A subscription to JoVE is required to view this content. Sign in or start your free trial.

Method Article

Investigating the Mechanism of β-Elemene-Mediated LINC00511 Modulation to Suppress Cisplatin Resistance in Lung Cancer

663 views

⸱

DOI:

10.3791/68825

⸱

August 19th, 2025

In This Article

Summary

Cisplatin (DDP) resistance limits chemotherapy efficacy in lung cancer. This study aimed to elucidate how β-Elemene(β-Ele) reverses resistance in A549/DDP cells by downregulating LINC00511. In vitro and RNA-seq analyses showed that this regulation inhibits aerobic glycolysis and Wnt/β-catenin signaling, offering a potential strategy to overcome chemoresistance.

Abstract

Cisplatin resistance significantly limits the efficacy of chemotherapy in non-small cell lung cancer, necessitating the development of new strategies to overcome this barrier. This in vitro study aimed to elucidate the mechanism by which β-Ele reverses cisplatin resistance in lung adenocarcinoma cells via the LINC00511-mediated glycolysis and Wnt/β-catenin signaling pathways. The cisplatin-resistant human lung adenocarcinoma cell line (A549/DDP), with either LINC00511 overexpression or knockdown, was established through plasmid transfection. The transfection efficiency was evaluated using Quantitative Reverse Transcriptase Polymerase Chain Reaction (qRT-PCR) to detect LINC00511 expression levels. Assessment via the 5-ethynyl-2'-deoxyuridine (EdU) assay indicated significant β-Ele-mediated inhibition of A549/DDP cell proliferation. Further RNA-seq analysis revealed that the inhibitory effect of β-Elemene on cisplatin resistance was closely associated with the interference of cellular glycolysis and the suppression of Wnt/β-catenin signaling pathway activation. Western blot analysis of key proteins, including glucose transporter 1 (GLUT1), pyruvate kinase M2 (PKM2), lactate dehydrogenase A (LDHA), β-catenin, and glycogen synthase kinase 3β (GSK-3β), showed that β-Elemene reversed cisplatin resistance by inhibiting aerobic glycolysis and blocking the activation of the Wnt/β-catenin signaling pathway through downregulation of LINC00511. Collectively, these results demonstrate that β-Elemene overcomes cisplatin resistance in lung cancer by targeting LINC00511 and its associated aerobic glycolysis/Wnt/β-catenin pathway. This establishes a theoretical framework for future preclinical and clinical investigations while revealing potential therapeutic targets.

Introduction

Among malignant tumors worldwide, lung cancer exhibits exceptionally high incidence and fatality rates, characterized by the malignant transformation and invasive growth of bronchial epithelial cells1,2. Based on histopathological features, lung cancer is categorized as either non-small cell carcinoma (NSCLC) or small cell carcinoma (SCLC)3. It is worth mentioning that NSCLC represents roughly 85% of total lung cancer cases4,5. As a first-line chemotherapeutic standard for NSCLC, cisplatin (DDP) is clinically indispensable6. However, clinical observations have revealed that tumor cells can develop drug resistance via multiple mechanisms, primarily involving the activation of immune escape pathways, mutations in drug target genes, and dysregulation of drug metabolism pathways7,8,9.

Long non-coding RNAs (lncRNA) represent transcripts > 200 nucleotides (nt) that lack protein-coding capacity10. Accumulating evidence indicates that lncRNA can reverse cisplatin resistance in tumor cells through multiple mechanisms, such as functioning as competing endogenous RNAs (ceRNAs) to sponge miRNAs and release their target genes11, modulating apoptosis signaling pathways12, participating in DNA damage repair13, and regulating cellular autophagy14. Furthermore, with the advancement of research on tumor metabolic reprogramming, substantial evidence has emerged demonstrating that lncRNA play a critical regulatory role in this process. The Warburg effect, denoting aerobic glycolysis, constitutes a fundamental metabolic characteristic of malignant cells15. It not only supplies energy for rapid cell proliferation but also generates intermediate metabolites that serve as precursors for biosynthesis, supporting protein and lipid synthesis to meet the demands of malignant tumor growth16. In lung cancer, it has been confirmed that lncRNA significantly influences tumor progression and chemotherapy resistance by regulating the aerobic glycolysis pathway17,18.

Among these, LINC00511, a widely studied lncRNA molecule in recent years, has been reported to be closely associated with the initiation and development of various malignant tumors19. These findings not only elucidate the specific mechanisms of lncRNA involvement in tumor metabolic reprogramming but also provide a theoretical basis for lncRNA-targeted tumor treatment strategies, opening up potential therapeutic avenues.

Derived from the rhizomes of Curcuma zedoaria, β-Ele is a bioactive sesquiterpenoid with established antitumor efficacy. Our previous studies have demonstrated that β-Ele serves as a selective inhibitor of the PI3K/Akt/mTOR signaling pathway and produces a synergistic effect with cisplatin by targeting tumor metabolism. It significantly suppressed tumor growth in the NSCLC mouse xenograft model20. Subsequent investigations demonstrate β-Ele's capacity to attenuate aerobic glycolysis in NSCLC cells via modulation of the miR-301a-3p/AMPKα signaling axis, resulting in oncostatic outcomes21. Based on our previous findings, we have confirmed that LINC00511 attenuates cisplatin resistance in lung cancer; nevertheless, the exact molecular mechanism of action remains to be fully elucidated.

Considering the pivotal role of aerobic glycolysis in tumor metabolic reprogramming and the critical role of LINC00511 in tumor development and progression, this study aims to investigate whether β-Ele can reverse cisplatin resistance in lung cancer by modulating the LINC00511-mediated aerobic glycolysis pathway.

