Name: Electroporation-Based CRISPR-Cas9-Mediated Gene Knockout in THP-1 Cells and Single-Cell Clone Isolation (Video) | JoVE Journal
Uploaded: 2025-02-28T12:30:00.000+00:00
Duration: 9 min 29 s
Description: Learn CRISPR-Cas9 electroporation for gene knockout in THP-1 cells to study HIV resistance mechanisms. This protocol enables efficient genome editing and single-cell clone isolation for macrophage research.

ai_agent_IP

ai_agent

maintenance

instantTrialDurationMinutes

isBiopharma

enableNewMyJoveSectionDesign

educationFeatures

seoMetaApi

ai_copilot_institution_blacklist

ai_chat_institution_blacklist

freeAccessWindow

ssoRoleCapture

scheduledMaintenanceBanner

joveLabsFeatures

disable_autoplay_for_bots

extended_trial_duration

5 minutes

We are grateful to JP Concordet (MNHN, U1154/UMR7196, Paris), G. Bossis (IGMM, Montpellier), and D.&#160;Schl&#252;ter (Hannover Medical School, Germany) for sharing protocols and for discussion. This project has received funding from the European Union&#39;s Horizon 2020 research and innovation program (grant agreement No 101017572 to AZ) and ANRS (grant ECTZ162721 to AZ). The Infectious Disease Model and Innovative Therapies (IDMIT) research infrastructure is supported by the &#34;programme investissement d&#39;avenir (PIA)&#34; under reference ANR_11_INSB_0008.

