Name: Identification of Functionally-Relevant Lentivirus Integration Sites in an Insertional Mutagenesis Cell Library (Video) | JoVE Journal
Uploaded: 2025-01-10T14:30:00.000+00:00
Duration: 7 min 28 s
Description: Discover the InSET method for identifying functional genomic elements using lentivirus integration sites in a cell library. This approach reveals novel exons in protein-coding and non-coding regions.

ai_agent_IP

ai_agent

maintenance

instantTrialDurationMinutes

isBiopharma

enableNewMyJoveSectionDesign

educationFeatures

seoMetaApi

ai_copilot_institution_blacklist

ai_chat_institution_blacklist

freeAccessWindow

ssoRoleCapture

scheduledMaintenanceBanner

joveLabsFeatures

disable_autoplay_for_bots

extended_trial_duration

5 minutes

D.X. is supported by the National Natural Science Foundation of China (32000441), the Natural Science Foundation of Fujian Province, China (2023J01130), the Fundamental Research Funds for the Central Universities of Huaqiao University (ZQN-924), and the Scientific Research Funds of Huaqiao University (18BS205). P.K. is supported by the National Natural Science Foundation of China (32170619), the Research Fund for International Senior Scientists from the National Natural Science Foundation of China (32150710525), and the Natural Science Foundation of Fujian Province, China (2020J02006).