Prior evidence indicates β-Ele can reverse cisplatin resistance and enhance its anti-tumor effects by activating apoptotic pathways22, regulating exosome secretion23, and arresting the cell cycle24. However, these known mechanisms typically exhibit broad effects and lack precise regulation of specific molecular targets, thereby limiting their clinical translatability. Therefore, there is an urgent need to explore novel strategies that are more targeted, have well-defined mechanisms, and demonstrate strong potential for clinical translation to overcome cisplatin resistance. In contrast to prior research emphasizing β-Ele's immediate biological actions, this study characterizes the impact of β-Ele on Warburg metabolism and the Wnt/β-catenin signaling pathway in A549/DDP cells through the regulation of lncRNA-mediated molecular pathways, aiming to elucidate a novel mechanism underlying its reversal of chemosensitization in lung cancer. This article not only uncovers a new approach for β-Ele to reverse chemoresistance by targeting lncRNA but also provides a fresh theoretical foundation and potential intervention targets for the clinical management of lung cancer. These findings, through their detailed elucidation of a specific molecular target (LINC00511) and key signaling pathways (Warburg and Wnt/β-catenin), demonstrate significantly enhanced clinical translational potential. They are expected to provide a solid scientific basis for improving chemotherapy sensitivity in lung cancer patients and enhancing their quality of life, as well as to advance the development of precision treatment strategies for lung cancer.

Access restricted. Please log in or start a trial to view this content.

Protocol

1. Solvent preparation

  1. Preparation of Medium Solution for A549/DDP cells: Cultivate A549/DDP cells in Ham's F-12K complete medium (see Table of Materials for details), supplemented with 10% fetal bovine serum (FBS, see Table of Materials for details), 1% penicillin-streptomycin solution (P/S, see Table of Materials for details), and 2 μg/mL cisplatin (DDP, see Table of Materials for details).
    1. Preparation of Complete Medium Solution: Prepare a complete medium solution by adding 50 mL of FBS and 5 mL of P/S to 500 mL of Ham's F-12K medium, followed by thorough mixing.
    2. Preparation of Complete Medium Solution Containing Cisplatin: Weigh 1 mg of cisplatin powder (DDP, see Table of Materials for details) and dissolve it in 1 mL of double-distilled water (ddH2O) to prepare the stock solution. Add 200 μL of the stock solution to 100 mL of complete medium (prepared according to step 1.1.1) and mix thoroughly to prepare a working solution of complete medium containing 2 μg/mL of cisplatin.
      NOTE: Since cisplatin is a cytotoxic substance, perform all procedures in a fume hood or biosafety cabinet and wear protective equipment such as gloves, lab coats, and goggles.
  2. β-Ele administration solution: The drug concentration used in this study was based on the results of previous experiments conducted by our research team20,21. Dissolve 1 mg of β-Ele (see Table of Materials for details) in 20 μL of dimethyl sulfoxide (DMSO, see Table of Materials for details) to prepare the stock solution. Dilute the stock solution to 25 mL using complete medium to obtain a 40 μg/mL β-Ele working solution.
    NOTE: Since DMSO can enhance the absorption of other substances through the skin, perform all operation steps in a fume hood or biosafety cabinet and wear protective equipment such as gloves, laboratory clothing, and goggles.

2. Cell culture 

  1. Use the human lung adenocarcinoma cisplatin-resistant cell line (A549/DDP, Procell, see Table of Materials for details) in this study. Confirm that this cell line has been identified by short tandem repeat (STR) analysis and successfully matched to standard lineages in ATCC and other databases.
    1. For the STR analysis method, collect approximately 1 x 106 cells, and extract genomic DNA using a commercial DNA extraction kit (see Table of Materials for details).
    2. Employ a validated multiplex STR system suitable for DNA typing to amplify 20 STR loci along with the gender-determining locus. Perform PCR amplification under the following thermal cycling conditions: initial denaturation at 95 °C for 2 min, followed by 29 cycles of denaturation at 94 °C for 30 s, annealing at 59 °C for 45 s, and extension at 72 °C for 45 s, with a final extension step at 72 °C for 10 min.
    3. Analyze the resulting PCR products via capillary electrophoresis using an automated genetic analyzer according to manufacturer instructions. Here, allele typing was conducted using a fragment analysis software (see Table of Materials for details), with a peak detection threshold set at 150 Relative Fluorescence Units (RFU).
      NOTE: The generated 20-locus STR profile was compared against reference profiles of A549/DDP cell lines available in public databases. A match rate exceeding 80% was considered indicative of homology. The absence of extraneous allele peaks further confirmed the absence of cross-contamination.
  2. Retrieve the cells from liquid nitrogen and place them in a 37 °C water bath for rapid thawing until the liquid is completely melted. Transfer the cell suspension to a 5 mL centrifuge tube, add two volumes of complete medium solution, and gently resuspend the mixture. Following centrifugation (358 × g, 5 min, room temperature), discard the supernatant carefully.
    NOTE: When using cell cryopreservation tubes from liquid nitrogen, wear anti-freezing gloves and either goggles or a face mask, and do not face the tube mouth. 
  3. Resuspend the cell pellet in 1 mL of complete medium with gentle pipetting, then dilute the suspension to 10 mL by adding 9 mL of complete medium. Seed the cells into 100 mm cell culture dishes and culture them in an incubator (see Table of Materials for details) at 37 °C and 5% CO2. The cell passage ratio was maintained between 1:2 and 1:3.
    NOTE: Cisplatin is a platinum chemotherapeutic drug with cytotoxicity. In this method, A549/DDP cells are cultured with medium containing cisplatin. Therefore, collect the waste culture medium containing cisplatin into a special waste liquid barrel and regularly send it to the hazardous waste treatment company for professional disposal.