<ol><li>Tsuchiya, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Establishment+and+characterization+of+a+human+acute+monocytic+leukemia+cell+line+%28THP-1%29%5BTitle%5D)+AND+%22Int+J+Cancer%22%5BJournal%5D)">Establishment and characterization of a human acute monocytic leukemia cell line (THP-1).</a> Int J Cancer. 26 (2), 171-176 (1980).</li>
<li>Danis, V. A., Millington, M., Hyland, V. J., Grennan, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Cytokine+production+by+normal+human+monocytes%3A+inter-subject+variation+and+relationship+to+an+IL-1+receptor+antagonist+%28IL-lRa%29+gene+polymorphism%5BTitle%5D)+AND+%22Clin+Exp+Immunol%22%5BJournal%5D)">Cytokine production by normal human monocytes: inter-subject variation and relationship to an IL-1 receptor antagonist (IL-lRa) gene polymorphism.</a> Clin Exp Immunol. 99, https://academic.oup.com/cei/article/99/2/303/6484286 (1995).</li>
<li>Bol, S. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Donor+variation+in+in+vitro+HIV-1+susceptibility+of+monocyte-derived+macrophages%5BTitle%5D)+AND+%22Virology%22%5BJournal%5D)">Donor variation in in vitro HIV-1 susceptibility of monocyte-derived macrophages.</a> Virology. 390 (2), 205-211 (2009).</li>
<li>Appleby, L. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Sources+of+heterogeneity+in+human+monocyte+subsets%5BTitle%5D)+AND+%22Immunol+Lett%22%5BJournal%5D)">Sources of heterogeneity in human monocyte subsets.</a> Immunol Lett. 152 (1), 32-41 (2013).</li>
<li>O'Neill, M. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Single-cell+and+bulk+RNA-sequencing+reveal+differences+in+monocyte+susceptibility+to+Influenza+A+virus+infection+between+Africans+and+Europeans%5BTitle%5D)+AND+%22Front+Immunol%22%5BJournal%5D)">Single-cell and bulk RNA-sequencing reveal differences in monocyte susceptibility to Influenza A virus infection between Africans and Europeans.</a> Front Immunol. 12, 768189(2021).</li>
<li>Wen, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Comparability+study+of+monocyte-derived+dendritic+cells%2C+primary+monocytes%2C+and+THP1+cells+for+innate+immune+responses%5BTitle%5D)+AND+%22J+Immunol+Methods%22%5BJournal%5D)">Comparability study of monocyte-derived dendritic cells, primary monocytes, and THP1 cells for innate immune responses.</a> J Immunol Methods. 498, 113147(2021).</li>
<li>Inagaki, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Interferon-g-induced+apoptosis+and+activation+of+THP-1+macrophages%5BTitle%5D)+AND+%22Life+Sci%22%5BJournal%5D)">Interferon-g-induced apoptosis and activation of THP-1 macrophages.</a> Life Sci. 71 (21), 2499-2508 (2002).</li>
<li>Boonkaewwan, C., Toskulkao, C., Vongsakul, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Anti-inflammatory+and+immunomodulatory+activities+of+stevioside+and+its+metabolite+steviol+on+THP-1+cells%5BTitle%5D)+AND+%22J+Agric+Food+Chem%22%5BJournal%5D)">Anti-inflammatory and immunomodulatory activities of stevioside and its metabolite steviol on THP-1 cells.</a> J Agric Food Chem. 54 (3), 785-789 (2006).</li>
<li>Chanput, W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((%CE%B2-Glucans+are+involved+in+immune-modulation+of+THP-1+macrophages%5BTitle%5D)+AND+%22Mol+Nutr+Food+Res%22%5BJournal%5D)">β-Glucans are involved in immune-modulation of THP-1 macrophages.</a> Mol Nutr Food Res. 56 (5), 822-833 (2012).</li>
<li>Cui, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((USP3+inhibits+type+I+interferon+signaling+by+deubiquitinating+RIG-I-like+receptors%5BTitle%5D)+AND+%22Cell+Res%22%5BJournal%5D)">USP3 inhibits type I interferon signaling by deubiquitinating RIG-I-like receptors.</a> Cell Res. 24 (4), 400-416 (2014).</li>
<li>Chen, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((SAMHD1+suppresses+innate+immune+responses+to+viral+infections+and+inflammatory+stimuli+by+inhibiting+the+NF-%CE%BAB+and+interferon+pathways%5BTitle%5D)+AND+%22Proc+Natl+Acad+Sci+USA%22%5BJournal%5D)">SAMHD1 suppresses innate immune responses to viral infections and inflammatory stimuli by inhibiting the NF-κB and interferon pathways.</a> Proc Natl Acad Sci USA. 115 (16), E3798-E3807 (2018).</li>
<li>Pradhananga, S., Spalinskas, R., Poujade, F. A., Eriksson, P., Sahlén, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Promoter+anchored+interaction+landscape+of+THP-1+macrophages+captures+early+immune+response+processes%5BTitle%5D)+AND+%22Cell+Immunol%22%5BJournal%5D)">Promoter anchored interaction landscape of THP-1 macrophages captures early immune response processes.</a> Cell Immunol. 355, 104148(2020).</li>
