Name: Manipulation and Analysis of Cell Cycle-Dependent Processes in Budding Yeast (Video) | JoVE Journal
Uploaded: 2025-09-26T14:10:00.000+00:00
Duration: 8 min 13 s
Description: Learn cell cycle synchronization in Saccharomyces cerevisiae using alpha-factor arrest to study chromosome segregation and protein dynamics. This method enables precise observation of mitotic processes.

ai_agent_IP

ai_agent

maintenance

instantTrialDurationMinutes

isBiopharma

enableNewMyJoveSectionDesign

educationFeatures

seoMetaApi

ai_copilot_institution_blacklist

ai_chat_institution_blacklist

freeAccessWindow

ssoRoleCapture

scheduledMaintenanceBanner

joveLabsFeatures

disable_autoplay_for_bots

extended_trial_duration

5 minutes

We thank the University of Utah Cell Imaging Core for maintaining the Delta Vision microscope facility. This work was supported in part by NIH grants F31CA2717405 (to M.G.S) and T32GM141848 (to M.G.S. and T.C.S.), 5 For the Fight (to M.P.M.), Pew Biomedical Scholars (to M.P.M.), and NIH grant R35GM142749 (to M.P.M.).

1. Construction of strains for cell cycle analysis and imaging
<ol>
	<li>Design primers to C-terminally tag the gene of interest using Pringle Tagging Plasmids (pFA6a plasmids)24. In short, design F2 and R1 primers that, when used with a pFA6a-series plasmid, produce a PCR product that can be directly transformed into yeast to generate a &#39;tagged&#39; version of the gene of interest. Use the primer pairs and plasmids contained in Table 1 to tag the genes of interest in this protocol. Plasmid and primer design strategies for C-terminal tagging of yeast genes are described in detail by Longtine et al.24. 
	NOTE: This method can be used to produce fluorescently tagged proteins for imaging, or Auxin Inducible Degron (AID) tagged proteins to facilitate cell cycle arrest and other experiments enabled by degradation of a target protein18. For example, to tag CDC20 with the AID (IAA7) tag, the forward tagging primer consists of 25-40 bases of the CDC20 gene&#160;immediately before the stop codon, excluding the STOP codon (5&#39; TACAAGGAGGCCCTCTAGTAC 
	CAGCCAATATTTGATCAGG 3&#39;), and also the Pringle Plasmid F2 adapter sequence (5&#39; cggatccccgggttaattaa 3&#39;) appended to the 3&#39; end to produce the final primer sequence (5&#39; TACAAGGAGGCCCTCTAGTAC 
	CAGCCAATATTTGATCAGG cggatccccgggttaattaa 3&#39;). The reverse CDC20 tagging primer contains the reverse complement of the 25-40 base pairs immediately after the STOP codon (5&#39; ATTATATGCCTTGACATGAA 
	CTTTTATTTTTTTTATTTTA 3&#39;) and the Pringle Plasmid R1 adapter sequence (5&#39; gaattcgagctcgtttaaac 3&#39;) to produce the final primer sequence (5&#39; ATTATATGCCTTGACATGAACTTTTATT 
	TTTTTTATTTTA gaattcgagctcgtttaaac 3&#39;). It is also important to note that using PCR primers shorter than 40 base pairs will reduce the efficiency of integration into the yeast genome.</li>
	<li>Dilute primers in molecular biology grade water to 10 &#181;M.</li>
	<li>Perform PCR with the F2 and R1 plasmid pair and the appropriate tagging plasmid using standard methods, following the thermal cycler program contained in Table 2, then confirm the size of the PCR product by agarose gel electrophoresis.</li>
	<li>Inoculate the yeast strain to transform into 25 mL of Yeast extract Peptone Adenine Dextrose (YPAD) culture and grow overnight at 23 &#176;C. For constructing cdc20-AID yeast (that will degrade Cdc20 upon treatment with auxin), the transformed strain may either already contain OsTIR1 expressed from an ectopic locus, or OsTIR1 may be crossed in&#160;later18.</li>
	<li>The following morning, check the OD600 of the overnight culture. If culture OD &#60;2.0 proceed to step 1.6. If OD &#62; 2.0, dilute to ~0.2-0.4 and allow for 2-3 cycles of growth.</li>
	<li>Harvest cells at OD600 = ~0.4-2.0 to ensure they are in logarithmic growth phase. Harvest 5 ODs of cells per transformation (e.g., 5 mL of OD600 = 1.0). If doing more than one transformation of the same strain, cells can be combined at this stage. Harvest cells by centrifuging at 3,000 x g for 5 min at 23 &#176;C.</li>
	<li>Discard supernatant and wash the cell pellet with 25 mL of water, followed by centrifuging at 3,000 x g for 5 min at 23 &#176;C.</li>
	<li>Discard the supernatant and resuspend cells in 1 mL of 0.1 M Lithium Acetate (LiAc) and transfer to 1.6 mL tube(s). If doing more than one transformation, split the 1 mL resuspension into multiple tubes (e.g., for 2 transformations split 2x 500 &#181;L; for 3 transformations split 3x 333 &#181;L, etc.).</li>
	<li>Centrifuge cells at 1,000 x g for 2 min at 23 &#176;C and discard the supernatant.</li>
	<li>Add the following to the cell pellet (in this order): i) 240 &#181;L of PEG (50%), ii) 36 &#181;L of 1.0 M LiAc, iii) 20 &#181;L = 50 &#181;g of Salmon Sperm DNA pre-boiled for 5 min, iv) 54 &#181;L of water.</li>
	<li>Add 10 &#181;L of PCR product (obtained in step 1.3) to the cells and vortex for 1 min, ensuring everything is well mixed.</li>
	<li>Incubate cells at 30 &#176;C for 30 min in a roller drum in a warm room or a thermoshaker at 1000 rpm.</li>
	<li>Heat shock cells at 42 &#176;C for 15 min in a water bath. 
	NOTE: The optimal heat shock time might differ depending on the yeast strain background. This protocol is optimized for the W303 strain background.</li>
	<li>Centrifuge cells at 1,000 x g for 2 min at 23 &#176;C. Remove supernatant and gently resuspend in 100 &#181;L of water.</li>
	<li>For transformations using KanMX or other drug selection, plate cells on YPAD and incubate the plates at 23 &#176;C, then replica plate to drug plate the following day. 
	NOTE: Allowing a day of growth on YPAD is critical to allow for expression of drug resistance genes in transformed cells.</li>