3. Plasmid transfection 

  1. Employ a plasmid construct for LINC00511 overexpression and a gene-specific siRNA targeting LINC00511 (gene ID: 400619; transcript ID: NR_033876.1) for cell transfection. The utilized siRNA sequences are provided in Table 1.
 siRNA sequences
NameSense 5'-3'Antisense 5'-3'
LINC00511-Homo-1625
CAGCUGUGAACUUCCUUUATT
UAAAGGAAGUUCACAGCUGTT

Table 1: siRNA sequence list

  1. Randomly select A549/DDP cells that have been passaged to the third generation after resuscitation, and uniformly inoculate them into 6-well plates at a density of 1 x 105 cells/well. Each well was randomly numbered, and the wells were assigned to experimental groups based on these random numbers.
  2. Transfect the cells using a transfection reagent (see Table of Materials for details)  when their density reaches approximately 70%.
    1. Prepare the siRNA transfection solution.
      1. Mix 250 μL of Optimized Minimum Essential Medium (Opti-MEM, see Table of Materials for details) with 5 μL of transfection reagent, gently vortex 3–5x to ensure homogeneity, and incubate at room temperature for 5 min.
      2. Dilute 5 μL of siRNA (50 nM) in 250 μL of Opti-MEM, vortex gently 3–5x to mix thoroughly. Combine the diluted transfection reagent with the siRNA solution and incubate at room temperature for 20 min to form the siRNA transfection complex.
    2. Prepare the plasmid transfection solution.
      1. Mix 250 μL of Opti-MEM with 5 μL of transfection reagent, gently vortex 3–5x to ensure homogeneity, and incubate at room temperature for 5 min.
      2. Dilute 2 μg of plasmid in 250 μL of Opti-MEM, gently vortex 3–5x to ensure thorough mixing. Combine the diluted transfection reagent with the plasmid solution and incubate at room temperature for 20 min to prepare the plasmid transfection solution.
      3. Add the siRNA transfection solution and plasmid transfection solution to the 6-well plates, respectively. Add 1,500 μL of complete medium to each well. Gently mix the cell plates before and after the addition to ensure even distribution. Incubate the plates at 37 °C, 5% CO2 for 24 h post-transfection prior to analysis.

4. Detecting the transfection efficiency by Quantitative Reverse Transcriptase Polymerase Chain Reaction (qRT-PCR)

NOTE: Take the cells after transfection for 24 h in step 3.3 for qRT-PCR detection according to the following procedure. All experiments were performed in three independent biological replicates (n = 3).

  1. RNA extraction 
    1. Use an ultrapure RNA extraction kit (see Table of Materials for details). Discard the medium in the 6-well plate according to the kit instructions and wash the cells with PBS. Subsequently, add 500 μL of phenol–guanidine-based lysis reagent solution to each well, gently blow the cells with the tip of the gun to fully suspend them, and transfer the mixture to a centrifuge tube. Leave it for 5 min to ensure complete lysis of the cell sample.
    2.  Add 100 μL of phenol-guanidine isothiocyanate lysis reagent, shake sharply for 15 s, and leave it for 2 min at room temperature. Finally, carefully aspirate the upper aqueous phase, transfer it to the adsorption column, and centrifuge at 13,400 x g for 10 min at 4 °C.
    3. Bind RNA to the silica gel membrane. Wash it with Buffer RW1 and Buffer RW2 to remove proteins. Subsequently, add DNase I to digest residual DNA and perform a secondary wash with Buffer RW2 to ensure complete removal of impurities. Finally, collect RNA samples by eluting RNA with RNase-free water and centrifuging at 13,400 x g for 1 min.
  2. Measure the RNA concentration.
    1. Place each 1.5 μL of sample RNA solution in a micro nucleic acid detector (see Table of Materials for details) and read the A260/A280 values.
      NOTE: If the measured A260/A280 values are within the range of 1.8 to 2.0 and the RNA concentration is between 20 ng/μL and 200 ng/μL, this indicates that the RNA quality is acceptable and can be used for subsequent experiments.
    2. Based on the measurements, dilute the RNA solution with Diethyl Pyrocarbonate (DEPC) water to ensure consistent RNA concentrations for all samples, using the measured minimum RNA concentration as a benchmark, followed by PCR experiments.
  3. Reverse transcription of RNA
    1. Use the extracted total RNA as a template and synthesize cDNA according to the reverse transcription kit instructions (see Table of Materials for details). Prepare the reaction system according to the kit requirements.
    2. Add the extracted RNA solution and the reaction system to an eight-row tube, and set two replicate wells in each group. Initiate the reaction with sequential conditions: 15 min incubation at 37 °C, 5 s heat denaturation at 85 °C, 5 min cooling at 4 °C.
  4. PCR reaction
    1. Conduct PCR amplification on a real-time fluorescence quantitative PCR system (see Table of Materials for details) using the SYBR Green-based premixed PCR master mix (see Table of Materials for details). Use GADPH as the reference gene, with primer sequences listed in Table 2, and prepare the reaction mixture as follows: sequentially add 0.4 μL of the corresponding primer, 2 μL of cDNA template, and the reaction mixture to an eight-well strip tube to achieve the final reaction volume.
    2. Run PCR amplification: 95 °C 30 s (1 cycle), 95 °C 5 s (40 cycles), 60 °C 20 s (40 cycles). Calculate the relative expression levels of target genes using the 2 -ΔΔCt method25. Independently repeat all experiments three times to ensure the reliability of the data. 
      NOTE: Chemical waste generated during experimental procedures must be collected in designated hazardous waste containers and disposed of by certified hazardous waste management services in accordance with institutional policies.
Primer sequences
PrimerSequence(5'-3')
human-LINC00511-FTTTCCCAGCACAGCTCAATC
human-LINC00511-RTCCCTTCTCCCTCGGTCA
GAPDH-FAATCCCATCACCATCTTCCA
GAPDH-RAAATGAGCCCCAGCCTTCT