<li>Mezzasoma, L., Talesa, V. N., Romani, R., Bellezza, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Anp+and+BNP+exert+anti-inflammatory+action+via+npr-1%2Fcgmp+axis+by+interfering+with+canonical%2C+non-canonical%2C+and+alternative+routes+of+inflammasome+activation+in+human+THP1+cells%5BTitle%5D)+AND+%22Int+J+Mol+Sci%22%5BJournal%5D)">Anp and BNP exert anti-inflammatory action via npr-1/cgmp axis by interfering with canonical, non-canonical, and alternative routes of inflammasome activation in human THP1 cells.</a> Int J Mol Sci. 22 (1), 1-17 (2021).</li>
<li>Martinat, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((SUMOylation+of+SAMHD1+at+Lysine+595+is+required+for+HIV-1+restriction+in+non-cycling+cells%5BTitle%5D)+AND+%22Nat+Commun%22%5BJournal%5D)">SUMOylation of SAMHD1 at Lysine 595 is required for HIV-1 restriction in non-cycling cells.</a> Nat Commun. 12 (1), 4582(2021).</li>
<li>Rensen, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Clustering+and+reverse+transcription+of+HIV-1+genomes+in+nuclear+niches+of+macrophages%5BTitle%5D)+AND+%22EMBO+J%22%5BJournal%5D)">Clustering and reverse transcription of HIV-1 genomes in nuclear niches of macrophages.</a> EMBO J. 40 (1), e105247(2021).</li>
<li>Ikeda, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((APOBEC3+degradation+is+the+primary+function+of+HIV-1+Vif+determining+virion+infectivity+in+the+myeloid+cell+line+THP-1%5BTitle%5D)+AND+%22mBio%22%5BJournal%5D)">APOBEC3 degradation is the primary function of HIV-1 Vif determining virion infectivity in the myeloid cell line THP-1.</a> mBio. 14 (4), e0078223(2023).</li>
<li>Jinek, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+programmable+dual+RNA-guided+DNA+endonuclease+in+adaptive+bacterial+immunity%5BTitle%5D)+AND+%22Science%22%5BJournal%5D)">A programmable dual RNA-guided DNA endonuclease in adaptive bacterial immunity.</a> Science. 337, 816-821 (2012).</li>
<li>Kurosaki, T., Maquat, L. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Nonsense-mediated+mRNA+decay+in+humans+at+a+glance%5BTitle%5D)+AND+%22J+Cell+Sci%22%5BJournal%5D)">Nonsense-mediated mRNA decay in humans at a glance.</a> J Cell Sci. 129 (3), 461-467 (2016).</li>
<li>Tuladhar, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((CRISPR-Cas9-based+mutagenesis+frequently+provokes+on-target+mRNA+misregulation%5BTitle%5D)+AND+%22Nat+Commun%22%5BJournal%5D)">CRISPR-Cas9-based mutagenesis frequently provokes on-target mRNA misregulation.</a> Nat Commun. 10 (1), 4056(2019).</li>
<li>Embree, C. M., Abu-Alhasan, R., Singh, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Features+and+factors+that+dictate+if+terminating+ribosomes+cause+or+counteract+nonsense-mediated+mRNA+decay%5BTitle%5D)+AND+%22J+Biol+Chem%22%5BJournal%5D)">Features and factors that dictate if terminating ribosomes cause or counteract nonsense-mediated mRNA decay.</a> J Biol Chem. 298 (11), 102592(2022).</li>
<li>Xue, C., Greene, E. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((DNA+repair+pathway+choices+in+CRISPR-Cas9-mediated+genome+editing%5BTitle%5D)+AND+%22Trends+Genet%22%5BJournal%5D)">DNA repair pathway choices in CRISPR-Cas9-mediated genome editing.</a> Trends Genet. 37 (7), 639-656 (2021).</li>
<li>Schnoor, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Efficient+non-viral+transfection+of+THP-1+cells%5BTitle%5D)+AND+%22J+Immunol+Methods%22%5BJournal%5D)">Efficient non-viral transfection of THP-1 cells.</a> J Immunol Methods. 344 (2), 109-115 (2009).</li>
<li>Tang, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+method+for+high+transfection+efficiency+in+THP-1+suspension+cells+without+PMA+treatment%5BTitle%5D)+AND+%22Anal+Biochem%22%5BJournal%5D)">A method for high transfection efficiency in THP-1 suspension cells without PMA treatment.</a> Anal Biochem. 544, 93-97 (2018).</li>
<li>Ji, W., Zhang, L., Liu, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Protocol+using+lentivirus+to+establish+THP-1+suspension+cell+lines+for+immunostaining+and+confocal+microscopy%5BTitle%5D)+AND+%22STAR+Protoc%22%5BJournal%5D)">Protocol using lentivirus to establish THP-1 suspension cell lines for immunostaining and confocal microscopy.</a> STAR Protoc. 4 (1), 102032(2023).</li>
<li>Guo, C., Ma, X., Gao, F., Guo, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Off-target+effects+in+CRISPR%2FCas9+gene+editing%5BTitle%5D)+AND+%22Front+Bioeng+Biotechnol%22%5BJournal%5D)">Off-target effects in CRISPR/Cas9 gene editing.</a> Front Bioeng Biotechnol. 11, (2023).</li>
<li>Synthego Performance Analysis, ICE Analysis. 3.0, Synthego. 
 <a target="_blank" href="https://www.synthego.com/help/citing-ice">https://www.synthego.com/help/citing-ice</a> (2019).</li>
<li>Salamov, A. A., Nishikawa, T., Swindells, M. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Assessing+protein+coding+region+integrity+in+cDNA+sequencing+projects%5BTitle%5D)+AND+%22Bioinformatics%22%5BJournal%5D)">Assessing protein coding region integrity in cDNA sequencing projects.</a> Bioinformatics. 14, 384-390 (1998).</li>