	<li>For transformations using auxotrophic markers (URA, HIS, etc.), plate cells directly on selective medium.</li>
	<li>Incubate plates at 23 &#176;C for 3 days to allow the yeast transformant colonies to grow.</li>
	<li>Verify the correct tagging of the gene by genomic PCR or by western blotting. These methods are described in detail by Burnette25 and Chu et al26. 
	NOTE: For producing strains with multiple tagged alleles, repeated transformation is not recommended without back-crossing, as transformation can be a mutagenic process. To produce the strain containing Stu2-GFP and Spc110-mCherry, for instance, we recommend transforming strains separately to produce Stu2-GFP and Spc110-mCherry, then combining these alleles into one haploid strain by yeast cross, sporulation, tetrad dissection, and genotypic analysis. More information on yeast crosses is available from Stansfield and Stark27 and Morin et al.28. To perform an &#945;-factor arrest-release, the haploid strain utilized must be MATa.</li>
</ol>
2. Yeast culture and cell cycle synchronization: &#945;-factor arrest-release
<ol>
	<li>Inoculate yeast into 25 mL of YPAD culture overnight at 23 &#176;C, to be at OD600 = 0.5-2.0 the next morning.
	<ol>
		<li>If cells are above OD600 = 2.0 in the morning, dilute back to OD600 = 0.2-0.4 and let them grow for at least 1 cell cycle (2-3 h at 23 &#176;C).</li>
	</ol>
	</li>
	<li>Dilute cells back to OD600 = 0.5 and add &#945;-factor to a final concentration of 1 &#181;g/mL (stock 10 mg/mL in DMSO). Cells ideally would have a bar1 mutation (e.g. bar1-1), which renders them more sensitive to &#945;-factor. BAR1 wild type cells are less sensitive to &#945;-factor and require a concentration of &#945;-factor that is at least an order of magnitude higher to arrest properly, which is less economical.</li>
	<li>At 2.5-3.5 h post-arrest, check the degree of arrest by counting the percentage of non-budded shmooed cells. When 90-95% of cells are shmooed (arrested in G1), proceed to release. Timing will differ depending on the yeast strain, growth medium, and temperature.</li>
	<li>Release cells from &#945;-factor arrest by spinning down in centrifuge at 3,000 x g for 3-5 min at 23 &#176;C, and then pouring off supernatant.</li>
	<li>Wash cells by resuspending the pellet in 25 mL of YPAD + 1% DMSO.</li>
	<li>Repeat steps 2.4-2.5 twice for a total of three washes, changing the used tube once after the first wash.</li>
	<li>Add YPAD to cells to bring the final volume to 25 mL and transfer cells into a new flask. 
	NOTE: Using a new flask is critical to eliminate trace amounts of &#945;-factor left that might prevent the release.</li>
	<li>Take time point (0 min) sample and fix (see fixation instructions in steps 4.1 to 4.4).</li>
	<li>Continue taking time point samples every 15 min if growth takes place at 23 &#176;C. This timing will change at other temperatures based on how fast the cells grow.</li>
	<li>At time point 60 min, judge the synchrony of the release by checking for uniform small buds (bud size &#60; 25% mother cell size) under a light microscope.</li>
	<li>Optional) At 60 min post-release, add &#945;-factor again to a final concentration of 1 &#181;g/mL to prevent progression into the next cell cycle. Confirm synchronous cell release by verifying uniform small-budded morphology before addition.</li>
	<li>Continue taking time point samples up to 180 min, or as long as desired. At 23 &#176;C, metaphase occurs ~45-60 min post-release, anaphase occurs ~60-90 min post-release, and most cells will be in the new G1 by 120 min post-release.</li>
</ol>
3. Yeast culture and cell cycle synchronization: Cdc20 depletion arrest-release
<ol>
	<li>Inoculate an overnight culture of yeast at 23 &#176;C to be at an OD600 = 0.5-2.0 the next morning.
	<ol>
		<li>If cells are above OD600 = 2.0 the next morning, dilute back to OD600 = 0.2-0.4 and let them grow for at least 1 cell cycle (2-3 h at 23 &#176;C).</li>
	</ol>
	</li>
	<li>Dilute back to OD600 = 0.5 and add auxin to a final concentration of 500 &#181;M from 1 M stock (500x) to all cultures. For cultures receiving other drugs (nocodazole), add them concurrently with auxin at the appropriate concentration (e.g., ~10 &#181;g/mL nocodazole).</li>
	<li>At 2 h post-arrest, check the degree of arrest by counting the percentage of large-budded cells (large-budded is determined as the presence of bud &#62; 25% mother cell size). When 90-95% of cells are arrested in mitosis, proceed to either collecting samples or releasing cells from arrest, depending on the experimental application. If 90% of cells are not arrested, allow the culture to continue growing, and check it every 15-30 min. Timing will differ depending on the yeast strain, growth medium, and temperature. 
	NOTE: It is not advisable to allow arrests to proceed for too long (greater than 4 h) if releasing, as prolonged arrests may reduce cell viability.</li>
	<li>To release from Cdc20 depletion arrest, harvest culture by centrifugation at 3000 x g for 3-5 min at 23 &#176;C.</li>
	<li>Wash cells by resuspending the pellet in 25 mL of YPAD + 1% DMSO, then harvesting by centrifugation at 3,000 x g for 3-5 min at 23 &#176;C.</li>
	<li>Repeat steps 3.4-3.5 for a total of 2 washes.</li>
	<li>Add YPAD to cells to bring the final volume to 25 mL and transfer the cells to a new flask. 
	NOTE: Using a new flask is critical to remove trace amounts of auxin that might prevent a release.</li>
	<li>Take time point 0 and fix (see fixation instructions in steps 4.1 to 4.4).</li>
	<li>Continue taking timepoints every 10-15 min for the desired length of the time course. At 23 &#176;C, most cells would have released from the arrest after 50-70 min. 