Table 2: Primer sequences for PCR assays

5. EdU detection

  1. Evaluate the effect of altered LINC00511 expression on the proliferation of A549/DDP cells using an EdU assay kit (see Table of Materials for details).
    1. Randomly select A549/DDP cells that have been passaged to the third generation after resuscitation, and uniformly inoculate them into 24-well plates at a density of 2 x 104 cells/well.
      NOTE: Here, all experiments were performed in three independent biological replicates (n = 3).
    2. Randomly number each well, and assign the wells to one of four experimental groups based on these random numbers: Control group, β-Ele group, β-Ele + LINC00511 overexpression (β-Ele + OV-LINC00511) group, and β-Ele + LINC00511 knockdown (β-Ele + si-LINC00511) group.
  2. When the cell density reaches approximately 70%, perform plasmid transfection and interference treatment according to step 3.3. After 24 h of transfection, discard the original medium and add 1 mL of medium solution containing β-Ele (40 μg/mL) to each well of the drug treatment group.
  3. Incubate the cells with EdU for labeling after treating them with 40 μg/mL of β-Ele for 24 h. Then fix the cells with 4% paraformaldehyde for 10 min and permeabilize them with 0.5% Triton X-100.
  4. Add the click reaction solution (prepared by dissolving one vial of the kit-provided Click Additive reagent in 1.3 mL of deionized water with thorough mixing) in the dark and maintain the reaction in the dark for 30 min. Wash the cells with PBS after the reaction is complete, followed by Hoechst staining for 5 min. Finally, observe the results using fluorescence microscopy (Figure 1 and Figure 2).
    NOTE: DMSO is highly permeable and a flammable liquid. In this scheme, the β-Ele administration solution contains DMSO. Therefore, collect the β-Ele administration solution into a special waste liquid barrel after use and hand it to the hazardous waste treatment company for professional disposal on a regular basis.

6. Glucose content detection 

NOTE: All experiments were performed in three independent biological replicates (n = 3).

  1. Randomly select A549/DDP cells that have been passaged to the third generation after resuscitation, and uniformly inoculate them into 6-well plates at a density of 1 x 105 cells/well. Randomly number each well, and assign the wells to experimental groups based on these random numbers.
  2. When the cell density reaches approximately 70%, proceed with plasmid transfection and interference as described in step 3.3. After 24 h of transfection, treat the cells in the treated groups with 40 μg/mL of β-Ele.
  3. After 24 h of drug treatment, collect the upper culture medium from the cells and centrifuge it at 1000 × g for 5 min. Collect the supernatant. According to the instructions in the glucose test kit (see Table of Materials for details), prepare the reaction solution and mix it thoroughly with the supernatant.
  4. Place the samples into 96-well plates with five replicate wells per group. Gently shake the plates and incubate them at 37 °C for 10 min. Measure the absorbance of each well using a microplate reader at a wavelength of 505 nm, and calculate the glucose content using the provided formula in the test kit:
    Glucose concentration equation formula, used in biochemical analysis and spectroscopy.
    Here, Cstandard = 5.55 mmol/L, N = Dilution factor.
    NOTE: Chemical waste generated during experimental procedures must be collected in designated hazardous waste containers and disposed of by certified hazardous waste management services in accordance with institutional policies.

7. Lactic acid content detection 

NOTE: All experiments were performed in three independent biological replicates (n = 3).

  1. Randomly select A549/DDP cells that have been passaged to the third generation after resuscitation, and uniformly inoculate them into 6-well plates (1 × 105 cells/well). Randomly number each well, and assign the wells to experimental groups based on these random numbers. When the cell density reaches approximately 70%, proceed with plasmid transfection and interference as described in step 3.3. 24 h after transfection, treat the cells in the treated groups with 40 μg/mL of β-Ele.
  2. After 24 h of drug treatment, collect the upper culture medium from the cells and centrifuge it at 1000 x g for 5 min. Collect the supernatant. According to the instructions in the lactic acid test kit (see Table of Materials for details), prepare the reaction solution and mix it thoroughly with the supernatant.
  3. Add a total of 250 μL of sample to each well of a 96-well plate, setting five replicate wells for each group. Gently shake the plate and incubate it at 37 °C for 10 min. Measure the absorbance of each well at a wavelength of 530 nm using a microplate reader (see Table of Materials for details), and calculate the lactate content using the provided formula in the test kit:
    Lactic acid calculation formula; absorbance equation for concentration analysis.
    Here, Cstandard =3 mmol/L, N = Dilution factor.
    NOTE: Chemical waste generated during experimental procedures must be collected in designated hazardous waste containers and disposed of by certified hazardous waste management services in accordance with institutional policies. 