Figure 1 provides a schematic overview of the InSET method. For optimal coverage, prepare five parallel libraries from 1 &#181;g of genomic DNA, then pool them for next-generation sequencing. This procedure has been successfully completed continuously in previous tests, though users may introduce pause points based on their discretion. Detailed information on the reagents and equipment used in this study can be found in the Table of Materials.
1. Capture of lentivirus integration sites in the genome
<ol>
	<li>Use the Genomic DNA isolated from lentivirus-based insertional mutagenesis cell library (1 &#181;g), as described in a previous study32, as the template for a linear PCR in a 50 &#181;L reaction containing 1x Taq Buffer, 2.5 U Taq DNA Polymerase, 4 &#181;L of dNTP Mixture (2.5 mM each), and 0.3 &#181;M of biotinylated primer 3-LTR_prime (Table 1) in a PCR tube. 
	NOTE: The 3-LTR_prime primer anneals to the LTR region of the lentivirus sequence. If it anneals to the 5&#39; LTR, the amplified fragment includes the flanking genomic sequence. If it anneals to the 3&#39; LTR, the amplified fragment contains an internal lentivirus sequence, which cannot be aligned to the host genome and will, therefore, be filtered out during downstream sequencing data analysis. This primer can also be modified to adapt to other types of vectors used to generate an insertional mutagenesis cell library.</li>
	<li>Perform 50 cycles of linear PCR in a standard PCR thermocycler, adding 2.5 U of Taq DNA Polymerase at the start and again immediately after 25 cycles. PCR conditions are as follows: 94 &#176;C for 5 min; 50 cycles of 94 &#176;C for 30 s, 55 &#176;C for 30 s and 72 &#176;C for 30 s; 72 &#176;C for 5 min. 
	NOTE: To maintain the activity of the Taq DNA Polymerase during prolonged reactions, it is recommended to add the enzyme at both the beginning and the midpoint of the reaction.</li>
	<li>Transfer the PCR products to a new, clean 1.5 mL centrifuge tube.</li>
	<li>Mix the PCR products thoroughly with 10 &#181;L of biotin-streptavidin magnetic beads.</li>
	<li>Incubate the mixture for 2 hours at room temperature, shaking at 400 rpm in a metal bath. 
	NOTE: Take out the tube to mix well with the pipette every 15 min.</li>
	<li>Use a magnetic stand to collect the beads, then carefully remove the supernatant.</li>
	<li>Wash the beads with 300 &#181;L of Binding/Wash Buffer (10 mM of Tris-HCl (pH 7.5), 1 mM of EDTA, 1 M of NaCl, 0.1% Tween-20) 6 times and discard the supernatant.</li>
	<li>Wash with 300 &#181;L (65 &#176;C) DNase/RNase-free distilled water twice and discard the supernatant.</li>
	<li>For the second strand synthesis, resuspend the beads in a 24 &#181;L reaction volume containing 1x Klenow Fragment Buffer, 2 &#181;L of dNTP Mixture (2.5 mM each), and 6.25 &#181;M of P5_N6 primer (Table 1) in a PCR tube. 
	NOTE: Prepare a 100 &#181;M stock solution of P5_N6 primer. The P5_N6 primer is composed of a fixed P5 adaptor sequence at the 5&#39; end and a random hexamer sequence at the 3&#39; end. The random hexamer can bind to a diverse range of target sequences, making it suitable for amplifying various DNA fragments generated through linear PCR.</li>
	<li>Pre-incubate the mixture at 15 &#176;C for 20 min in a PCR thermocycler.</li>
	<li>Add 2 U of Klenow Fragment (Large Fragment E.coli DNA Polymerase).</li>
	<li>Incubate the mixtures in a PCR thermocycler at the following conditions: slowly ramp at 0.5 &#176;C/min from 15 &#176;C to 25 &#176;C followed by 30 min incubation; then slowly ramp at 0.5 &#176;C/min to 37 &#176;C followed by 1 h incubation.</li>
	<li>Transfer the PCR products into a new, clean 1.5 mL centrifuge tube.</li>
	<li>Use a magnetic stand to capture the beads, then discard the supernatant.</li>
	<li>Wash the beads gently with 300 &#181;L of 4 &#176;C DNase/RNase-free distilled water. Collect the beads and discard the supernatant.</li>
</ol>
2. Construction of NGS library with nested PCR
<ol>
	<li>Resuspend the beads from step 1.15 in a 25 &#181;L PCR reaction volume containing 1x Taq Buffer, 1.25 U Taq DNA Polymerase, 0.5 &#181;M of primer P5 (Table 1), 2 &#181;L of dNTP Mixture (2.5 mM each), and 0.5 &#181;M of primer 3-LTR_Nest (Table 1) in a PCR tube.</li>
	<li>Perform PCR reactions in a PCR thermocycler under the following conditions: 94 &#176;C for 3 min; 20 cycles of 94 &#176;C for 30 s, 55 &#176;C for 30 s and 72 &#176;C for 30 s; 72 &#176;C for 7 min.</li>
	<li>Use 5 &#181;L of the PCR products from step 2.2 as the template for the next round of PCR in 50 &#181;L volume containing 1x Taq Buffer, 2.5 U Taq DNA Polymerase, 4 &#181;L of dNTP Mixture (2.5 mM each), 0.4 &#181;M of primer Illumina_P5 (Table 1) and 0.4 &#181;M of primer Illumina_P7-3LTR (Table 1).</li>
	<li>Perform PCR reactions in a PCR thermocycler under the following conditions: 94 &#176;C for 3 min; 15 cycles of 94 &#176;C for 30 s, 55 &#176;C for 30 s, and 72 &#176;C for 30 s; 72 &#176;C for 7 min.</li>
	<li>Transfer the PCR products to a clean 1.5 mL centrifuge tube. 
	NOTE: The protocol can be paused at this step, and the samples can be stored at -20 &#176;C.</li>
	<li>Purify the PCR products using 1.2x volumes of DNA clean beads, bringing the final volume to 21 &#181;L. 
	NOTE: Take 10 &#181;L of PCR products from each of the 5 libraries prepared in parallel, pool them together, and purify to a final volume of 21 &#181;L. The purification protocol for the PCR products is adapted from the manufacturer&#39;s instructions for the DNA clean beads (see Table of Materials).
	<ol>
		<li>Equilibrate the beads from 2-8 &#176;C to room temperature for 30 min.</li>
		<li>Mix the beads thoroughly by inverting or vortexing.</li>
		<li>Pipette 1.2x volumes of the beads into a clean 1.5 mL centrifuge tube.</li>
		<li>Add the PCR products into the beads and mix thoroughly by pipetting up and down 10 times.</li>
		<li>Incubate at room temperature for 5 min to allow DNA binding to the beads.</li>