	NOTE: Cells do not release as synchronously from this Cdc20 depletion arrest as they do with &#945;-factor arrest. However, it can be useful to study anaphase or mitotic exit events. Additionally, a technical limitation of this arrest-release is that in later time points after the release, it is more difficult to differentiate between metaphase cells that have not yet released and the cells that released earlier and have reached the metaphase of their next cell cycle. If needed, this can be overcome by either doing live cell imaging to track individual cells as they release from the arrest or by adding &#945;-factor to the culture (assuming the cells are MATa) to arrest cells in G1 after mitotic exit.</li>
</ol>
4. Yeast fixation
<ol>
	<li>Centrifuge 1 mL (or 0.5-1.5 ODs) of culture for 1 min at max speed (~20,000 x g) at 23 &#176;C.</li>
	<li>Aspirate off supernatant and resuspend cells in 500 &#181;L of fixative solution (3.7% formaldehyde in 0.1 M potassium phosphate (KPi) pH 6.4).</li>
	<li>Incubate cells in the fixative solution for 2-15 min at 
	23 &#176;C. For time course experiments, it is generally advisable to fix cells for 15 min to align the timing of centrifuging cells when taking samples. 
	NOTE: Fixation timing should be optimized for specific fluorophores and proteins of interest.</li>
	<li>Centrifuge cells for 1 min at max speed at 23 &#176;C, aspirate off supernatant, and resuspend in 500 &#181;L of 0.1 M KPi (pH 6.4). Cells in KPi can be stored at 4 &#176;C until ready to image. 
	NOTE: Fixed cell fluorescence signal can last for up to 2 weeks, depending on the fluorophore, however, for quantification of fluorescent signals, collect images within 7 days.</li>
</ol>
5. Preparing slides for imaging
<ol>
	<li>When prepared to image, centrifuge cells for 1 min at max speed at 23 &#176;C and discard supernatant. Resuspend cells in 10-100 &#181;L of Triton/DAPI/sorbitol solution (1.2 M sorbitol, 1% triton, 0.1 M KPi, pH 7.5, 2 &#181;g/mL DAPI).</li>
	<li>Pipette ~0.8 &#181;L of cells directly onto a clean coverslip. Use a pipette tip to gently spread the cell droplet into an approximately 1 cm2 circle in the center of the coverslip.</li>
	<li>Place the coverslip onto a microscopy slide. Use a Kimwipe to gently press around the slide to distribute the sample.</li>
	<li>Seal the edges of the coverslip with nail polish.</li>
	<li>Optionally store in a cool dark location for up to 4-6 h before imaging to help cells settle and prevent excess motion.</li>
</ol>
6. Imaging
<ol>
	<li>Take slide to a microscope equipped with a 60x/1.42 oil objective and a Red, Green, Blue, Far Red laser and filter set. Higher magnification objectives (up to 100x) can also be used.</li>
	<li>Focus the microscope on the yeast cells adhered to the coverslip. 
	NOTE: If yeast cells are moving too much, slides may be left in a cool dark location for 20-60 min to settle.</li>
	<li>Once the yeast are in focus, tune exposure settings of each channel to produce a signal to noise ratio of at least 3:1, ensuring no fluorescent puncta are over-exposed. 
	NOTE: For example, on an imaging system we use with a scientific CMOS camera, using 60x 550 objective and immersion oil with a refractive index of n = 1.516, setting max signal of the red channel to 1000-2000 au, the green channel to 3000 au, the blue channel to 3000 au and the DIC channel to 4000-5000 au produces high quality images.</li>
	<li>Adjust the acquisition settings to take 14-20 0.2 &#181;m Z-stacks to span 2-4 &#181;m total.</li>
	<li>For microscopes equipped with post-processing modules, select Deconvolution and Quick Projection for each stack.</li>
	<li>Collect Z-stacks of cells, taking enough images to capture ~100-200 cells for each condition or time point.</li>
	<li>Refer to the Supplemental File 1 for software instructions with screenshots from the imaging software.</li>
</ol>
7. Image analysis
<ol>
	<li>Open projected images in ImageJ and adjust brightness and contrast to view different channels. If the microscope used for imaging does not have post-processing modules, perform max projection of the Z-stacks at this stage.</li>
	<li>To determine cell cycle progression, count 100 cells per time point and classify them as containing one or two nuclei. Alternatively, calculate the spindle length or distance between spindle pole bodies to define cell cycle state. The distance between Spc110 foci &#60; 1.5 &#181;m corresponds with metaphase cells, and the distance &#62; 1.5 &#181;m corresponds with anaphase cells.</li>
	<li>To calculate intensities of protein puncta (e.g., Stu2-GFP), use the freehand selection tool to draw around the boundary of the signal of interest. Add this signal to ROI (Region of Interest) manager by pressing T or using the Menu. In ROI manager select Measure to calculate the intensity of each selected puncta. To view changes in puncta signal over time, plot average intensity with 95% confidence interval on a line graph for each time point.</li>
	<li>To calculate the percentage of cells with Bub1-GFP puncta, ensure the green channel minimum and maximum brightness settings are the same across different images. Cells with a Bub1-GFP puncta showing overlap with an Mtw1-mCherry puncta are counted as Bub1 localized to the kinetochore; otherwise, the cell is counted as negative. Count ~100 cells per condition. Aravamudhan et al.29 contains more information on Bub1 localization to kinetochores.</li>
	<li>To calculate the percentage of large-budded mononuclear cells, count the number of cells with a large bud and one nucleus (one DAPI signal) in the population and divide by the total number of cells.</li>
	<li>Refer to the Supplemental File 1 for the software instructions with screenshots from the imaging software.</li>
</ol>