8. Bulk RNA-seq

  1. Establish a sample database
    1. Select A549/DDP cells for the experiment and divide them into the following groups: Control group, DDP group, β-Ele (40 μg/mL) + DDP (48 μM) group, β-Ele+ DDP + OV-LINC00511 group and β-Ele + DDP +si-LINC00511 group. Include 3 samples in each group.
    2. Extract total RNA from each cell group. Use a magnetic bead-based mRNA isolation kit (see Table of Materials for details) to enrich eukaryotic mRNA, in which Oligo(dT)-coated beads selectively bind to the poly(A) tails of mRNA via A-T base pairing. Add fragmentation buffer (1 μL/μg of RNA, see Table of Materials for details) and incubate at 94 °C for 7 min to fragment the mRNA into short segments.
    3. Proceed with first-strand cDNA synthesis using random hexamer primers according to the manufacturer's instructions. For second-strand cDNA synthesis, add appropriate amounts of reaction buffer, RNase H, and DNA polymerase I to complete the process.
    4. Perform end repair and A-tailing on double-stranded cDNA by incubation at 25 °C for 30 min (end repair), immediately followed by 72 °C for 30 min (A-tailing). Ligate sequencing adapters to the end-repaired fragments.
    5. Purify and size-select ligated products using carboxyl-modified magnetic silica beads (see Table of Materials for details). Finally, construct the sequencing library by PCR amplification.
    6. Following sample preparation, analyze the sequencing library on the DNBSEQ-T7 platform (see Table of Materials for details). Load the sample onto a Patterned Array microarray chip for sequencing.
      NOTE: The instrument collected, read, and identified optical signals using a high-resolution imaging system to determine the sequence information of individual bases. Subsequently, perform additional sequencing cycles to obtain the sequence of the following bases. After multiple cycles, the raw sequencing data were generated.
  2. Bioinformatics analysis 
    1. Sequence the samples on the machine to obtain the raw data, also known as the off-machine data. Further, process the sequencing data using fastp (v 0.21.0). Remove reads containing 3' adapter sequences and eliminate low-quality reads with an average quality score below Q20 as part of the primary filtering criteria. Conduct all downstream analyses based on the cleaned, high-quality data.
      NOTE: Conduct initial filtering of sequencing data using fastp. Refer to the official documentation for transcriptomic datasets (https://github.com/OpenGene/fastp#rna-seq-processing) for the specific command-line parameters.
    2. Use FastQC (v 0.12.0) to assess the quality of the cleaned sequencing data. The quality requirements are as follows: at least 90% of bases must have a quality score higher than Q20, and the percentage of remaining adapter sequences should not exceed 1%. Data that meet these criteria are considered qualified and can be used for downstream analysis.
      NOTE: Assess the quality of the cleaned sequencing data using FastQC, following the official guidelines (https://www.bioinformatics.babraham.ac.uk/projects/fastqc/).
  3. Gene expression analysis 
    1. Use DESeq2 software to perform differential expression analysis between the two comparison groups.
      1. First, input the data into the software to construct a DESeq DataSet. Then, filter out genes with a total count of fewer than 10 across all samples.
      2. Finally, conduct the differential gene analysis and extract the results. The conditions for screening differentially expressed genes are as follows: the fold change in expression |log2FoldChange| > 1, and the significance padj ≤ 0.05.
        NOTE: For detailed operation steps of DESeq2 software, please refer to the detailed steps on the official website: https://www.bioconductor.org/packages/release/bioc/html/DESeq2.html.

9. Detection of protein expression level changes by Western blot (WB) 

NOTE: All experiments were performed in three independent biological replicates (n = 3).

  1. Perform Western blotting to quantify cellular protein expression levels.
    1. Randomly select A549/DDP cells that have been passaged to the third generation after resuscitation, and uniformly inoculate them into 6-well plates at a density of 1 x 105 cells/well.
    2. Randomly number each well, and assign the wells to one of the six experimental groups based on these random numbers: Control, β-Ele, OV-LINC00511, si-LINC00511, β-Ele + OV-LINC00511, and β-Ele + si-LINC00511.
    3. When the cell density reaches approximately 70%, perform plasmid transfection and interference as described in step 3.3. After 24 h of transfection, expose the treatment group to β-Ele (40 μg/mL), while providing fresh medium to the control group. Culture both groups for an additional 24 h.
    4. Subsequently, collect cell pellets by centrifugation at 1675 × g for 5 min. Lyse each group of cells with 500 μL of RIPA lysis buffer containing 1 mM PMSF on ice for 30 min (see Table of Materials for details).
  2. Centrifuge the cell lysates at 13,400 × g for 10 min at 4 °C and collect the supernatant. Measure protein concentrations using the BCA Protein Concentration Assay Kit (see Table of Materials for details). Separate equal amounts of protein samples by 10% SDS-PAGE and transfer them to polyvinylidene fluoride (PVDF) membranes via electrophoresis.
  3. Immerse membranes in blocking solution (5% skim milk/Tris-buffered saline with 0.1% Tween-20 (TBST)) for 2 h at room temperature and incubate them overnight at 4 °C with primary antibodies against GLUT1, PKM2, LDHA, β-catenin, GSK-3β (1:1000), and β-Actin (1:2000, see Table of Materials for details).
    1. The next day, wash the membranes three times with TBST, 5 min each, at room temperature with gentle shaking.
  4. The next day, incubate the membranes with secondary antibody solutions (HRP-labeled goat anti-rabbit IgG, 1:2000) and shake gently at room temperature for 1 h.
  5. Finally, add 0.1 mL/cm2 of commercially available ECL chromogenic solution to fully cover the PVDF membranes. Incubate for 1 min at room temperature before exposure. Visualize and analyze the bands using an enhanced chemiluminescence system (see Table of Materials for details). Please refer to Figure 4C and Figure 5B.
    NOTE: Chemical waste generated during experimental procedures must be collected in designated hazardous waste containers and disposed of by certified hazardous waste management services in accordance with institutional policies.

10. Statistical anaysis 

NOTE: All experiments were performed in three independent biological replicates (n = 3).

  1. Organize the experimental data by group and input them into GraphPad Prism software (Version 8.0.2; see Table of Materials for details). Perform data visualization and statistical significance analysis in accordance with the software guidelines. Measurement data were expressed as mean ± standard deviation. Statistical differences between groups were assessed using One-way ANOVA with η² (eta-squared) effect size calculation, followed by Tukey's multiple comparisons test26. Consider **P < 0.01 as statistically significant.

Access restricted. Please log in or start a trial to view this content.

Results

β-Ele significantly suppresses the proliferation of A549/DDP cells

In this experiment, the administration concentrations of β-Ele and DDP were determined based on the results of our previous studies20,21. A549/DDP cells were treated with β-Ele, alone or combined with DDP, to dissect its impact on DDP chemoresistance. EdU analysis (Fi...

Access restricted. Please log in or start a trial to view this content.

Discussion

This study focused on the critical clinical issue of cisplatin resistance in lung cancer. Lung cancer, responsible for the highest number of cancer fatalities globally, continues to have a five-year survival rate below 20%29,30. Cisplatin, as the cornerstone of platinum-based chemotherapy drugs, is an efficient, broad-spectrum anticancer agent that inhibits DNA replication to exert its anticancer effects31. However, it has been observed th...

Access restricted. Please log in or start a trial to view this content.

Disclosures

All the authors have no conflicts of interest to declare.