		<li>Place the samples on a magnetic stand and remove the supernatant once the solution is clear (about 5 min).</li>
		<li>Add 200 &#181;L of 80% ethanol to wash the beads, incubate at room temperature for 30 s, and remove the supernatant. 
		NOTE: The 80% ethanol should be prepared freshly.</li>
		<li>Repeat step 2.6.7 once.</li>
		<li>Air dry the beads at room temperature with the lid open for about 5 min.</li>
		<li>Remove the tube from the magnetic stand, add 22 &#181;L of DNase/RNase-free distilled water, mix thoroughly by pipetting up and down 10 times, and let it sit at room temperature for 2 min.</li>
		<li>Place the tube on the magnetic stand until the solution is clear (about 2 min), then transfer 21 &#181;L of supernatant to a clean 1.5 mL centrifuge tube. 
		NOTE: The protocol can be paused at this step, and the samples can be stored at -20 &#176;C.</li>
	</ol>
	</li>
	<li>Use 1 &#181;L of purified PCR products to measure the concentration using the Fluorometer with the commercially available dsDNA fluorescence detection kit (see Table of Materials). 
	NOTE: The concentration measurement protocol follows the manufacturer&#39;s instructions for the dsDNA detection kit.
	<ol>
		<li>Prepare the Working Solution preparation by mixing the Reagent and Buffer (provided in the kit) at a ratio of 1:200.</li>
		<li>Prepare the assay standards by mixing 10 &#181;L of Standard #1 and 10 &#181;L of Standard #2 (provided in the kit), each with 190 &#181;L of Working Solution. Gently vortex the mixture for 2-3 s.</li>
		<li>Prepare the assay sample by mixing 1 &#181;L of the purified PCR products with 190 &#181;L of Working Solution. Gently vortex the mixture for 2-3 s.</li>
		<li>Incubate the assay standards and assay samples for 2 min at room temperature, keeping them protected from light.</li>
		<li>Turn on the Fluorometer.</li>
		<li>Select the dsDNA High Sensitivity&#160;program from the main menu.</li>
		<li>For calibration, insert Standard #1 into the machine, press the Read standard button to measure the first standard, then insert Standard #2 and press the Read standard button to measure the second standard.</li>
		<li>For sample measurement, press the Run samples button to go to the sample measurement page. Insert each tube containing the assay sample, and press the Read tube button to obtain the concentration. 
		NOTE: The protocol can be paused at this step, and the samples can be stored at -20 &#176;C.</li>
	</ol>
	</li>
	<li>Perform NGS on Illumina platforms using paired-end 150 bp (PE150) strategy on a 30 giga-base (GB) scale. 
	NOTE: This step is usually outsourced to the sequencing companies.</li>
</ol>
3. Data analysis
NOTE: The analysis in human cell lines was used as an example in this section.
<ol>
	<li>Mapping of lentivirus-integration sites
	<ol>
		<li>Filter out sequencing reads with more than 50% low-quality bases (Phred score &#60;20), more than 15 &#39;N&#39; bases, or shorter than 150 bases using fastp tool33 (see Table of Materials).</li>
		<li>Select only paired-end reads with the read 2 starting with LTR tag &#34;GCCTTGTGTGTGGTAGATCCACAG 
		ATCAAGGATATCTTGTCTTCGTTGGGAGTGA&#8203;AT 
		TAGCCCTTCCA&#34;. 
		NOTE: This sequence depends on the sequence of the vector used to generate the insertional mutagenesis cell library.</li>
		<li>Trim the LTR tag sequence from the reads selected from step 3.1.2.</li>
		<li>Align the trimmed reads to the GRCh37/hg19 using BWA-MEM 34 (see Table of Materials) with default settings.</li>
		<li>Retain only read pairs in which both read 1 and read 2 are uniquely mapped to the genome with correct configuration and spacing, indicated by FLAG 147 and FLAG 163.</li>
		<li>Define the insertion position as the first aligned base of the trimmed read 2.</li>
		<li>Normalize the read counts at each unique insertion site to the total number of uniquely aligned reads in each sample.</li>
	</ol>
	</li>
	<li>Identification of insertions affecting cellular fitness (IACFs) 
	NOTE: In the statistical analysis, it is advisable to conduct pairwise comparisons among the three biological replicates of both control and treated samples to identify significantly enriched or depleted positions. The number of replicates mentioned above is minimal. It is recommended to use as many replicates as practically possible to ensure the reliability and accuracy of the results.
	<ol>
		<li>Convert the normalized read counts of each position to log10 values.</li>
		<li>Set the log10 values of positions with zero reads as &#8722;5.</li>
		<li>Perform two-sided paired Student&#39;s t-test on the log10 values.</li>
		<li>Adjust the p-values for multiple comparisons using the Benjamini-Hochberg method within the R environment.</li>
		<li>Select positions with a False Discovery Rate (FDR) threshold of 25% as IACFs.</li>
	</ol>
	</li>
	<li>Identification of clusters affecting cellular fitness (CACFs) 
	NOTE: Three biological replicates of control and treated samples were recommended for this analysis.
	<ol>
		<li>Identify the significantly enriched or depleted insertion clusters between control and treated samples using SICER35 (see Table of Materials) with an FDR threshold of 1%. The command for SICER analysis is &#34;sh $SICER/SICER.sh $InputDir $In $Control $OutputDir hg19 1 10 1 0.8 30 0.01&#34;. 
		NOTE: The meanings of the parameters in the command above are as follows: [&#34;InputDir&#34;] [&#34;treated sample insertion sites bed file&#34;] [&#34;control sample insertion sites bed file&#34;] [&#34;OutputDir&#34;] [&#34;species&#34;] [&#34;redundancy threshold&#34;] [&#34;window size (bp)&#34;] [&#34;fragment size&#34;] [&#34;effective genome fraction&#34;] [&#34;gap size (bp)&#34;] [&#34;E-value&#34;].</li>
		<li>Obtain cluster regions shared by at least two biological replicates with the &#34;intersect&#34; function of the BEDTools suite36 (see Table of Materials) and denote these cluster regions as CACFs.</li>
	</ol>
	</li>
</ol>