The authors declare no competing financial interests.

Utilizing cell cycle synchronization in budding yeast enables studying important mechanisms for a variety of cellular processes. The use of G1 arrest-releases with &#945;-factor treatment allows synchronous progression of a population of cells through the stages of the cell cycle, and as we showed, can reveal dynamic localization patterns of cellular regulators like Stu236. Cell cycle arrests can also be accomplished using genetic means via depletion of cell cycle regulators like Cdc20, w...

Eukaryotic cell division is highly regulated through a program called the cell cycle. The highly conserved and dynamic processes occurring in the cell cycle make it interesting to study in-and-of-itself, but also have wide-spread implications that inform investigations of other cell biological processes-for example, many organelles undergo dramatic remodeling during cell division, and the abundance and localization of many proteins is highly regulated throughout1,2,3. Although there are some additional layers of complexity present in metazoan systems compared to yeast, including more variety of regulatory kinases and proteins, as well as additional input from external signaling in metazoans, cell division is overall very highly conserved in all eukaryotes4,5. Much fundamental work establishing key insights into cell cycle progression and crucial regulatory steps was done in yeast, and it remains an extremely attractive organism for studying cell cycle-related questions for a multitude of reasons6,7. Chief among these is the wide array of methods available to manipulate the cell cycle, allowing for arrest at various stages and synchronization of cells. Additional advantages include yeast&#39;s short cell cycle (~90-150 min depending on temperature and media conditions), the ease of genetic manipulation, and the large breadth of conditional alleles that enable study in an otherwise wild-type context.
Progression through the different phases of the cell cycle is driven by the activity of several key kinases, including the ubiquitous Cyclin-dependent kinase (Cdk), Polo-like kinase, and Aurora kinases. Cell cycle checkpoints regulate progression through the cell cycle, ensuring that cells do not progress into the next stage of division unless specific conditions are met8,9. These checkpoints, and the transitions they regulate, can be hijacked by researchers to achieve long term arrest, or transient arrest and release to synchronize a population of cells (Figure 1). For example, the cell cycle commitment checkpoint (Restriction point or Start in yeast) ensures that the cell has enough nutrients to commit to division before starting DNA replication10. This checkpoint can be manipulated in haploid yeast to achieve a G1 arrest, taking advantage of the yeast mating program that interacts with the cell cycle. In baker&#39;s yeast (Saccharomyces cerevisiae), haploid cells have one of two mating types, MATa or MAT&#945;, which is genetically determined by a mating type locus. Yeast of one mating type are sensitive to the mating pheromone of the other mating type and respond by activating a MAP kinase signaling cascade that ultimately phosphorylates and stabilizes the Cdk inhibitor Far1, which prevents cell cycle entry by binding to the Cln1/2-Cdk complex and blocking its activity11,12,13. Cells responding to mating pheromones can be visually determined by the presence of a mating projection or shmoo (Figure 1). Thus, chemically synthesized &#945;-factor can be added to cultures of&#160;MATa cells to achieve a G1 arrest. Another cell cycle transition that researchers can target to synchronize yeast cells is the metaphase-to-anaphase transition. During mitosis, the Spindle Assembly Checkpoint (SAC) monitors the attachment of kinetochores to microtubules and inhibits the anaphase promoting complex/cyclosome (APC/C) by sequestering its activator, Cdc20, when unattached kinetochores are detected. The APC/C is an E3 ligase complex that is essential for anaphase entry. When the SAC is satisfied, Cdc20 then binds the APC/C, and APC/C ubiquitinates several proteins, primarily securin and cyclin B, which targets them for degradation, and promotes chromosome segregation and mitotic exit14,15. Although Cdc20 itself is not a component of the SAC, its inhibition is the target of SAC activation; therefore, inducible depletion of Cdc20 can be leveraged to arrest a yeast culture in metaphase (Figure 1)16.
This protocol encompasses two methods of yeast cell cycle manipulation, as well as an example application of each method. In the first, &#945;-factor is used to arrest cells in G1, followed by a wash step to release cells from the arrest, resulting in synchronous cell cycle re-entry. The synchronized cells will continue through the entire cell cycle, enabling researchers to track and study cells in each cell cycle stage. In this method, the dynamic localization of a GFP-tagged protein of interest, Stu2, is monitored throughout, and its association with the mitotic spindle is tracked. This method also leverages a tagged spindle pole body (SPB) component, Spc110-mCherry, which enables measurements of mitotic spindle length and is an excellent proxy for cell cycle progression17. This method demonstrates how cell cycle arrest and release enable synchronization of cell populations, facilitating the study of a protein or other component of interest throughout the cell cycle.
In the second method, a mitotic arrest is accomplished via depletion of Cdc20 using an auxin-inducible degron (AID) system18. In cells expressing TIR1 (an F-box protein of plant origin), any protein with an AID tag will be ubiquitinated and degraded upon the addition of auxin. Here, we use an AID-tagged Cdc20 to enable inducible degradation of Cdc20, thereby causing an arrest in metaphase. This cell population is then monitored for the recruitment of the tagged SAC component Bub1-GFP to kinetochores, using the tagged kinetochore protein Mtw1-mCherry as a fiducial marker. Although Bub1 plays SAC-independent roles at the kinetochores and localizes to kinetochores in early mitosis, its persistent kinetochore localization in arrested cells signals improper kinetochore-microtubule attachments19. We showed this by treating cells with the microtubule poison, nocodazole, which disrupts kinetochore-microtubule attachments. This experiment highlights how processes specific to a distinct cell cycle phase can be studied using highly tunable arrest methods. We further demonstrate that auxin can be washed out of cdc20-AID cultures, allowing release into anaphase and entry into a new cell cycle, though in our experience, these cultures do not release as synchronously as an &#945;-factor arrest-release. These two arrest-release methods are both effective and easy to implement, but many other methods are available to researchers in yeast to arrest cells at different cell cycle stages20,21,22,23. Further details of these methods can be found in the Discussion.