<li>Pedersen, A. G., Nielsen, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Neural+network+prediction+of+translation+initiation+sites+in+eukaryotes%3A+Perspectives+for+EST+and+genome+analysis%5BTitle%5D)+AND+%22Proc+Int+Conf+Intell+Syst+Mol+Biol%22%5BJournal%5D)">Neural network prediction of translation initiation sites in eukaryotes: Perspectives for EST and genome analysis.</a> Proc Int Conf Intell Syst Mol Biol. 5, 226-233 (1997).</li>
<li>Concordet, J. P., Haeussler, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((CRISPOR%3A+Intuitive+guide+selection+for+CRISPR%2FCas9+genome+editing+experiments+and+screens%5BTitle%5D)+AND+%22Nucleic+Acids+Res%22%5BJournal%5D)">CRISPOR: Intuitive guide selection for CRISPR/Cas9 genome editing experiments and screens.</a> Nucleic Acids Res. 46 (W1), W242-W245 (2018).</li>
<li>Laguette, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((SAMHD1+is+the+dendritic-+and+myeloid-cell-specific+HIV-1+restriction+factor+counteracted+by+Vpx%5BTitle%5D)+AND+%22Nature%22%5BJournal%5D)">SAMHD1 is the dendritic- and myeloid-cell-specific HIV-1 restriction factor counteracted by Vpx.</a> Nature. 474 (7353), 654-657 (2011).</li>
<li>Hrecka, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Vpx+relieves+inhibition+of+HIV-1+infection+of+macrophages+mediated+by+the+SAMHD1+protein%5BTitle%5D)+AND+%22Nature%22%5BJournal%5D)">Vpx relieves inhibition of HIV-1 infection of macrophages mediated by the SAMHD1 protein.</a> Nature. 474 (7353), 658-661 (2011).</li>
<li>Seki, A., Rutz, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Optimized+RNP+transfection+for+highly+efficient+CRI+SPR%2FCas9-mediated+gene+knockout+in+primary+T+cells%5BTitle%5D)+AND+%22J+Exp+Med%22%5BJournal%5D)">Optimized RNP transfection for highly efficient CRI SPR/Cas9-mediated gene knockout in primary T cells.</a> J Exp Med. 215 (3), 985-997 (2018).</li>
<li>Batista Napotnik, T., Polajžer, T., Miklavčič, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Cell+death+due+to+electroporation+-+A+review%5BTitle%5D)+AND+%22Bioelectrochemistry%22%5BJournal%5D)">Cell death due to electroporation - A review.</a> Bioelectrochemistry. 141, 107871(2021).</li>
<li>Perretta-Tejedor, N., Freke, G., Seda, M., Long, D. A., Jenkins, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Generating+mutant+renal+cell+lines+using+CRISPR+technologies%5BTitle%5D)+AND+%22Methods+Mol+Biol%22%5BJournal%5D)">Generating mutant renal cell lines using CRISPR technologies.</a> Methods Mol Biol. 2067, 323-340 (2020).</li>
<li>Sentmanat, M. F., Peters, S. T., Florian, C. P., Connelly, J. P., Pruett-Miller, S. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+survey+of+validation+strategies+for+CRISPR-Cas9+editing%5BTitle%5D)+AND+%22Sci+Rep%22%5BJournal%5D)">A survey of validation strategies for CRISPR-Cas9 editing.</a> Sci Rep. 8 (1), 888(2018).</li>
<li>Makino, S., Fukumura, R., Gondo, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Illegitimate+translation+causes+unexpected+gene+expression+from+on-target+out-of-frame+alleles+created+by+CRISPR-Cas9%5BTitle%5D)+AND+%22Sci+Rep%22%5BJournal%5D)">Illegitimate translation causes unexpected gene expression from on-target out-of-frame alleles created by CRISPR-Cas9.</a> Sci Rep. 6, 39608(2016).</li>
<li>Bowling, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Downstream+alternate+start+site+allows+N-terminal+nonsense+variants+to+escape+NMD+and+results+in+functional+recovery+by+readthrough+and+modulator+combination%5BTitle%5D)+AND+%22J+Pers+Med%22%5BJournal%5D)">Downstream alternate start site allows N-terminal nonsense variants to escape NMD and results in functional recovery by readthrough and modulator combination.</a> J Pers Med. 12 (9), 1448(2022).</li>
<li>Inácios, Â, et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Nonsense+mutations+in+close+proximity+to+the+initiation+codon+fail+to+trigger+full+nonsense-mediated+mRNA+decay%5BTitle%5D)+AND+%22J+Biol+Chem%22%5BJournal%5D)">Nonsense mutations in close proximity to the initiation codon fail to trigger full nonsense-mediated mRNA decay.</a> J Biol Chem. 279 (31), 32170-32180 (2004).</li>
<li>Li, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Efficient+inversions+and+duplications+of+mammalian+regulatory+DNA+elements+and+gene+clusters+by+CRISPR%2FCas9%5BTitle%5D)+AND+%22J+Mol+Cell+Biol%22%5BJournal%5D)">Efficient inversions and duplications of mammalian regulatory DNA elements and gene clusters by CRISPR/Cas9.</a> J Mol Cell Biol. 7 (4), 284-298 (2015).</li>
<li>Guo, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((CRISPR+inversion+of+CTCF+sites+alters+genome+topology+and+enhancer%2Fpromoter+function%5BTitle%5D)+AND+%22Cell%22%5BJournal%5D)">CRISPR inversion of CTCF sites alters genome topology and enhancer/promoter function.</a> Cell. 162 (4), 900-910 (2015).</li>
</ol>

