Recombineering-based Manufacturing of Engineered Viral Vectors for Research and Therapy

Summary

Recombineering, a recombination-mediated genetic engineering method, enables precise viral genome modifications without relying on enzymatic digestion. This approach is crucial for basic research, such as targeted deletions, and for developing engineered viruses used in oncolytic therapies, gene therapy, and genetic vaccines, expanding possibilities in both research and clinical applications.

Abstract

The increasing demand for engineered viral vectors in both basic and translational research has underscored the need for flexible, rapid, and scalable methods to generate recombinant DNA viruses. Strategies relying on restriction enzyme digestion and ligation are constrained by sequence-dependent limitations and time-consuming cloning steps. Here, we describe the recombination-mediated genetic engineering method (recombineering) that circumvents these limitations by enabling precise and seamless modifications of viral genomes in bacterial artificial chromosomes (BACs). This approach allows for efficient deletion, insertion, or substitution of coding or non-coding genetic elements, providing a powerful platform for high-throughput viral vector development. Recombineering is particularly valuable in basic research applications, such as the deletion or mutation of viral genes to investigate their function. More importantly, this methodology enables the generation of tens of recombinant viruses encoding distinct immunostimulatory or therapeutic payloads in parallel, making it exceptionally well-suited for the rapid preclinical evaluation of novel constructs. While this technology can be potentially implemented for any scientific purpose, this article focuses on the application of recombineering in two specific areas: the generation of oncolytic viruses based on herpes simplex virus, and the development of non-replicative adenoviral vectors for gene transfer. In conclusion, recombineering offers a versatile approach to viral genome engineering, significantly accelerating the pipeline from design to functional testing. Its relevance spans from fundamental virology to translational medicine to meet evolving research and clinical needs.

Introduction

Viral vectors have emerged as potent tools in gene therapy, oncolytic virotherapy, and genetic vaccine development due to their natural ability to deliver genetic material into host cells. They leverage viruses' natural tropism and transduction mechanisms, facilitating both transient and long-term gene expression. They are able to survive in the extracellular environment, to attach to a specific cellular receptor (that defines the viral tropism) and promote their internalization, to hijack the host cell gene expression machinery and drive the expression of their own genes, and to elude membrane-bound and intracellular sensors of the innate immune arm^1,2. In this way, after a productive viral infection, viruses transform cells into viral progeny factories that spread new viruses into the organism, eventually causing a disease.

Wild-type viruses can be transformed into a biotechnological tool by genetic engineering: their genome can be easily manipulated to retain the transduction capability and obtain a clinical outcome. Based on their clinical application, viral vectors can be engineered to retain (at least in part) or be ablated in their replication competence to generate either replication-competent or replication-incompetent vectors^3,4.

Replication-competent viruses are mainly intended for oncolytic virus purposes. Cancer cells, often deficient in antiviral defenses¹, allow replication of attenuated recombinant viruses engineered through deletion of virulence genes. These viruses selectively replicate in tumors while sparing normal tissue. As understanding of virology has advanced, attenuated viruses have been superseded by more precise genome modifications designed to enhance both safety and therapeutic efficacy.

Among the fields of interest requiring surgical molecular engineering of viral genomes are: i) Replication-conditional oncolytic viruses, where viral promoters are replaced with tumor-associated promoters (cellular promoters over-transcribed in tumor cells), thereby restricting viral gene expression to diseased cells⁵. ii) Viruses with altered tropism^6,7, where envelope glycoproteins that determine infection can be modified or replaced with antibody fragments or ligands that target proteins overexpressed on tumor cells^8,9. iii) Armed oncolytic viruses. Tumor cell death induced by oncolytic viruses triggers immunogenic cell death (ICD), characterized by the release of inflammatory mediators^1,10 and tumor antigens¹¹. These signals promote efficient recognition of tumor antigens by the immune system, restoring surveillance¹²and enabling combination with immune checkpoint inhibitors^13,14,15 and other immune therapeutics such as RNA-based therapies and vaccines¹⁶.

In support of this immunotherapeutic effect, transgenes of interest can be encoded within the viral genome, thereby exploiting the virus not only for its oncolytic activity but also to enhance its immunotherapeutic potential through the in-situ production of relevant payloads^3,7,17,18,19. These payloads may comprise cytokines, chemokines, antibodies, suicide genes, and antigens^3,20. Insertion requires precision, with intergenic regions of the viral genome preferred to minimize disruption of viral genes and preserve replication and potency⁷. Therefore, techniques that enable the screening of both optimal insertion sites and transgenes of interest are essential.

On the other hand, in the context of non-replicative viruses, used for gene therapy or as vehicles for genetic vaccines, it is important that the viral vector delivers the transgene (either transiently or long-lasting) without replicating into the host cell to avoid toxicity²¹. Adenoviral vectors are characterized by high transduction efficiency, robust expression of transgenes, and the capacity to infect both dividing and non-dividing cells³. These properties have made them first-in-class for the development of genetic vaccines, including those for emerging infectious diseases, such as COVID-19, as well as gene replacement therapies²². The most famous example of an adenoviral vector that has reached the market is the Oxford-AstraZeneca COVID-19 vaccine, known by the commercial name of Covishield or Vaxzevria, based on a modified chimpanzee adenovirus, ChAdOx1, encoding for the Spike protein of SARS-CoV-2. When injected by the intramuscular route, Covishield is able to penetrate inside the cells and induce the expression of the Spike protein, priming the immune system to mount an immune response against it³.