Acknowledgements

Funding for this study was provided by the Jilin Provincial Natural Science Foundation under Award No. YDZJ202401058ZYTS.

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
A549/DDP cellsProcellCL-0519URLs:https://www.procell.com.cn/p/a549-ddp--cl-0519
An exceptionally clean workbenchSuzhou Antai AirtechSW-CJ-2FDURLs:http://www.sz-antai.com
BCA Protein concentration Assay kitSolarbioPC0020URLs:https://www.solarbio.com
Benchtop CentrifugeThermoPico17URLs:https://www.thermofisher.com
Cell culture chamberThermo3111URLs:https://www.thermofisher.com
Cell culture dishBIOFILTCD000100URLs:http://www.biofil.com.cn
Chemiluminescence AnalyzerQinxiang Instruments 4300URLs:https://www.clinx.cn/about_us
CisplatinAladdinC295225-250mgURLs:https://www.aladdin-e.com/
DNBSEQ-T7 Gene Sequencing InstrumentMGI Tech CO., LtdT7URLs:https://www.mgitech.cn/
EasyPure Micro Genomic DNA KitTransGen BiotechEE181-01URLs:https://www.transgen.com/
ECL chromogenic solutionSolarbioPE0010URLs:https://www.solarbio.com
EDU detection kitBeyotimeC0071SURLs:https://www.beyotime.com
Enzyme labeled instrumentDetie EquipmentHBS-1096AURLs:https://www.detiebio.cn/
Fetal bovine serum FBS)CLARKFB15015URLs:https://zn.clarkbio.com/
Frag/Prime Buffer Yeasen11277ESURLs:https://www.yeasen.com/products/detail/2151
GeneMapper Software 6ThermoVersion 6Fragment analysis software. URLs:https://www.thermofisher.cn/  
GenReader platformBeijing Yuewei Gene Technology Co., Ltd.https://yyigou.com/product/detail/0000037250.htmlAutomated genetic analyzer used for capillary electrophoresis
Glucose test kitJiancheng BioA154-1-1URLs:http://www.njjcbio.com
GLUT1 Polyclonal antibodyProteintech Group21829-1-APURLs:https://www.ptglab.com
GraphPad PrismGraphPad SoftwareVersion 8.0.2URLs:https://www.graphpad.com
GSK-3βAntibodyAffinityAF5016URLs:https://www.affbiotech.com
Ham's F-12KProcellPM150910URLs:https://www.procell.com.cn/
Hieff NGS DNA selection BeadsYeasen12601ESURLs:https://www.yeasen.com/products/detail/939
HieffNGS mRNA Isolation Master KitYeasen12603ZHURLs:https://www.yeasen.com/products/detail/1119
HRP labeled goat anti-rabbit IgGServicebioGB23303URLs:https://www.servicebio.cn
Lactate test kitJiancheng BioA019-2-1URLs:http://www.njjcbio.com
LDHA-Specific Polyclonal AntibodyProteintech Group19987-1-APURLs:https://www.ptglab.com
Light Cycler 96RocheLC96URLs:https://lifescience.roche.com
Lipofectamine 2000Invitrogen11668-019URLs:https://www.thermofisher.com/invitrogen
Opti-MEMGibco31985-070URLs:https://www.thermofisher.com/gibco
Penicillin-streptomycin(P/S)BiosharpBL505AURLs:https://www.biosharp.cn/
PKM2-specific Polyclonal AntibodyProteintech Group15822-1-APURLs:https://www.ptglab.com
PMSF BeyotimeST506URLs:https://www.beyotime.com
PrimeScript RT reagent Kit (Perfect Real Time)TaKaRaRR037AURLs:https://www.takarabio.com
RIPA lysateBeyotimeP0013BURLs:https://www.beyotime.com
Sequencing platformBGIDNBSEQ-T7URLs:https://www.bgi.com/global
TB Green Premix Ex TaqTaKaRaRR420AURLs:https://www.takarabio.com
Trace nucleic acid testerAosheng InstrumentNano-100URLs:http://www.hzaosheng.com
TRIzon PaICanvax BiotechCW0597SURLs:https://www.canvaxbiotech.com
TrypsinBiosharpBL501AURLs:https://www.biosharp.cn/
Ultrapure RNA Kit (DNase I)Canvax BiotechCW0597SURLs:https://www.canvaxbiotech.com
β-Actin AntibodyProteintech Group60008-1-IgURLs:https://www.ptglab.com
β-catenin Antibody AffinityDF6794URLs:https://www.affbiotech.com
β-ElemeneSigma63965-25MGURLs:https://www.sigmaaldrich.com