All authors have no conflicts of interest.

Here, a protocol is described to obtain a successful CRISPR-mediated editing of the THP-1 cell line. The approach relies on the transfer of pre-assembled sgRNA/Cas9 RNPs by electroporation/nucleofection. This strategy was chosen to limit the off-target effects that potentially arise upon lentiviral-mediated integration of the sgRNA/Cas9 cassette, yielding persistent expression of the nuclease. Multiple sgRNAs targeting the gene of interest were selected to achieve reliable and efficient editing, which increases the likel...

THP-1 is a human monocyte-derived cell line isolated from a patient suffering from acute leukemia (AML), which displays phenotypic features closely resembling those of primary monocytes1. As compared to primary monocyte-derived macrophages, which do not divide and display both limited lifespan and inter-/intra-donor variability in phenotype, THP-1 cells can be cultured virtually forever and have a more homogeneous behavior that favors results reproducibility2,3,4,5,6. Notably, THP-1 cells can be differentiated towards a macrophage-like phenotype with phorbol-12-myristate 13-acetate (PMA), making them a widely used in vitro model to investigate the responses of monocytes/macrophages to inflammatory signals7,8,9,10,11,12,13 or infection by clinically relevant human pathogens, including HIV14,15,16. The possibility to genetically engineer THP-1 cells is of interest across many biology-related research areas.
Clustered Regularly Interspaced Short Palindromic Repeats-CRISPR associated protein 9 (CRISPR-Cas9) is a prokaryotic adaptive immune system relaying on RNA-guided nuclease to degrade invading viral genomes, which has been reprogrammed as a genetic engineering tool17. The process of genome editing proceeds in three steps: recognition, cleavage, and repair. A single-guide RNA (sgRNA) recruits the Cas9 nuclease to a specific genomic locus through base pairing with its 20-bp guide sequence. The presence of a Protospacer Adjacent Motif (PAM) sequence directly 3&#39; of the 20-bp genomic target sequence triggers the Cas9-mediated unwinding and cleavage on both DNA strands between positions 17 and 18 (3-bp 5&#39; of the PAM). The resulting double-strand break (DSB) is processed by two major repair pathways. In the absence of a repair template bearing homology with the damaged locus, the error-prone Non-Homologous End Joining (NHEJ) pathway will introduce random nucleotide insertions and/or deletions (indels), potentially leading to frameshift mutations and/or the introduction of premature termination codons (PTC). In turn, PTC-containing mRNAs are targeted by degradation by the nonsense-mediated mRNA decay (NMD) pathway, ultimately disrupting protein expression/function18,19,20. Alternatively, the template-dependent Homology-Directed Repair (HDR) pathway can operate and faithfully repair the DSB. This mechanism has been harnessed to achieve precise gene editing, including knock-ins and base substitutions. It is worth noting that the cell cycle status is an important factor influencing the choice of DSB repair pathway. Indeed, NHEJ is active at all stages of the cell cycle, while HDR is mainly restricted to the S/G2 phases21.
THP-1 cells grow in suspension and are notoriously difficult to transfect with plasmid DNA, a procedure that possibly also alters their viability and/or differentiation capacity22,23. Transduction with HIV-1-based lentiviral vectors encoding both Cas9 and the sgRNA is often employed to knockout (KO) a gene of interest24. Integration of the Cas9/sgRNA cassette into the cellular genome ensures prolonged expression and efficient KO, but is also a persistent source of off-target effects25. Alternatively, the pre-assembled Cas9:sgRNA ribonucleoproteins (RNPs) are delivered by electroporation, a method involving the temporary formation of pores in both the plasma and nuclear membranes upon application of electric impulses. Preserving cell viability is an important challenge when undertaking this approach.
Here, a THP-1 cell line stably expressing GFP (THP-1_GFP) was produced to serve as a tool to establish a protocol to achieve efficient CRISPR-Cas9-based editing. After designing a strategy to inactivate the EGFP gene using three sgRNAs simultaneously (multi-guide approach), KO efficiency among several electroporation conditions was determined using GFP expression as a readout. Cell proliferation was monitored in parallel. Gene editing was confirmed by both a T7 endonuclease I (T7EI) assay and Sanger sequencing, followed by analysis with the Inference of CRISPR Edits (ICE) algorithm26. Parameters that yielded up to 95% GFP expression decrease, with THP-1 cells recovering normal growth rates after electroporation, were successfully employed to inactivate an endogenous gene (SAMHD1) and produce single-cell THP-1 clones.

