template control may indicate mispipetting, reagent, or equipment failure. The entire run, including all RNA samples tested must be repeated. Failure of the extraction control may indicate a problem during extraction, such as reagent failure, mispipetting, or cross-contamination. Extraction of all samples must be repeated. Failure of controls should be rare for experienced laboratory personnel. <a href="https://www.jove.com/files/ftp_upload/66761/Table%205.xlsx" target="_blank">Please click here to download this Table.</a>

This protocol demonstrates the pan-lyssavirus LN34 real-time reverse transcription-polymerase chain reaction (RT-PCR) assay from tissue collection to result interpretation, including updates to primer sequences and formulations to improve assay performance for some non-rabies lyssaviruses and lagomorphs. We also demonstrate the assay setup for a single-well LN34 multiplexed (LN34M) format.

Rabies is a fatal zoonotic disease caused by Lyssavirus rabies (RABV) and related negative strand RNA viruses from the Lyssavirus genus (family ...

Rabies is a hundred percent fatal and rapid, accurate diagnosis is required to get life-saving treatment to those who need it most. Reliable laboratory testing is really crucial for rabies control. The CDC has developed a step-by-step protocol for rabies testing by quantitative reverse transcriptase PCR or RT-PCR, using a validated real-time Alisa virus test called LN34, enabling laboratories to improve diagnostic accuracy and support rabies prevention efforts.For decades, rabies testing relied on the direct fluorescence antibody tests called DFA or FAT. However, many international laboratories also use RT-PCR for rabies testing due to its excellent sensitivity and accuracy. The DFA test for rabies require specialized microscopes, cold chain storage, specialized training of staff and reagents have experienced shortages over recent years, PCR and RT-PCR are now widely used for pathogen testing.Many laboratories already have PCR and RT-PCR equipment and expertise and the needed reagents are available from commercial vendors. Cost is a major barrier to rabies testing in areas that have the most human rabies cases. CDC developed a multiplex form of the LN34 assay, which improves quality controls and lowers cost per sample tested.RT-PCR is increasingly being implemented for rabies diagnostics because it's widely used for testing other pathogens and the results are easy to interpret. But using a validated test is extremely important, and making sure the test is performing as expected is equally critical. Our step-by-step protocol includes quality controls, safety considerations, and PCR best practices to help labs get started.To begin, wear personal protective equipment including safety glasses, a closed front gown and two pairs of gloves. Clean and disinfect the work surface with quaternary ammonium compound, or another suitable disinfectant for inactivating the rabies virus. Lay out a plastic lined absorbent pad on the work surface, using a clean single use scalpel collect tissue representing a full cross-section of the brainstem and cerebellum.For homogenization and RNA extraction finally, mince the required tissues using a single use scalpel. Smear the mince tissue with a swab and transfer the swab to a tube prefilled with homogenization buffer and beads. After discarding the outer glove using QAC disinfectant diluted 1:256, clean and disinfect the workstation, equipment, and outside of the sample tubes.Homogenize samples with a mini bead beater for 60 seconds. And visually inspect the tubes. Allow the samples to sit for five minutes at room temperature.Finally clean and disinfect the workstation, equipment, and outside of sample tubes with QAC disinfectant before proceeding to RNA extraction. To begin, perform surface decontamination of the biological safety cabinet using QAC diluted to 1:256. Perform additional cleaning to remove dust or other environmental contaminants.Lay out a plastic lined absorbent work pad on the working platform. Then, arrange the reagents and the samples in the biosafety cabinet. Lay out all collection tubes in a clean rack for micro centrifuge tubes.Pre-fill one 1.5 milliliter micro centrifuge tube with 300 microliters of 100%ethanol for each brain sample. Centrifuge the homogenized sheet brain samples at 10, 000 to 16, 000 G for two minutes in a tabletop micro centrifuge. Transfer the clear pink supernatant into a new sterile tube containing 100%ethanol, pipette up and down to mix and transfer 600 microliters of the ethanol supernatant mixture to a spin column in a collection tube.Centrifuge for one minute until the liquid passes through the column, discard the flow through and transfer each column to a new collection tube. Add 400 microliters of RNA pre-wash buffer to each column. Centrifuge the mixture at 10, 000 to 16, 000 G for 30 seconds and discard the flow through.Return each column to the same collection tube and repeat the pre-wash step a second time. Next, add 700 microliters of RNA wash buffer to each column. Centrifuge at 10, 000 to 16, 000 G for two minutes.And carefully transfer the into an RNase-free tube. Discard the flow through and the collection tube, then remove and discard outer gloves. Now add 50 microliters of DNase and RNase free water directly to the column matrix and incubate for 30 seconds.Then centrifuge at 10, 000 to 16, 000 G for one minute. Carefully transfer RNA to a new screw top flat bottom accession labeled micro centrifuge tube for RT-PCR assay. To begin, thaw one step RT-PCR buffer, no template control, nuclease free water, primers, and probes on ice, in the master mix preparation space.Place one step RT-PCR enzyme on ice. Calculate the volume of each reagent for the LN34 multiplexed and beta A Master Mixes. Designate wells for each sample in triplicate for the LN34 multiplexed assay using a 96 well plate map.After vortexing and spinning, dispense 23 microliters of LN34 multiplex Master Mix into each LN34 assigned well. To set up negative template control reactions, add two microliters of PCR grade water into each negative template control well. Place the 96 well plate on ice.Clean the workstation with 70%ethanol. Now at the template edition workspace, thaw RNA samples and positive control single use aliquot of artificial RNA on ice. After vortexing, briefly centrifuge tubes containing RNA samples, pipette two microliters of sample or positive control RNA into the corresponding well.After adding all samples, place the optical adhesive cover over the wells to seal them completely. Centrifuge the plate at 500 G for one minute at room temperature, place the sealed plate into a real time or quantitative PCR instrument calibrated for fam and VIC Hex reporter dies. Set the instrument to the appropriate cycling parameters.After the run is completed set the threshold values to 0.2 for LN34 and 0.05 for beta actin. Check the control sample curves for any quality issues. The LN34 assay showed successful amplification curves with positive results crossing the threshold at distinct cycle threshold values when viewed on a logarithmic scale.And sigmoid amplification curves on a linear scale for both LN34 and beta actin. Negative results exhibited flat lines without amplification. Abnormal amplification curves were identified with some displaying linear rather than sigmoidal increases in fluorescence, indicating atypical results.The corresponding multi-component plots showed irregular wavy fluorescent signals rather than expected smooth curves. Highlighting the need to analyze amplification plots instead of relying solely on cycle threshold values.