InSET: A Novel Tool for Unbiased Genome-Wide Functional Element Discovery

<ol><li>Kapranov, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Large-scale+transcriptional+activity+in+chromosomes+21+and+22%5BTitle%5D)+AND+%22Science%22%5BJournal%5D)">Large-scale transcriptional activity in chromosomes 21 and 22.</a> Science. 296 (5569), 916-919 (2002).</li>
<li>Bertone, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Global+identification+of+human+transcribed+sequences+with+genome+tiling+arrays%5BTitle%5D)+AND+%22Science%22%5BJournal%5D)">Global identification of human transcribed sequences with genome tiling arrays.</a> Science. 306 (5705), 2242-2246 (2004).</li>
<li>Carninci, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+transcriptional+landscape+of+the+mammalian+genome%5BTitle%5D)+AND+%22Science%22%5BJournal%5D)">The transcriptional landscape of the mammalian genome.</a> Science. 309 (5740), 1559-1563 (2005).</li>
<li>Kapranov, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+majority+of+total+nuclear-encoded+non-ribosomal+RNA+in+a+human+cell+is+%27dark+matter%27+un-annotated+RNA%5BTitle%5D)+AND+%22BMC+Biol%22%5BJournal%5D)">The majority of total nuclear-encoded non-ribosomal RNA in a human cell is 'dark matter' un-annotated RNA.</a> BMC Biol. 8, 149(2010).</li>
<li>Djebali, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Landscape+of+transcription+in+human+cells%5BTitle%5D)+AND+%22Nature%22%5BJournal%5D)">Landscape of transcription in human cells.</a> Nature. 489 (7414), 101-108 (2012).</li>
<li>Kapranov, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Examples+of+the+complex+architecture+of+the+human+transcriptome+revealed+by+race+and+high-density+tiling+arrays%5BTitle%5D)+AND+%22Genome+Res%22%5BJournal%5D)">Examples of the complex architecture of the human transcriptome revealed by race and high-density tiling arrays.</a> Genome Res. 15 (7), 987-997 (2005).</li>
<li>Denoeud, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Prominent+use+of+distal+5%27+transcription+start+sites+and+discovery+of+a+large+number+of+additional+exons+in+encode+regions%5BTitle%5D)+AND+%22Genome+Res%22%5BJournal%5D)">Prominent use of distal 5' transcription start sites and discovery of a large number of additional exons in encode regions.</a> Genome Res. 17 (6), 746-759 (2007).</li>
<li>Mercer, T. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Targeted+RNA+sequencing+reveals+the+deep+complexity+of+the+human+transcriptome%5BTitle%5D)+AND+%22Nat+Biotechnol%22%5BJournal%5D)">Targeted RNA sequencing reveals the deep complexity of the human transcriptome.</a> Nat Biotechnol. 30 (1), 99-104 (2011).</li>
<li>Deveson, I. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Universal+alternative+splicing+of+non-coding+exons%5BTitle%5D)+AND+%22Cell+Syst%22%5BJournal%5D)">Universal alternative splicing of non-coding exons.</a> Cell Syst. 6 (2), 245-255.e5 (2018).</li>
<li>Xu, D., Tang, L., Kapranov, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Complexities+of+mammalian+transcriptome+revealed+by+targeted+RNA+enrichment+techniques%5BTitle%5D)+AND+%22Trends+Genet%22%5BJournal%5D)">Complexities of mammalian transcriptome revealed by targeted RNA enrichment techniques.</a> Trends Genet. 39 (4), 320-333 (2023).</li>
<li>Amaral, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+status+of+the+human+gene+catalogue%5BTitle%5D)+AND+%22Nature%22%5BJournal%5D)">The status of the human gene catalogue.</a> Nature. 622 (7981), 41-47 (2023).</li>
<li>Mattick, J. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Long+non-coding+RNAs%3A+Definitions%2C+functions%2C+challenges+and+recommendations%5BTitle%5D)+AND+%22Nat+Rev+Mol+Cell+Biol%22%5BJournal%5D)">Long non-coding RNAs: Definitions, functions, challenges and recommendations.</a> Nat Rev Mol Cell Biol. 24 (6), 430-447 (2023).</li>
<li>Bassik, M. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+systematic+mammalian+genetic+interaction+map+reveals+pathways+underlying+ricin+susceptibility%5BTitle%5D)+AND+%22Cell%22%5BJournal%5D)">A systematic mammalian genetic interaction map reveals pathways underlying ricin susceptibility.</a> Cell. 152 (4), 909-922 (2013).</li>
<li>Wang, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Identification+and+characterization+of+essential+genes+in+the+human+genome%5BTitle%5D)+AND+%22Science%22%5BJournal%5D)">Identification and characterization of essential genes in the human genome.</a> Science. 350 (6264), 1096-1101 (2015).</li>