<table><tbody><tr><td>?-factor</td><td>University of Utah Core Synthesis Facility</td><td></td><td>Sequence: WHWLQLKPGQPMY</td></tr><tr><td>1.5 mL Eppendorf Tubes</td><td>Axygen</td><td>MCT-175-C</td><td></td></tr><tr><td>10mM dNTP mix</td><td>Thermo Scientific</td><td>R0193</td><td></td></tr><tr><td>50 mL conical tubes</td><td>greiner bio-one</td><td>227 261</td><td></td></tr><tr><td>5x Phusion HF reaction buffer</td><td>New England BioLabs</td><td>B0518S</td><td></td></tr><tr><td>Acetic Acid, Glacial</td><td>Fisher Chemical</td><td>BP2401C-212</td><td></td></tr><tr><td>adenine hemisulfate salt</td><td>Sigma-Aldrich</td><td>A9126-100G</td><td></td></tr><tr><td>Agar, Granulated</td><td>Apex Chemicals and Reagents</td><td>20-275</td><td></td></tr><tr><td>agarose</td><td>Apex Bioresearch Products</td><td>20-102GP</td><td></td></tr><tr><td>Autoclave Amsco Century Steam Sterilizer</td><td>Steris</td><td>SV-1262</td><td></td></tr><tr><td>autoclaved DI water</td><td></td><td></td><td></td></tr><tr><td>Auxin</td><td>Sigma-Aldrich</td><td>Cat#I3750-5G-A; CAS: 87-51-4</td><td></td></tr><tr><td>Cargille Laser Liquid</td><td>Cargille Laboratories</td><td>20130</td><td></td></tr><tr><td>D-Sorbitol</td><td>Sigma-Aldrich</td><td>S1876-500G</td><td></td></tr><tr><td>DAPI (40 ,6-Diamidino-2-Phenylindole, Dihydrochloride)</td><td>Molecular Probes</td><td>Cat#D1306</td><td></td></tr><tr><td>Deoxyribonucleic acid sodium salt from salmon testes</td><td>Sigma-Aldrich</td><td>D1626</td><td></td></tr><tr><td>Dextrose</td><td>Fisher Chemical</td><td>D16-10</td><td></td></tr><tr><td>Disodium Ethylenediamine Tetraacetate</td><td>Fisher Chemical</td><td>S811-10</td><td></td></tr><tr><td>DMSO</td><td>Thermo Scientific</td><td>20688</td><td></td></tr><tr><td>FIJI/ImageJ2 vs 2.14.0/1.54f</td><td>ImageJ2</td><td>https://imagej.net/software/fiji/</td><td></td></tr><tr><td>Fixed Speed Vortex Mixer</td><td>VWR</td><td>https://dabos.com/product/vortex-mixers-vwr-fixed-speed-vortex-mixer-00001-24763?srsltid=AfmBOoo5TH0aoExvrrrphDaFt8XAsDqLvkjxtEUj1QWlFbWh7_gwzMObLT4&amp;amp;gQT=2</td><td></td></tr><tr><td>Fluorescent microscope DV Ultra</td><td>Leica</td><td>https://www.leica-microsystems.com/c/am/lsr-w/fluorescence-microscope-wf/?nlc=20250214-SFDC-022570&amp;amp;utm_source=google&amp;amp;utm_medium=cpc&amp;amp;utm_campaign=25-AM-LSR-L3-LSPO-LSWF-SE-Google-Ads-WF-Thunder-Search&amp;amp;utm_content=text_ad&amp;amp;utm_term=fluorescence%20microscopes&amp;amp;gad_source=1&amp;amp;gad_campaignid=170130111&amp;amp;gbraid=0AAAAADrbsAF-dGDbxzgT8m_cvXSlf4BB0&amp;amp;gclid=CjwKCAjwmenCBhA4EiwAtVjzmkMJUGFksaHezZvlBUlbbS1tR8RqXP24dbSRzcRgTT8RmJy7nyeThBoC3yQQAvD_BwE</td><td>Serial #: NV01063. No longer supported</td></tr><tr><td>Formaldehyde</td><td>Fisher Chemical</td><td>Cat#F79-500</td><td></td></tr><tr><td>gel apparatus</td><td>Thermo Scientific</td><td>Owl EasyCast B1</td><td></td></tr><tr><td>GeneRuler DNA Ladder Mix</td><td>Fermentas</td><td>SM0333</td><td></td></tr><tr><td>glass beads</td><td>Fisher Scientific</td><td>11312A</td><td></td></tr><tr><td>Glass Slides</td><td>VWR</td><td>48300-026</td><td></td></tr><tr><td>Innova 2300 Platform Shaker</td><td>New Brunswick</td><td>NB-2300</td><td></td></tr><tr><td>Kimwipes</td><td>Kimtech</td><td>06-666</td><td></td></tr><tr><td>Laboratory centrifuge for 1.5 mL tubes</td><td>Eppendorf</td><td>2525</td><td></td></tr><tr><td>Laboratory centrifuge for 50 mL tubes</td><td>Eppendorf</td><td>5804</td><td></td></tr><tr><td>Lithium acetate dihydrate</td><td>Sigma-Aldrich</td><td>L4158-250G</td><td></td></tr><tr><td>Master cycler nexus X2</td><td>eppendorf</td><td>https://www.eppendorf.com/us-en/Products/PCR/Thermocyclers/Mastercycler-nexus-X2-p-PF-82586</td><td></td></tr><tr><td>Micro-pipettes p2, p20, p200 and p1000 and corresponding tips</td><td>Rainin</td><td>L-2XLS+R, L-20XLS-R, L-200XLS-R, L-1000XLS-R</td><td></td></tr><tr><td>Microscope Cover Glass</td><td>Fisher Scientific</td><td>12541014</td><td></td></tr><tr><td>Nocodazole</td><td>Calbiochem</td><td>Cat#487928; CAS: 31430-18-9; Lot#B35705</td><td></td></tr><tr><td>Orange G</td><td>Sigma-Aldrich</td><td>O7252</td><td></td></tr><tr><td>PEG</td><td>Hampton Research</td><td>HR2-591</td><td></td></tr><tr><td>Peptone granulated&amp;nbsp;</td><td>Fisher Bioreagents</td><td>BP9725-5</td><td></td></tr><tr><td>Phusion HF DNA Polymerase</td><td>New England BioLabs</td><td>M0530L</td><td></td></tr><tr><td>Pipet-X</td><td>Rainin</td><td>PX-100R</td><td></td></tr><tr><td>Potassium phosphate, dibasic</td><td>Thermo Scientific</td><td>424195000</td><td></td></tr><tr><td>Potassium phosphate, monobasic</td><td>Thermo Scientific</td><td>424200025</td><td></td></tr><tr><td>power source</td><td>Bio-Rad</td><td>23786</td><td></td></tr><tr><td>Start Acquire Ultra 1.2.2</td><td>softWoRx Cytiva</td><td>Obtain with DV Ultra</td><td></td></tr><tr><td>Tris Base</td><td>Fisher Bioreagents</td><td>BP152-10</td><td></td></tr><tr><td>Triton X-100</td><td>Sigma-Aldrich</td><td>9002-93-1</td><td></td></tr><tr><td>tube rotator</td><td>VWR</td><td>10136-084</td><td></td></tr><tr><td>water bath</td><td>VWR</td><td>WBE10A11B</td><td></td></tr><tr><td>Water, Ultra Pure</td><td>Apex Bioresearch Products</td><td>18-194</td><td></td></tr><tr><td>Yeast extract Granulated</td><td>Fisher Bioreagents</td><td>BP9727-5</td><td></td></tr></tbody></table>