postmortem-diagnosis-rabies-animals-updated-multiplexed-ln34-real

Research

JoVE Journal

Biology

The direct rapid immunohistochemical test (DRIT) offers a World Organization for Animal Health and World Health Organization (OIE/WHO) recognized alternative to the direct fluorescent antibody (DFA) test for rabies diagnosis. This test allows for field-based applications that can be performed in approximately 1 h upon brain impressions using light microscopy.

Enhanced Rabies Surveillance Using a Direct Rapid Immunohistochemical Test

A pan-lyssavirus nested reverse transcription polymerase chain reaction has been developed to detect specifically all known lyssaviruses. Validation using rabies brain samples of different animal species showed that this method has a sensitivity and specificity equivalent to the gold standard fluorescent antibody test and could be used for routine rabies diagnosis.

Evaluation of a Universal Nested Reverse Transcription Polymerase Chain Reaction for the Detection of Lyssaviruses

The goal of this protocol is to demonstrate safe necropsy techniques in small and large animals to obtain satisfactory tissue samples for rabies testing.

Rabies Necropsy Techniques in Large and Small Animals

This real-time RT-PCR using dsDNA intercalating dye is suitable to diagnose lyssavirus infections. The method begins with RNA extracted from rabies suspected ante-mortem or post-mortem samples, detailing master mix preparation, RNA addition, setup of the real-time machine and correct interpretation of results.

Pan-lyssavirus Real Time RT-PCR for Rabies Diagnosis

We present a complete protocol for postmortem diagnosis of animal rabies under field conditions using a rapid immunochromatographic diagnostic test (RIDT), from brain biopsy sampling to final interpretation. We also describe further applications using the device for molecular analysis and viral genotyping.

Field Postmortem Rabies Rapid Immunochromatographic Diagnostic Test for Resource-Limited Settings with Further Molecular Applications

Here, we present an immunohistochemistry test protocol for the detection of rabies virus antigen as an alternative diagnostic test for formalin-fixed tissues.

Immunohistochemistry Test for the Lyssavirus Antigen Detection from Formalin-Fixed Tissues

This protocol presents a qRT-PCR-based approach for determining the rabies virus nucleoprotein (N) gene copy number within various bovine brain anatomical structures using in vitro transcription.

Quantitation of Rabies Virus in Various Bovine Brain Structures

The Solaris qPCR Gene Expression Assays are novel pre-designed qPCR primer/probe combinations designed to simplify the qPCR process without sacrificing the specificity and robustness of the assay.

Quantitative Real-Time PCR using the Thermo Scientific Solaris qPCR Assay

Quantitative real-time PCR (qRT-PCR) is an effective tool to diagnose mRNA levels in different insect tissues and developmental stages. In this report we show the use of qRT-PCR to ascertain mRNA levels in different larval tissues and developmental stages of the invasive insect species, emerald ash borer.

Analysis of Gene Expression in Emerald Ash Borer (Agrilus planipennis) Using Quantitative Real Time-PCR

PCR has emerged as a common technique in many molecular biology laboratories.  Provided here is a quick guide to several conventional PCR protocols.   Because each reaction is a unique experiment, optimal conditions required to generate a product vary.  Understanding the variables in a reaction will greatly enhance troubleshooting efficiency, thereby increasing the chance to obtain the desired result.

Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies

Learn the updated LN34 multiplex RT-PCR assay for postmortem rabies diagnosis in animals. This protocol covers tissue collection, RNA extraction, and result interpretation with quality controls.

Postmortem Diagnosis of Rabies in Animals by the Updated, Multiplexed LN34 Real-Time Reverse Transcription-Polymerase Chain Reaction Assay (Video) | JoVE Journal

Postmortem Diagnosis of Rabies in Animals by the Updated, Multiplexed LN34 Real-Time Reverse Transcription-Polymerase Chain Reaction Assay

Explore More Videos