<table><tbody><tr><td>0.2 &amp;micro;m syringe filter</td><td>ClearLine</td><td>146560</td><td>_</td></tr><tr><td>0.4 % trypan blue</td><td>Beckman Coulter</td><td>383200</td><td>_</td></tr><tr><td>1.5 mL tube</td><td>Eppendorf</td><td>3810X</td><td>_</td></tr><tr><td>24-well plate</td><td>Corning</td><td>353047</td><td>_</td></tr><tr><td>6x TriTrack DNA Loading Dye</td><td>Thermo scientific</td><td>R1161</td><td>_</td></tr><tr><td>75 cm&amp;sup2; Culture Flask Vented Cap</td><td>Corning</td><td>353136</td><td>_</td></tr><tr><td>8-Strip PCR Tubes with Caps</td><td>Life technologies</td><td>AM12230</td><td>_</td></tr><tr><td>96-well plates Flat bottom</td><td>Corning</td><td>353072</td><td>_</td></tr><tr><td>96-well plates Round bottom</td><td>Corning</td><td>353077</td><td>_</td></tr><tr><td>Agarose</td><td>Euromedex</td><td>D5</td><td>_</td></tr><tr><td>ATGpr</td><td>_</td><td>_</td><td>https://atgpr.dbcls.jp/</td></tr><tr><td>ChemiDoc Imaging System</td><td>BIO-RAD</td><td>12003153</td><td>_</td></tr><tr><td>Counting slide</td><td>NanoEntek</td><td>DHC-N04</td><td>_</td></tr><tr><td>CRISPOR</td><td>_</td><td>_</td><td>http://crispor.gi.ucsc.edu/</td></tr><tr><td>DPBS</td><td>Gibco</td><td>14190094</td><td>_</td></tr><tr><td>Ensembl</td><td>EMBL-EBI</td><td>_</td><td>https://www.ensembl.org/index.html</td></tr><tr><td>Fetal Bovine Serum</td><td>Sigma-Aldrich</td><td>F7524</td><td>_</td></tr><tr><td>FlowJo</td><td>BD Life Sciences</td><td>v10.10</td><td>_</td></tr><tr><td>GeneRuler 100 bp Plus DNA Ladder</td><td>Thermo scientific</td><td>SM0323</td><td>_</td></tr><tr><td>Genome Data Viewer</td><td>NCBI</td><td>_</td><td>https://www.ncbi.nlm.nih.gov/gdv/</td></tr><tr><td>GraphPad Prism</td><td>Dotmatics</td><td>_</td><td>Version 9.3.1</td></tr><tr><td>Herculase II Fusion DNA Polymerases</td><td>Agilent</td><td>600679</td><td>_</td></tr><tr><td>ICE CRISPR Analysis Tool</td><td>Synthego</td><td>_</td><td>https://www.synthego.com/products/bioinformatics/crispr-analysis</td></tr><tr><td>Image Lab Touch</td><td>BIO-RAD</td><td>_</td><td>Version 2.4.0.03</td></tr><tr><td>NEBuffer 2</td><td>New England Biolabs</td><td>B7002S</td><td>Included with T7EI M0302S</td></tr><tr><td>Neon Kit, 10 &amp;micro;L</td><td>Invitrogen</td><td>MPK1025K</td><td>Electroporation kit containing tips, tubes, buffer R and E</td></tr><tr><td>Neon Transfection System</td><td>Invitrogen</td><td>MPK5000</td><td>_</td></tr><tr><td>NetStart 1.0</td><td>_</td><td>_</td><td>https://services.healthtech.dtu.dk/services/NetStart-1.0/</td></tr><tr><td>Nuclease-free Water</td><td>Synthego</td><td>_</td><td>_</td></tr><tr><td>PCR primer (EGFP)</td><td>Eurofins</td><td>_</td><td>Fw : GGAATGCAAGGTCTGTTGAATG ; Rev : CACCTTGATGCCGTTCTTCT</td></tr><tr><td>PCR primer (SAMHD1)</td><td>Eurofins</td><td>_</td><td>Fw : CGGGATTGATTTGAGGACGA ; Rev : GGGTGGCAAGTTAGTGAAGA</td></tr><tr><td>Penicillin-streptomycin (10,000 U/mL)</td><td>Gibco</td><td>15140122</td><td>_</td></tr><tr><td>PFA</td><td>Electron Microscopy Sciences</td><td>15714</td><td>_</td></tr><tr><td>PMA</td><td>Sigma-Aldrich</td><td>P8139</td><td>_</td></tr><tr><td>PrimerQuest</td><td>IDT</td><td>_</td><td>https://eu.idtdna.com/pages/tools/primerquest</td></tr><tr><td>QIAquick PCR Purification Kit</td><td>Qiagen</td><td>28104</td><td>_</td></tr><tr><td>QuickExtract DNA Extraction Solution</td><td>Biosearch Technologies</td><td>QE09050</td><td>_</td></tr><tr><td>RPMI 1640, GlutaMAX</td><td>Gibco</td><td>61870010</td><td>_</td></tr><tr><td>SnapGene Viewer</td><td>Dotmatics</td><td>_</td><td>Version 7</td></tr><tr><td>SpCas9 2NLS Nuclease</td><td>Synthego</td><td>_</td><td>_</td></tr><tr><td>SYBR Safe DNA Gel Stain</td><td>Invitrogen</td><td>S33102</td><td>_</td></tr><tr><td>Synthetic sgRNA (EGFP)</td><td>Synthego</td><td>_</td><td>#1 : CGCGCCGAGGUGAAGUUCGA ; #2 : UUCAAGUCCGCCAUGCCCGA ; #3 : CAACUACAAGACCCGCGCCG</td></tr><tr><td>Synthetic sgRNA (SAMHD1)</td><td>Synthego</td><td>_</td><td>#1 : AUCGCAACGGGGACGCUUGG ; #2 : GCAGUCAAGAACCUCGGCGC ; #3 : CCAUCCCGACUACAAGACAU</td></tr><tr><td>Syringe Plastipak Luer Lock</td><td>BD</td><td>301229</td><td>_</td></tr><tr><td>T100 Thermal Cycler</td><td>BIO-RAD</td><td>1861096</td><td>_</td></tr><tr><td>T7 endonuclease I</td><td>New England Biolabs</td><td>M0302S</td><td>_</td></tr><tr><td>TAE buffer UltraPure, 10x</td><td>Invitrogen</td><td>15558026</td><td>400 mM Tris-Acetate, 10 mM EDTA</td></tr><tr><td>THP-1 cells</td><td>ATCC</td><td>TIB-202</td><td>_</td></tr><tr><td>Trypsin-EDTA (0,05 %)</td><td>Gibco</td><td>25300054</td><td>_</td></tr><tr><td>ZE5 Cell Analyzer</td><td>BIO-RAD</td><td>12014135</td><td>_</td></tr></tbody></table>