<li>Zhu, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Genome-scale+deletion+screening+of+human+long+non-coding+RNAs+using+a+paired-guide+RNA+CRISPR-Cas9+library%5BTitle%5D)+AND+%22Nat+Biotechnol%22%5BJournal%5D)">Genome-scale deletion screening of human long non-coding RNAs using a paired-guide RNA CRISPR-Cas9 library.</a> Nat Biotechnol. 34 (12), 1279-1286 (2016).</li>
<li>Liu, S. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((CRISPRi-based+genome-scale+identification+of+functional+long+non-coding+RNA+loci+in+human+cells%5BTitle%5D)+AND+%22Science%22%5BJournal%5D)">CRISPRi-based genome-scale identification of functional long non-coding RNA loci in human cells.</a> Science. 355, 6320(2017).</li>
<li>Bester, A. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((An+integrated+genome-wide+CRISPRa+approach+to+functionalize+lncRNAs+in+drug+resistance%5BTitle%5D)+AND+%22Cell%22%5BJournal%5D)">An integrated genome-wide CRISPRa approach to functionalize lncRNAs in drug resistance.</a> Cell. 173 (3), 649-664.e20 (2018).</li>
<li>Liu, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Genome-wide+screening+for+functional+long+non-coding+RNAs+in+human+cells+by+Cas9+targeting+of+splice+sites%5BTitle%5D)+AND+%22Nat+Biotechnol%22%5BJournal%5D)">Genome-wide screening for functional long non-coding RNAs in human cells by Cas9 targeting of splice sites.</a> Nat Biotechnol. 36, 1203-1210 (2018).</li>
<li>Xu, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+CRISPR%2FCas13-based+approach+demonstrates+biological+relevance+of+vlinc+class+of+long+non-coding+RNAs+in+anticancer+drug+response%5BTitle%5D)+AND+%22Sci+Rep%22%5BJournal%5D)">A CRISPR/Cas13-based approach demonstrates biological relevance of vlinc class of long non-coding RNAs in anticancer drug response.</a> Sci Rep. 10 (1), 1794(2020).</li>
<li>Noguchi, Y., Matsui, R., Suh, J., Dou, Y., Suzuki, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Genome-wide+screening+approaches+for+biochemical+reactions+independent+of+cell+growth%5BTitle%5D)+AND+%22Annu+Rev+Genomics+Hum+Genet%22%5BJournal%5D)">Genome-wide screening approaches for biochemical reactions independent of cell growth.</a> Annu Rev Genomics Hum Genet. 25 (1), 51-76 (2024).</li>
<li>Recinos, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((CRISPR-dCas13d-based+deep+screening+of+proximal+and+distal+splicing-regulatory+elements%5BTitle%5D)+AND+%22Nat+Commun%22%5BJournal%5D)">CRISPR-dCas13d-based deep screening of proximal and distal splicing-regulatory elements.</a> Nat Commun. 15 (1), 3839(2024).</li>
<li>Cho, S. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Analysis+of+off-target+effects+of+CRISPR%2FCas-derived+RNA-guided+endonucleases+and+nickases%5BTitle%5D)+AND+%22Genome+Res%22%5BJournal%5D)">Analysis of off-target effects of CRISPR/Cas-derived RNA-guided endonucleases and nickases.</a> Genome Res. 24 (1), 132-141 (2014).</li>
<li>Zhang, X. H., Tee, L. Y., Wang, X. G., Huang, Q. S., Yang, S. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Off-target+effects+in+CRISPR%2FCas9-mediated+genome+engineering%5BTitle%5D)+AND+%22Mol+Ther+Nucleic+Acids%22%5BJournal%5D)">Off-target effects in CRISPR/Cas9-mediated genome engineering.</a> Mol Ther Nucleic Acids. 4 (11), e264(2015).</li>
<li>Stojic, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Specificity+of+RNAi%2C+LNA+and+CRISPRi+as+loss-of-function+methods+in+transcriptional+analysis%5BTitle%5D)+AND+%22Nucleic+Acids+Res%22%5BJournal%5D)">Specificity of RNAi, LNA and CRISPRi as loss-of-function methods in transcriptional analysis.</a> Nucleic Acids Res. 46 (12), 5950-5966 (2018).</li>
<li>Gao, F., Cai, Y., Kapranov, P., Xu, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Reverse-genetics+studies+of+lncRNAs-what+we+have+learnt+and+paths+forward%5BTitle%5D)+AND+%22Genome+Biol%22%5BJournal%5D)">Reverse-genetics studies of lncRNAs-what we have learnt and paths forward.</a> Genome Biol. 21 (1), 93(2020).</li>
<li>Leoni, C., Volpicella, M., De Leo, F., Gallerani, R., Ceci, L. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Genome+walking+in+eukaryotes%5BTitle%5D)+AND+%22FEBS+J%22%5BJournal%5D)">Genome walking in eukaryotes.</a> FEBS J. 278 (21), 3953-3977 (2011).</li>
<li>Carette, J. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Haploid+genetic+screens+in+human+cells+identify+host+factors+used+by+pathogens%5BTitle%5D)+AND+%22Science%22%5BJournal%5D)">Haploid genetic screens in human cells identify host factors used by pathogens.</a> Science. 326 (5957), 1231-1235 (2009).</li>