manipulation and analysis of cell cycle-dependent processes in budding yeast

Manipulation and Analysis of Cell Cycle-Dependent Processes in Budding Yeast

Eukaryotic cells follow a conserved cell cycle that regulates diverse processes, including DNA maintenance and organelle homeostasis. Studying cellular processes in a cell cycle-dependent manner is often necessary to properly interpret experimental results. There are chemical and genetic methods available to produce cell cycle synchronization in cultured cells across a wide swath of organisms, including vertebrate models, enabling the study of cell cycle-dependent processes. However, among model organisms, budding yeast remains a powerhouse for cell cycle analysis due to its particularly robust synchronization methods, short generation time, and genetic tractability. Yeast shares core cell cycle machinery with other eukaryotes, which has enabled landmark discoveries in cell cycle regulation. This protocol details methods for cell cycle analysis in yeast, focusing on G1 arrest-release and mitotic arrest-release experiments, including strain construction, culture preparation, and microscopy. PCR tagging methods for producing suitable strains for cell cycle arrests and fluorescence microscopy are presented. A G1 arrest is achieved using the peptide pheromone &#945;-factor, and brief washes result in synchronous release and cell cycle progression. Samples are taken at different time points following release into the cell cycle and fixed for microscopy. A second method arrests yeast cells in mitosis by depleting the cell cycle regulator Cdc20 to achieve a metaphase-arrested population, as well as optional release into anaphase. Samples are fixed and prepared for imaging pre- and post-release, and are imaged and analyzed. Image analysis focuses on cataloging dynamic localization and population abundance changes of proteins in the cell cycle. These synchronization methods are suitable for diverse cell cycle manipulations, and while their use in imaging fixed cells is highlighted here, they can be adapted for many other analyses, including live cell imaging as well as biochemical and molecular assays.

Analyzing changes in cell cycle-dependent protein localization by fluorescence microscopy can be readily accomplished using the methods we describe here. Our group has long been interested in the dynamic regulation and function of the mitotic spindle. In yeast, spindle pole bodies (marked by component Spc110) function as microtubule organizing centers from which microtubule filaments emanate to create the structure of the mitotic spindle30. The microtubule binding ...

This protocol details two methods of yeast cell cycle arrest and optional release, and elaborates on the use of fluorescence microscopy to study cell cycle-dependent processes in S. cerevisiae.

Eukaryotic cells follow a conserved cell cycle that regulates diverse processes, including DNA maintenance and organelle homeostasis. Studying cellular ...

We study how dividing cells faithfully pass on their chromosomes during mitosis, focusing on the molecular machines and mechanisms that ensure accurate chromosome segregation. We synchronize cells to study molecular processes that change with the cell cycle. Without these methods, key changes would be hidden in an unsynchronized cell population.Compared to other synchronization methods, alpha-factor arrest in BAR1 mutants provides a cleaner, reversible, G1 arrest, allowing us to track an entire yeast culture progressing synchronously through the cycle. Our work reveals dynamic protein localization and activity changes throughout the cell cycle, shedding light on key mitotic processes, like chromosome segregation and spindle maintenance. To begin, inoculate yeast into 25 milliliters of YPAD media, and incubate overnight to reach an optical density at 600 nanometers between 0.5 and 2.0.Dilute the yeast cells to an optical density at 600 nanometers of 0.5. Add alpha-factor to the culture to reach a final concentration of one microgram per milliliter. At 2.5 to 3.5 hours after alpha-factor addition, count the percentage of non-budded shmooed cells under a microscope to assess the cell arrest.Then, spin down the culture in a centrifuge at 3, 000g for three to five minutes at 23 degrees Celsius. Carefully pour off the supernatant to remove the alpha-factor. Resuspend the cell pellet in 25 milliliters of YPAD containing 1%dimethyl sulfoxide to wash the cells.Transfer the cell pellet to a fresh tube and repeat the washes twice more for a total of three washes to remove any residual alpha-factor. Next, add YPAD to the washed cells to bring the final volume to 25 milliliters, and transfer the suspension into a new flask for further incubation or use. Collect the zero-minute time-point sample immediately after release and fix the sample.At 60 minutes post-release, assess synchrony of the cell population under a light microscope. If desired, add alpha-factor again at 60 minutes after release to a final concentration of one microgram per milliliter to block progression into the next cell cycle. Continue collecting time-point samples every 15 minutes up to 180 minutes or for as long as needed.To fix the yeast cells, centrifuge one milliliter of culture for one minute at maximum speed. Aspirate the supernatant completely. Then, resuspend the pellet in 500 microliters of fixative solution and incubate at 23 degrees Celsius for two to 15 minutes.After centrifuging the fixed cells, aspirate the supernatant and resuspend the pellet in 500 microliters of 0.1-molar potassium phosphate buffer at pH 6.4. Before imaging, centrifuge the fixed cells at 23 degrees Celsius for one minute at maximum speed. Once the supernatant is aspirated, resuspend the pellet in 10 to 100 microliters of Triton, DAPI, and sorbitol solution.Pipette approximately 0.8 microliters of the stained cell suspension directly onto the center of a clean coverslip. Use a pipette tip to gently spread the droplet into a circular area approximately one square centimeter in size. Place the coverslip onto a microscopy slide.Using a Kimwipe, gently press around the edges of the coverslip to evenly distribute the sample. Then, seal the edges of the coverslip with nail polish to secure the sample. Take the prepared slide to a microscope equipped with a 60 times magnification, 1.42 numerical aperture oil immersion objective, and a red, green, blue, and far red laser and filter set.Focus the microscope on the yeast cells adhered to the coverslip. Once focused, tune the exposure settings for each fluorescence channel to achieve a signal-to-noise ratio of at least three-to-one. Adjust the acquisition settings to collect 14 to 20 z-stack images with each slice spaced 0.2 micrometers apart, covering a total z-depth of two to four micrometers.On microscopes equipped with post-processing modules, select Deconvolution and Quick Projection options for each z-stack image. Acquire z-stacks of the sample, capturing enough images to record approximately 100 to 200 yeast cells for each experimental condition or time point. For analysis, open the projected images in ImageJ software.Adjust the brightness and contrast of each fluorescence channel to enhance visibility. To analyze cell cycle progression, count 100 cells for each time point and classify them as containing one or two nuclei. To calculate the percentage of cells showing Stu2-GFP puncta, standardize the green channel brightness settings across all images.Count cells showing Stu2-GFP puncta that co-localize with Spc110-mCherry puncta as positive for kinetochore localization. Next, to quantify the intensity of protein puncta, use the freehand selection tool to outline the region of interest around the signal. Add the selection to the Region of Interest Manager by pressing T or choosing the option from the ROI Manager menu.In the ROI Manager, click Measure to calculate puncta intensity. To visualize changes over time, plot the average intensity with 95%confidence intervals for each time point. Count approximately 100 cells per condition.In G1-arrested cells, Stu2-GFP localized to a single spindle-pole proximal punctum with additional dispersed signal along cytoplasmic microtubules. At 60 minutes after release, Stu2-GFP localized as two puncta adjacent to duplicated spindle poles marked by Spc110-mCherry. By 90 minutes, during anaphase, Stu2-GFP appeared both near the spindle poles and along microtubules spanning the single axis.Following mitotic exit, at 120 minutes, Stu2-GFP reappeared on astral microtubules in the cytoplasm. Quantification revealed that Stu2-GFP intensity near spindle poles increased during early mitosis, peaking before anaphase and declined thereafter. The percentage of binucleate cells peaked at approximately 90 minutes, indicating synchronized entry into anaphase.