electroporation-based crispr-cas9-mediated gene knockout in thp-1 cells and single-cell clone isolation

Electroporation-Based CRISPR-Cas9-Mediated Gene Knockout in THP-1 Cells and Single-Cell Clone Isolation

The human acute monocytic leukemia (AML) THP-1 cell line is widely used as a model to study the functions of human monocyte-derived macrophages, including their interplay with significant human pathogens such as the human immunodeficiency virus (HIV). Compared to other immortalized cell lines of myeloid origin, THP-1 cells retain many intact inflammatory signaling pathways and display phenotypic characteristics that more closely resemble those of primary monocytes, including the ability to differentiate into macrophages when treated with phorbol-12-myristate 13-acetate (PMA). The use of CRISPR-Cas9 technology to engineer THP-1 cells through targeted gene knockout (KO) provides a powerful approach to better characterize immune-related mechanisms, including virus-host interactions. This article describes a protocol for efficient CRISPR-Cas9-based engineering using electroporation to deliver pre-assembled Cas9:sgRNA ribonucleoproteins into the cell nucleus. Using multiple sgRNAs targeting the same locus at slightly different positions results in the deletion of large DNA fragments, thereby increasing editing efficiency, as assessed by the T7 endonuclease I assay. CRISPR-Cas9-mediated editing at the genetic level was validated by Sanger sequencing followed by Inference of CRISPR Edits (ICE) analysis. Protein depletion was confirmed by immunoblotting coupled with a functional assay. Using this protocol, up to 100% indels in the targeted locus and a decrease of over 95% in protein expression were achieved. The high editing efficiency makes it convenient to isolate single-cell clones by limiting dilution.

A THP-1 cell line was generated stably expressing the GFP reporter protein (THP-1_GFP) (Figure 2A) and used as a tool to establish a protocol for an efficient CRISPR-Cas9-mediated gene edition. To this aim, 3 sgRNA targeting the EGFP gene was designed with the CRISPOR web tool29 (Figure 2B), which were simultaneously complexed with Cas9 at a molar ratio of 9:1 to form RNPs before delivery into the cells by electroporation using d...

The THP-1 cell line is widely used as a model to investigate the functions of human monocytes/macrophages across various biology-related research areas. This article describes a protocol for efficient CRISPR-Cas9-based engineering and single-cell clone isolation, enabling the production of robust and reproducible phenotypic data.

The human acute monocytic leukemia (AML) THP-1 cell line is widely used as a model to study the functions of human monocyte-derived macrophages, including ...

electroporation-based-crispr-cas9-mediated-gene-knockout-thp-1-cells

Research

JoVE Journal

Immunology and Infection

In this video, we demonstrate all-in-one CRISPR-Cas9 based genome editing in cultured cells where Cas9 and sgRNA are provided as a single plasmid construct to the cells. The CRISPR-Cas9 system and desired gene to be inserted was introduced in cells through electroporation technique to facilitate successful gene editing.