<li>Carette, J. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Global+gene+disruption+in+human+cells+to+assign+genes+to+phenotypes+by+deep+sequencing%5BTitle%5D)+AND+%22Nat+Biotechnol%22%5BJournal%5D)">Global gene disruption in human cells to assign genes to phenotypes by deep sequencing.</a> Nat Biotechnol. 29 (6), 542-546 (2011).</li>
<li>Burckstummer, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+reversible+gene+trap+collection+empowers+haploid+genetics+in+human+cells%5BTitle%5D)+AND+%22Nat+Methods%22%5BJournal%5D)">A reversible gene trap collection empowers haploid genetics in human cells.</a> Nat Methods. 10 (10), 965-971 (2013).</li>
<li>Carette, J. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Ebola+virus+entry+requires+the+cholesterol+transporter+niemann-pick+c1%5BTitle%5D)+AND+%22Nature%22%5BJournal%5D)">Ebola virus entry requires the cholesterol transporter niemann-pick c1.</a> Nature. 477 (7364), 340-343 (2011).</li>
<li>Cao, J. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+genome-wide+haploid+genetic+screen+identifies+regulators+of+glutathione+abundance+and+ferroptosis+sensitivity%5BTitle%5D)+AND+%22Cell+Rep%22%5BJournal%5D)">A genome-wide haploid genetic screen identifies regulators of glutathione abundance and ferroptosis sensitivity.</a> Cell Rep. 26 (6), 1544-1556.e8 (2019).</li>
<li>Xu, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Evidence+for+widespread+existence+of+functional+novel+and+non-canonical+human+transcripts%5BTitle%5D)+AND+%22BMC+Biol%22%5BJournal%5D)">Evidence for widespread existence of functional novel and non-canonical human transcripts.</a> BMC Biol. 21 (1), 271(2023).</li>
<li>Chen, S., Zhou, Y., Chen, Y., Gu, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Fastp%3A+An+ultra-fast+all-in-one+FASTQ+preprocessor%5BTitle%5D)+AND+%22Bioinformatics%22%5BJournal%5D)">Fastp: An ultra-fast all-in-one FASTQ preprocessor.</a> Bioinformatics. 34 (17), i884-i890 (2018).</li>
<li>Li, H. Aligning sequence reads, clone sequences and assembly contigs with bwa-mem. <a target="_blank" href="http://scholar.google.com/scholar?hl=en&safe=off&q=author%3aLi%2C+H+%22arXiv+preprint+arXiv%3A1303.3997%22">arXiv preprint arXiv:1303.3997</a>. , (2013).</li>
<li>Zang, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+clustering+approach+for+identification+of+enriched+domains+from+histone+modification+chip-seq+data%5BTitle%5D)+AND+%22Bioinformatics%22%5BJournal%5D)">A clustering approach for identification of enriched domains from histone modification chip-seq data.</a> Bioinformatics. 25 (15), 1952-1958 (2009).</li>
<li>Quinlan, A. R., Hall, I. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Bedtools%3A+A+flexible+suite+of+utilities+for+comparing+genomic+features%5BTitle%5D)+AND+%22Bioinformatics%22%5BJournal%5D)">Bedtools: A flexible suite of utilities for comparing genomic features.</a> Bioinformatics. 26 (6), 841-842 (2010).</li>
<li>Pule, M. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Flanking-sequence+exponential+anchored-polymerase+chain+reaction+amplification%3A+A+sensitive+and+highly+specific+method+for+detecting+retroviral+integrant-host-junction+sequences%5BTitle%5D)+AND+%22Cytotherapy%22%5BJournal%5D)">Flanking-sequence exponential anchored-polymerase chain reaction amplification: A sensitive and highly specific method for detecting retroviral integrant-host-junction sequences.</a> Cytotherapy. 10 (5), 526-539 (2008).</li>
<li>Demeulemeester, J., De Rijck, J., Gijsbers, R., Debyser, Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Retroviral+integration%3A+Site+matters%3A+Mechanisms+and+consequences+of+retroviral+integration+site+selection%5BTitle%5D)+AND+%22Bioessays%22%5BJournal%5D)">Retroviral integration: Site matters: Mechanisms and consequences of retroviral integration site selection.</a> Bioessays. 37 (11), 1202-1214 (2015).</li>
<li>Kvaratskhelia, M., Sharma, A., Larue, R. C., Serrao, E., Engelman, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Molecular+mechanisms+of+retroviral+integration+site+selection%5BTitle%5D)+AND+%22Nucleic+Acids+Res%22%5BJournal%5D)">Molecular mechanisms of retroviral integration site selection.</a> Nucleic Acids Res. 42 (16), 10209-10225 (2014).</li>
<li>Ambrosi, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Estimated+comparative+integration+hotspots+identify+different+behaviors+of+retroviral+gene+transfer+vectors%5BTitle%5D)+AND+%22PLoS+Comput+Biol%22%5BJournal%5D)">Estimated comparative integration hotspots identify different behaviors of retroviral gene transfer vectors.</a> PLoS Comput Biol. 7 (12), e1002292(2011).</li>
</ol>