References

  1. Thandra, K. C., Barsouk, A., Saginala, K., Aluru, J. S., Barsouk, A. Epidemiology of lung cancer. Contemp Oncol (Pozn). 25 (1), 45-52 (2021).
  2. Huang, J., et al. Distribution risk factors, and temporal trends for lung cancer incidence and mortality: A Global Analysis. Chest. 161 (4), 1101-1111 (2022).
  3. Wang, H., Hu, Y., Lu, H., Wu, Z., Zhang, Y. Association between SOX gene family expression, DNA methylation, and miRNA regulation in lung adenocarcinoma progression. Discov Oncol. 16 (1), 188(2025).
  4. Sung, H., et al. Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 71 (3), 209-249 (2021).
  5. Qin, Z., et al. Phase separation of EML4-ALK in firing downstream signaling and promoting lung tumorigenesis. Cell Discov. 7 (1), 33(2021).
  6. Wang, X., Wang, H., Jiang, H., Qiao, L., Guo, C. Circular RNAcirc_0076305 promotes cisplatin (DDP) resistance of non-small cell lung cancer cells by regulating ABCC1 through miR-186-5p. Cancer Biother Radiopharm. 38 (5), 293-304 (2023).
  7. La Montagna, M., Ginn, L., Garofalo, M. Mechanisms of drug resistance mediated by long non-coding RNAs in non-small-cell lung cancer. Cancer Gene Ther. 28 (3-4), 175-187 (2021).
  8. Wu, S. G., Shih, J. Y. Management of acquired resistance to EGFR TKI-targeted therapy in advanced non-small cell lung cancer. Mol Cancer. 17 (1), 38(2018).
  9. Altorki, N. K., et al. The lung microenvironment: an important regulator of tumour growth and metastasis. Nat Rev Cancer. 19 (1), 9-31 (2019).
  10. Zhang, H., Wang, Y., Liu, X., Li, Y. Progress of long noncoding RNAs in anti-tumor resistance. Pathol Res Pract. 216 (11), 153215(2020).
  11. Li, H. Q., Fu, X. B., Guo, H. Y., Sun, Y., Wang, D., Zhang, Z. Z. Sevoflurane reverses cisplatin resistance in neuroblastoma cells through the linc00473/miR-490-5p/AKT1 axis. Saudi Medical Journal. 43 (11), 1209-1216 (2022).
  12. Guo, F., Cao, Z., Guo, H., Li, S. The action mechanism of lncRNA-HOTAIR on the drug resistance of non-small cell lung cancer by regulating Wnt signaling pathway. Exp Ther Med. 15 (6), 4885-4889 (2018).
  13. Ren, L., et al. The DDUP protein encoded by the DNA damage-induced CTBP1-DT lncRNA confers cisplatin resistance in ovarian cancer. Cell Death Dis. 14 (8), 568(2023).
  14. Chen, L., et al. H19/miR-107/HMGB1 axis sensitizes laryngeal squamous cell carcinoma to cisplatin by suppressing autophagy in vitro and in vivo. Cell Biol Int. 45 (3), 674-685 (2021).
  15. Peng, X., Li, S., Zeng, A., Song, L. Regulatory function of glycolysis-related lncRNAs in tumor progression: Mechanism, facts, and perspectives. Biochem Pharmacol. 229, 116511(2024).
  16. Kryczka, J., Kryczka, J., Czarnecka-Chrebelska, K. H., Brzeziańska-Lasota, E. Molecular mechanisms of chemoresistance induced by cisplatin in NSCLC cancer therapy. Int J Mol Sci. 22 (16), 8885(2021).
  17. Liu, J., Zhu, Y., Wang, H., Han, C., Wang, Y., Tang, R. LINC00629, a HOXB4-downregulated long noncoding RNA, inhibits glycolysis and ovarian cancer progression by destabilizing c-Myc. Cancer Sci. 115 (3), 804-819 (2024).
  18. Liao, M., et al. Targeting the Warburg effect: A revisited perspective from molecular mechanisms to traditional and innovative therapeutic strategies in cancer. Acta Pharm Sin B. 14 (3), 953-1008 (2024).
  19. Song, Z., Luo, J., Wu, M., Zhang, Z. linc00511 knockdown inhibits lung cancer progression by regulating miR-16-5p/MMP11. Crit Rev Eukaryot Gene Expr. 33 (7), 17-30 (2023).
  20. Cheng, G., et al. β-elemene suppresses tumor metabolism and stem cell-like properties of non-small cell lung cancer cells by regulating PI3K/AKT/mTOR signaling. Am J Cancer Res. 12 (4), 1535-1555 (2022).
  21. Li, L., et al. β-elemene suppresses Warburg effect in NCI-H1650 non-small-cell lung cancer cells by regulating the miR-301a-3p/AMPKα axis. Biosci Rep. 40 (6), BSR20194389(2020).
  22. Yao, C., Jiang, J., Tu, Y., Ye, S., Du, H., Zhang, Y. β-elemene reverses the drug resistance of A549/DDP lung cancer cells by activating intracellular redox system, decreasing mitochondrial membrane potential and P-glycoprotein expression, and inducing apoptosis. Thorac Cancer. 5 (4), 304-312 (2014).
  23. Song, H., et al. β-elemene ameliorates cisplatin resistance of gastric cancer via regulating exosomal METTL3-m6A-ARF6 axis. Cell Biochem Biophys. 83 (2), 2047-2058 (2025).
  24. He, J., et al. β-Elemene promotes ferroptosis and reverses radioresistance in gastric cancer by inhibiting the OTUB1-GPX4 interaction. Front Pharmacol. 15, 1469180(2024).
  25. Livak, K. J., Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 25 (4), 402-408 (2001).
  26. Yang, L., Tao, Y., Luo, L., Zhang, Y., Wang, X., Meng, X. Dengzhan Xixin injection derived from a traditional Chinese herb Erigeron breviscapus ameliorates cerebral ischemia/reperfusion injury in rats via modulation of mitophagy and mitochondrial apoptosis. J Ethnopharmacol. 288, 114988(2022).
  27. Zhang, Z., Zhang, Y., Qin, X., Wang, Y., Fu, J. FGF9 promotes cisplatin resistance in colorectal cancer via regulation of Wnt/β-catenin signaling pathway. Exp Ther Med. 19 (3), 1711-1718 (2020).
  28. He, J., et al. Sox2 inhibits Wnt-β-catenin signaling and metastatic potency of cisplatin-resistant lung adenocarcinoma cells. Mol Med Rep. 15 (4), 1693-1701 (2017).