All-in-One CRISPR Genome Editing: A Method for Homology Directed Repair-Based Gene Knock-In in Cultured Cells Using CRISPR-Cas9 System

This video demonstrates an assay for performing gene editing in human T cells using the CRISPR-Cas9 technology. A mixture of primary CD4+ and CD8+ T cells is combined with a CRISPR-Cas9 ribonucleoprotein complex, targeting specific genes for knockout. Upon electroporation, the sgRNA guides Cas9 to the target DNA sequence, creating precise cuts. These cuts are then repaired by the cell's non-homologous end-joining mechanism, leading to gene knockout.

A CRISPR-Cas9 Technique for Gene Editing in T Cells

The genotyping technique described here, which couples fluorescent polymerase chain reaction (PCR) to capillary gel electrophoresis, allows for high-throughput genotyping of nuclease-mediated knockout clones. It circumvents limitations faced by other genotyping techniques and is more cost effective than sequencing methods.

Using a Fluorescent PCR-capillary Gel Electrophoresis Technique to Genotype CRISPR/Cas9-mediated Knockout Mutants in a High-throughput Format

Recent advances in the ability to genetically manipulate somatic cell lines hold great potential for basic and applied research. Here, we present two approaches for CRISPR/Cas9 generated knockout production and screening in mammalian cell lines, with and without the use of selectable markers.

Selection-dependent and Independent Generation of CRISPR/Cas9-mediated Gene Knockouts in Mammalian Cells

This protocol describes in detail the generation of footprint-free induced pluripotent stem cells (iPSCs) from human pancreatic cells in feeder-free conditions, followed by editing using CRISPR/Cas9 ribonucleoproteins and characterization of the modified single-cell clones.

Efficient Generation and Editing of Feeder-free IPSCs from Human Pancreatic Cells Using the CRISPR-Cas9 System

A protocol for fast CRISPR/Cas9-mediated gene disruption in mouse and human primary hematopoietic cells is described in this article. Cas9-sgRNA ribonucleoproteins are introduced via electroporation with sgRNAs generated through in vitro transcription and commercial Cas9. High editing efficiencies are achieved with limited time and financial cost.

Highly Efficient Gene Disruption of Murine and Human Hematopoietic Progenitor Cells by CRISPR/Cas9

Here, we present a protocol to genetically modify primary or expanded human natural killer (NK) cells using Cas9 Ribonucleoproteins (Cas9/RNPs). By using this protocol, we generated human NK cells deficient for transforming growth factor–b receptor 2 (TGFBR2) and hypoxanthine phosphoribosyltransferase 1 (HPRT1).

Generation of Knock-out Primary and Expanded Human NK Cells Using Cas9 Ribonucleoproteins

Presented here is a protocol for efficient CRISPR/Cas9 ribonucleoprotein-mediated gene editing in mammalian cells using tube electroporation.

CRISPR/Cas9 Ribonucleoprotein-mediated Precise Gene Editing by Tube Electroporation

The presented method describes the generation of a CRISPR-mediated gene knockout in the human embryonic stem cell (hESC) line H9, which stably expresses sgRNAs targeting the L2HGDH gene using a highly efficient lentiviral-mediated gene delivery system.

CRISPR-Cas9 Mediated Gene Deletion in Human Pluripotent Stem Cells Cultured Under Feeder-Free Conditions

Here, we outline a comprehensive protocol for generating and utilizing laboratory-engineered glioblastoma organoids (LEGO) to investigate genotype-phenotype dependencies and screen potential drugs for glioblastoma treatment.

Laboratory-Engineered Glioblastoma Organoid Culture and Drug Screening

A detailed protocol is provided for using CRISPR/Cas9 technology to achieve highly efficient targeted knock-in of large, multicistronic constructs in primary human T cells via the homology-mediated end joining (HMEJ) DNA repair pathway. T cells engineered with this cGMP-adaptable protocol maintain excellent cell expansion, cytotoxicity, and cytokine production.

Non-Viral Engineering of Primary Human T Cells via Homology-Mediated End-Joining Targeted Integration of Large DNA Templates

Learn CRISPR-Cas9 electroporation for gene knockout in THP-1 cells to study HIV resistance mechanisms. This protocol enables efficient genome editing and single-cell clone isolation for macrophage research.

Electroporation-Based CRISPR-Cas9-Mediated Gene Knockout in THP-1 Cells and Single-Cell Clone Isolation

Explore More Videos