The authors have no disclosures.

In forward genetics analysis, genome-walking is essential for profiling integration sites in insertional mutagenesis cell libraries. Classical genome-walking methods like I-PCR&#160;and LAM-PCR&#160;often require restriction enzyme digestion and ligation, which can reduce library complexity and introduce biases due to enzyme site dependency27,28,29. The InSET method overcomes these limitations by eliminating the restriction dige...

Functional genomics remains a crucial and challenging field, even in the post-genome era, with a significant portion of genomic regions still lacking functional characterization. A key reason for these challenges lies in the intricate nature of the human genome and transcriptome, which are characterized by pervasive transcription and universal alternative splicing in both protein-coding and non-coding regions1,2,3,4,5. This complexity has been extensively highlighted through RNA-targeted enrichment studies6,7,8,9. It is increasingly recognized that numerous novel genomic elements remain unmapped and functionally unannotated10,11,12in addition to the well-annotated segments of the human genome.
In recent years, advancements in reverse-genetics tools have been seen, such as RNA interference (RNAi) and CRISPR/Cas systems13,14,15,16,17,18,19,20,21. However, these methods have notable disadvantages, including non-specific effects and high costs associated with generating complex libraries of short hairpin RNAs (shRNAs) or single guide RNAs (sgRNAs)22,23,24,25. Additionally, these methods predominantly focus on annotated genomic elements. In contrast, forward genetics has the advantage of identifying novel, unannotated functional genomic elements. Given the complexity of the human genome and transcriptome, as well as the vast number of novel genomic elements, this capability of forward genetics is of significant importance.
Forward genetics cell libraries are frequently generated through random retroviral integration, making the efficient detection of genome-wide integration sites crucial for a forward genetics assay. Detecting these integration sites typically involves genome-walking tools26. While there have been significant advancements in these tools, few are optimized for next-generation sequencing (NGS) applications and subsequently applied in insertional mutagenesis studies. Insertional mutagenesis in cell lines often utilizes methods like inverse PCR (I-PCR) or linear amplification-mediated PCR (LAM-PCR) to detect integration sites27,28,29. These methods, however, usually require restriction enzyme digestion or ligation steps, which can reduce efficiency and introduce biases in the results.
To enhance the efficient detection of genome-wide integration sites in forward genetics screens, a method called the Insertion-based Screen for functional Elements and Transcripts (InSET) method was introduced here. By integrating genome-walking with NGS, InSET enables the high-throughput identification of lentivirus integration sites in lentivirus-based insertional mutagenesis libraries. Compared to existing methods27,28,29, InSET is relatively straightforward and simple, eliminating the restriction enzyme digestion or ligation steps, making it more convenient and accessible. Furthermore, although the existing forward genetics screen in mammalian cells is limited to very few haploid or near-haploid cell lines27,28,29,30,31, InSET has been proven to work in aneuploid cell lines32.
This study provides a detailed, step-by-step protocol for implementing the InSET method. Additionally, it demonstrates the application of InSET in insertional mutagenesis studies. InSET serves as a powerful tool for identifying novel exons within genomic elements, encompassing both protein-coding and non-coding RNAs in human cell lines.

<table><tbody><tr><td>0.5 M EDTA</td><td>Invitrogen</td><td>AM9260G</td><td>To make Binding/Wash Buffer</td></tr><tr><td>1 M Tris-HCl (Ph 8.0)</td><td>Invitrogen</td><td>15568025</td><td>To make Binding/Wash Buffer</td></tr><tr><td>10&amp;times; Klenow Fragment Buffer&amp;nbsp;</td><td>Takara</td><td>2140A</td><td></td></tr><tr><td>10&amp;times; Taq Buffer</td><td>Tiangen</td><td>ET101-01-01</td><td></td></tr><tr><td>5 M NaCl</td><td>Invitrogen</td><td>AM9659</td><td>To make Binding/Wash Buffer</td></tr><tr><td>BeaverBeads Streptavidin</td><td>Beaver</td><td>22307-1</td><td>1 &amp;mu;m</td></tr><tr><td>BEDTools</td><td></td><td>Software, v2</td><td>https://bedtools.readthedocs.io/en/latest/</td></tr><tr><td>BWA-MEM</td><td></td><td></td><td>Software, v0.7.12</td></tr><tr><td>dNTP Mixture</td><td>Takara</td><td>4030</td><td>2.5 mM each</td></tr><tr><td>Equalbit dsDNA HS Assay Kit</td><td>Vazyme</td><td>EQ111-02</td><td></td></tr><tr><td>fastp</td><td></td><td></td><td>Software</td></tr><tr><td>HiSeq X Ten</td><td>Illumina</td><td>SY-412-1001</td><td>Illumina platform, outsourced to Novogene Corporation (Beijing)</td></tr><tr><td>Klenow Fragment</td><td>Takara</td><td>2140A</td><td></td></tr><tr><td>NovaSeq 6000</td><td>Illumina</td><td>20012850</td><td>Illumina platform, outsourced to Novogene Corporation (Beijing)</td></tr><tr><td>Qubit 3.0 Fluorometer</td><td>ThermoFisher Scientific</td><td>Q33216</td><td></td></tr><tr><td>SICER</td><td></td><td></td><td>Software, v1.1</td></tr><tr><td>Taq DNA Polymerase</td><td>Tiangen</td><td>ET101-01-01</td><td></td></tr><tr><td>Tween-20</td><td>HuShi</td><td>30189328</td><td>To make Binding/Wash Buffer</td></tr><tr><td>UltraPure Distilled Water</td><td>Invitrogen</td><td>10977015</td><td></td></tr><tr><td>VAHTS DNA Clean Beads</td><td>Vazyme</td><td>N411-01</td><td></td></tr></tbody></table>

identification of functionally-relevant lentivirus integration sites in an insertional mutagenesis cell library

Identification of Functionally-Relevant Lentivirus Integration Sites in an Insertional Mutagenesis Cell Library

The extent of functional sequences within the human genome is a pivotal yet debated topic in biology. Although high-throughput reverse genetic screens have made strides in exploring this, they often limit their scope to known genomic elements and may introduce non-specific effects. This underscores the urgent need for novel functional genomics tools that enable a deeper, unbiased understanding of genome functionality. This protocol introduces the Insertion-based Screen for functional Elements and Transcripts (InSET), a method for identifying lentivirus integration sites within a lentivirus-based insertional mutagenesis cell library. InSET facilitates the capture of genome-wide lentiviral integration sites, with next-generation sequencing used to detect and quantify flanking sequences. InSET's design enables the analysis of integration site abundance variations in phenotypic screens on a large scale, establishing it as a robust tool for forward genetics and for identifying functional genomic elements. A key benefit of InSET is its capacity to reveal previously unidentified genomic elements, including novel functional exons of both protein-coding and non-coding RNAs, independent of prior annotation. Overall, InSET holds significant value in studying the intricate complexity of the human genome and transcriptome, where many genomic elements await functional characterization.