  29. Bray, F., et al. Global cancer statistics 2022: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 74 (3), 229-263 (2024).
  30. Im, J. Y., et al. CYB5R3 functions as a tumor suppressor by inducing ER stress-mediated apoptosis in lung cancer cells via the PERK-ATF4 and IRE1α-JNK pathways. Exp Mol Med. 56 (1), 235-249 (2024).
  31. Manguinhas, R., et al. Impact of the APE1 Redox Function Inhibitor E3330 in non-small cell lung cancer cells exposed to cisplatin: Increased cytotoxicity and impairment of cell migration and invasion. Antioxidants (Basel). 9 (6), 550(2020).
  32. Jiang, L., et al. HCP5 is a SMAD3-responsive long non-coding RNA that promotes lung adenocarcinoma metastasis via miR-203/SNAI axis. Theranostics. 9 (9), 2460-2474 (2019).
  33. Singh, D., Assaraf, Y. G., Gacche, R. N. Long non-coding RNA mediated drug resistance in breast cancer. Drug Resist Updat. 63, 100851(2022).
  34. Sun, W., Zu, Y., Fu, X., Deng, Y. Knockdown of lncRNA-XIST enhances the chemosensitivity of NSCLC cells via suppression of autophagy. Oncol Rep. 38 (6), 3347-3354 (2017).
  35. Lu, Y., Tian, M., Liu, J., Wang, K. LINC00511 facilitates Temozolomide resistance of glioblastoma cells via sponging miR-126-5p and activating Wnt/β-catenin signaling. J Biochem Mol Toxicol. 35 (9), e22848(2021).
  36. Kong, X. Z., et al. Regulation of aerobic glycolysis by long non-coding RNAs in cancer. Biochem Biophys Res Commun. 479 (1), 28-32 (2016).
  37. Mao, Y., Xia, Z., Xia, W., Jiang, P. Metabolic reprogramming, sensing, and cancer therapy. Cell Rep. 43 (12), 115064(2024).
  38. Vaupel, P., Schmidberger, H., Mayer, A. The Warburg effect: essential part of metabolic reprogramming and central contributor to cancer progression. Int J Radiat Biol. 95 (7), 912-919 (2019).
  39. Ward, P. S., Thompson, C. B. Metabolic reprogramming: a cancer hallmark even warburg did not anticipate. Cancer Cell. 21 (3), 297-308 (2012).
  40. Nagao, A., Kobayashi, M., Koyasu, S., Chow, C. C. T., Harada, H. HIF-1-dependent reprogramming of glucose metabolic pathway of cancer cells and its therapeutic significance. Int J Mol Sci. 20 (2), 238(2019).
  41. Xie, Y., Wang, M., Xia, M., Guo, Y., Zu, X., Zhong, J. Ubiquitination regulation of aerobic glycolysis in cancer. Life Sci. 292, 120322(2022).
  42. Hua, G., Zeng, Z. L., Shi, Y. T., Chen, W., He, L. F., Zhao, G. F. LncRNA XIST contributes to cisplatin resistance of lung cancer cells by promoting cellular glycolysis through sponging miR-101-3p. Pharmacology. 106 (9-10), 498-508 (2021).
  43. Yin, D., Hua, L., Wang, J., Liu, Y., Li, X. Long Non-coding RNA DUXAP8 facilitates cell viability, migration, and glycolysis in non-small-cell lung cancer via regulating HK2 and LDHA by inhibition of miR-409-3p. Onco Targets Ther. 13, 7111-7123 (2020).
  44. Vallée, A. Aerobic glycolysis activation through canonical WNT/β-catenin pathway in ALS. Med Sci (Paris). 34 (4), 326-330 (2018).
  45. Rathee, M., et al. Canonical WNT/β-catenin signaling upregulates aerobic glycolysis in diverse cancer types. Mol Biol Rep. 51 (1), 788(2024).
  46. Li, R., Lv, M., Liu, J., Sun, Q. Tumor necrosis factor receptor-associated protein 1 promotes aerobic glycolysis and cisplatin resistance by regulating the Wnt/β-catenin signaling pathway in lung cancer. Histol Histopathol. , (2024).
  47. Zhao, Q., Chen, L., Zhang, X., Yang, H., Li, Y., Li, P. β-elemene promotes microglial M2-like polarization against ischemic stroke via AKT/mTOR signaling axis-mediated autophagy. Chin Med. 19 (1), 86(2024).
  48. Jiang, Z., Jacob, J. A., Loganathachetti, D. S., Nainangu, P., Chen, B. β-Elemene: mechanistic studies on cancer cell interaction and its chemosensitization effect. Front Pharmacol. 8, 105(2017).
  49. Li, J., Li, Y., Meng, F., Fu, L., Kong, C. Knockdown of long non-coding RNA linc00511 suppresses proliferation and promotes apoptosis of bladder cancer cells via suppressing Wnt/β-catenin signaling pathway. Biosci Rep. 38 (4), BSR20171701(2018).
  50. Tan, Z., et al. Small peptide LINC00511-133aa encoded by LINC00511 regulates breast cancer cell invasion and stemness through the Wnt/β-catenin pathway. Mol Cell Probes. 69, 101913(2023).
  51. Ghafouri-Fard, S., Safarzadeh, A., Hussen, B. M., Taheri, M., Ayatollahi, S. A. A review on the role of LINC00511 in cancer. Front Genet. 14, 1116445(2023).
  52. Liu, J., et al. Targeting Wnt-driven cancer through the inhibition of Porcupine by LGK974. Proc Natl Acad Sci U S A. 110 (50), 20224-20229 (2013).
  53. Wang, W. J., et al. Serum lncRNAs (CCAT2, LINC01133, LINC00511) with squamous cell carcinoma antigen panel as novel non-invasive biomarkers for detection of cervical squamous carcinoma. Cancer Manag Res. 12, 9495-9502 (2020).
  54. Fan, K., Liu, Z., Gao, M., Tu, K., Xu, Q., Zhang, Y. Targeting nutrient dependency in cancer treatment. Front Oncol. 12, 820173(2022).
  55. Liu, B., et al. Knockdown of LINC00511 decreased cisplatin resistance in non-small cell lung cancer by elevating miR-625 level to suppress the expression of leucine rich repeat containing eight volume-regulated anion channel subunit E. Hum Exp Toxicol. 41, 9603271221089000(2022).

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Tags

Beta-ElemeneWnt Beta-CateninAerobic GlycolysisA549 DDP CellsWestern BlotqRT-PCREdU Assay

This article has been published

Video Coming Soon