manipulation-analysis-cell-cycle-dependent-processes-budding

Research

JoVE Journal

Biology

Gene deletion and protein overexpression are common methods for studying functions of proteins. In this article, we describe a protocol for analysis of phenotype development as a function of protein concentration at population and single-cell levels in Saccharomyces cerevisiae.

Analysis of the Development of a Morphological Phenotype as a Function of Protein Concentration in Budding Yeast

Determining the cell cycle position of a population of cells, or understanding how signals affect proliferation, can be readily measured by flow cytometry using this protocol.  We report a simple experimental approach to staining cells and quantifying their position in the cell cycle.

Analysis of Cell Cycle Position in Mammalian Cells

We present a simple protocol to obtain fluorescence microscopy movies of growing yeast cells, and a GUI-based software package to extract single-cell time series data. The analysis includes automated lineage and division time assignment integrated with visual inspection and manual curation of tracked data.

Acquiring Fluorescence Time-lapse Movies of Budding Yeast and Analyzing Single-cell Dynamics using GRAFTS

The fission yeast, Schizosaccharomyces pombe is an excellent model system to study cytokinesis, the final stage in cell division. Here we describe a microscopy approach to analyze different cytokinetic events in live fission yeast cells.

Spatiotemporal Analysis of Cytokinetic Events in Fission Yeast

Budding yeast is an advantageous model for studying microtubule dynamics in vivo due to its powerful genetics and the simplicity of its microtubule cytoskeleton. The following protocol describes how to transform and culture yeast cells, acquire confocal microscopy images, and quantitatively analyze microtubule dynamics in living yeast cells.

High-resolution Imaging and Analysis of Individual Astral Microtubule Dynamics in Budding Yeast

The Inherent Dynamics Visualizer is an interactive visualization package that connects to a gene regulatory network inference tool for enhanced, streamlined generation of functional network models. The visualizer can be used to make more informed decisions for parameterizing the inference tool, thus increasing confidence in the resulting models.

Inherent Dynamics Visualizer, an Interactive Application for Evaluating and Visualizing Outputs from a Gene Regulatory Network Inference Pipeline

Time-lapse microscopy is a valuable tool for studying meiosis in budding yeast. This protocol describes a method that combines cell-cycle synchronization, time-lapse microscopy, and conditional depletion of a target protein to demonstrate how to study the function of a specific protein during meiotic chromosome segregation.

Use of Time-Lapse Microscopy and Stage-Specific Nuclear Depletion of Proteins to Study Meiosis in S. cerevisiae

One challenge of analyzing synchronized time-series experiments is that the experiments often differ in the length of recovery from synchrony and the cell-cycle period. Thus, the measurements from different experiments cannot be analyzed in aggregate or readily compared. Here, we describe a method for aligning experiments to allow for phase-specific comparisons.

Alignment of Synchronized Time-Series Data Using the Characterizing Loss of Cell Cycle Synchrony Model for Cross-Experiment Comparisons

In this article we present a general protocol for measuring the replicative life span of yeast mother cells.

Measuring Replicative Life Span in the Budding Yeast

The fission yeast, Schizosaccharomyces pombe, is a good model system to study basic cellular processes. Here we describe a method to perform quantitative live cell analysis of fission yeast. In this particular experiment we focus on organisation of the genome within the cell nucleus, but the method can also be used to study cytosolic factors.

Quantitative Live Cell Fluorescence-microscopy Analysis of Fission Yeast

Learn cell cycle synchronization in Saccharomyces cerevisiae using alpha-factor arrest to study chromosome segregation and protein dynamics. This method enables precise observation of mitotic processes.

Manipulation and Analysis of Cell Cycle-Dependent Processes in Budding Yeast

Explore More Videos