Quality control assessment of an NGS library, typically performed by the sequencing provider, serves as the standard quality check before sequencing. To demonstrate the impact of library quality, two samples were compared. The high-quality library, labeled s2-20-15, was prepared using the standard nested PCR protocol, consisting of two sequential amplification steps: the first with 20 cycles, followed by the second with 15 cycles. In contrast, the low-quality library, labeled s1-30, was prepared using a single-step PCR w...

Insertional mutagenesis is an essential tool in forward genetics for identifying functional genomic elements. Here, we describe the Insertion-based Screen for functional Elements and Transcripts (InSET), a method for detecting lentivirus integration sites within a lentivirus-based insertional mutagenesis cell library.

The extent of functional sequences within the human genome is a pivotal yet debated topic in biology. Although high-throughput reverse genetic screens ...

identification-functionally-relevant-lentivirus-integration-sites-an

Research

JoVE Journal

Genetics

We describe a protocol for amplifying retroviral integration sites from the genomic DNA of infected cells, sequencing the amplified virus-host junctions, and then mapping these sequences to a reference genome. We also describe techniques to quantify the distribution of integration sites relative to various genomic annotations using BEDTools.

Amplification, Next-generation Sequencing, and Genomic DNA Mapping of Retroviral Integration Sites

This manuscript describes the experimental procedure and software analysis for a bidirectional integration site assay that can simultaneously analyze upstream and downstream vector-host junction DNA. Bidirectional PCR products can be used for any downstream sequencing platform. The resulting data are useful for a high-throughput, quantitative comparison of integrated DNA targets.

Bidirectional Retroviral Integration Site PCR Methodology and Quantitative Data Analysis Workflow

Here, we describe a protocol for genome-wide mapping of the integration sites of Moloney murine leukemia virus-based retroviral vectors in human cells.

Retroviral Scanning: Mapping MLV Integration Sites to Define Cell-specific Regulatory Regions

We describe the production strategy of integrase-deficient lentiviral vectors (IDLVs) as vehicles for delivering CRISPR/Cas9 to cells. With an ability to mediate quick and robust gene editing in cells, IDLVs present a safer and equally effective vector platform for gene delivery compared to integrase-competent vectors.

A Protocol for the Production of Integrase-deficient Lentiviral Vectors for CRISPR/Cas9-mediated Gene Knockout in Dividing Cells

We present a genome engineering workflow for the generation of new in vitro models for HIV-1 infection that recapitulate proviral integration at selected genomic sites. Targeting of HIV-derived reporters is facilitated by CRISPR-Cas9-mediated, site-specific genome manipulation. Detailed protocols for single-cell clone generation, screening, and correct targeting verification are provided.

CRISPR-Cas9-based Genome Engineering to Generate Jurkat Reporter Models for HIV-1 Infection with Selected Proviral Integration Sites

Genetically-encoded histone-miniSOG induces genome-wide heritable mutations in a blue light-dependent manner. This mutagenesis method is simple, fast, free of toxic chemicals, and well-suited for forward genetic screening and transgene integration.

Optogenetic Random Mutagenesis Using Histone-miniSOG in C. elegans

A strategy for generating mutations in histone genes at their endogenous location in Saccharomyces cerevisiae is presented.

Targeted in Situ Mutagenesis of Histone Genes in Budding Yeast

Methods for generating large-scale gRNA libraries should be simple, efficient and cost-effective. We describe a protocol for the production of gRNA libraries based on enzymatic digestion of target DNA. This method, CORALINA (comprehensive gRNA library generation through controlled nuclease activity) presents an alternative to costly custom oligonucleotide synthesis.

A Universal Protocol for Large-scale gRNA Library Production from any DNA Source

The clustered regularly interspaced short palindromic repeats/CRISPR associated protein 9 (CRISPR/Cas9) system provides a promising tool for genetic engineering, and opens up the possibility of targeted integration of transgenes. We describe a homology-mediated end joining (HMEJ)-based strategy for efficient DNA targeted integration in vivo and targeted gene therapies using CRISPR/Cas9.

CRISPR/Cas9-mediated Targeted Integration In Vivo Using a Homology-mediated End Joining-based Strategy

This article describes a detailed methodology for random mutagenesis of a target gene in fission yeast. As an example, we target rpt4+, which encodes a subunit of the 19S proteasome, and screen for mutations that destabilize heterochromatin.

Gene-targeted Random Mutagenesis to Select Heterochromatin-destabilizing Proteasome Mutants in Fission Yeast

Discover the InSET method for identifying functional genomic elements using lentivirus integration sites in a cell library. This approach reveals novel exons in protein-coding and non-coding regions.

Identification of Functionally-Relevant Lentivirus Integration Sites in an Insertional Mutagenesis Cell Library

Explore More Videos