There is a clear need to modify viral genomes without being constrained by restriction enzyme recognition sites. Among oncolytic viruses, Herpes Simplex Virus-1 (HSV-1)-based vectors offer unique advantages, including lytic ability, safety, and large genome size, allowing insertion of sizeable transgenes or multiple genetic elements^23,24. Beyond HSV, many other viruses show therapeutic promise, as recently reviewed in Sasso et al.³. Rather than a universal "best-in-class" vector, different viral platforms are suited to distinct therapeutic needs³. Currently, homologous recombination systems in bacteria or hybrid yeast-bacteria cloning remain the most common alternatives to restriction enzymes, but these are laborious, multi-step, and inefficient²⁵.

An emerging alternative is the use of CRISPR/Cas9, recently applied to engineer genomes of viruses, including vaccinia virus (VV), herpes simplex virus, and adenoviral vectors. Cas9 is appealing for gene inactivation via indel mutations but becomes less practical when multiple cuts are required to delete genome segments or insert a transgene via donor DNA. Moreover, editing is limited by gRNA design, off-target effects in both viral and host genomes, and dependence on PAM sequences in regions of interest²⁵.

With this in mind, and through two examples based on HSV and adenovirus, this article illustrates the recombineering method, which can be applied broadly-from viruses to bacteriophages, complex plasmids, and diverse experimental systems. Recombineering (homologous RECOMBInation-mediated genetic engiNEERING) is an in vivo genetic engineering technique, used primarily in Escherichia coli, that exploits temperature-dependent bacteriophage recombination proteins to catalyze homologous recombination between DNA elements with as few as 30 bp of homology²⁶. This approach allows precise insertion, deletion, or modification of sequences without dependence on restriction sites or DNA size. In this manuscript, we describe a version based on the heat-inducible E. coli strain SW102, though alternative strains with specific inducible systems are also available²⁷.

Recombineering begins with preparing electrocompetent bacterial cells through a controlled temperature shock to activate phage recombination machinery. DNA molecules carrying the appropriate homology arms are then electroporated. These may be double-stranded DNAs (dsDNA) generated by restriction digestion or PCR or single-stranded DNAs (ssDNAs) such as oligonucleotides. The presence of homologous sequences together with active recombination proteins enables the creation of new DNA molecules with the desired modification.

Recombineering molecular cloning technology enables precise genetic engineering and is applied in diverse contexts, including insertion of selectable or non-selectable markers in plasmids, bacterial chromosomal DNA, and bacterial artificial chromosomes (BACs). BACs are particularly valuable for cloning large genomic fragments, including adenoviral and HSV DNA, enabling the rapid production of viral vectors. Beyond translational applications, recombineering also supports basic research by permitting targeted deletion, modification, or replacement of viral genes or protein domains. Recombineering has some limitations: short homology arms hinder recombination in repetitive regions; PCR-amplified substrates may occasionally introduce mutations; and the sequence of the target region must be known.

Protocol

As a prerequisite to recombineering, a proficient bacterial strain (e.g., SW102) with a BAC-Genome of Interest must be available. Although recombineering is a highly efficient method to enrich colonies that have undergone the desired modification, here, we describe a two-step recombineering strategy, referred to as the first and second steps (Figure 1). In the first step, an expression cassette containing both positive and negative selection markers is inserted into the locus of interest. In the second step, this cassette is replaced with the actual genetic modification intended for the final genome. The selection markers used in this study include ampicillin resistance (AmpR), beta-galactosidase activity (β-gal), and the sacB gene; however, any combination of positive and negative selection markers can be employed, depending on the specific needs of the research group.

1. Insert the selection cassette in the target region

1. Day 0
   1. Streak SW102 cells containing the desired BAC on LB Agar + antibiotic (whose resistance gene is in BAC (e.g., chloramphenicol 12.5 µg/mL). Grow them overnight in the incubator at 32 °C.
      ​NOTE: Avoid temperatures > 32 °C to prevent induction of recombineering genes during this phase.
2. Day 1
   1. Perform a PCR to amplify the AmpR/LacZ/SacB selection cassette. Use forward and reverse primers containing at the 3' end the sequence to anneal and amplify the selection cassette and at the 5' end 30-80 bp that represent homology arms to the viral genomic region to be modified (Table 1).
      NOTE: The selection cassette, as well as the insert, can be easily ordered as synthetic constructs from specialized providers. However, care must be taken to avoid the presence of duplicated promoters, terminators, or other genetic elements either within the BAC (controlling BAC genes) or in the viral genome to prevent unwanted recombination events.
   2. Ensure identity and purity of PCR fragment by agarose gel electrophoresis (as AmpR/LacZ/SacB cassette is 3,400 bp, run a 1% agarose gel) and that 260/230 and 260/280 values are in line with pure nucleic acid.
   3. In the afternoon, inoculate a single SW102 colony into 5 mL of LB and incubate overnight at 32 °C.
3. Day 2
   1. Inoculate 1-2 mL of the overnight culture into fresh 100 mL of LB. Grow the bacteria to an OD₆₀₀ of 0.55-0.7, measuring the OD₆₀₀ regularly to not miss the exponential phase.
   2. Prepare a water bath to 42 °C for induction and cool down to 4 °C ~250 mL of sterile ddH₂O for washes.
   3. Once the culture has reached the desired OD, transfer 50 mL into a clean conical tube and incubate at 42 °C in a water bath for 15 min. Include an uninduced negative control.
      NOTE: This step will induce lambda red proteins.
   4. Leave the tubes in ice for 10 min, then centrifuge for 5 min at 3,200 × g at 4 °C (both 42 °C induced and the uninduced).
   5. Discard the supernatant, add 40 mL of ice-cold, sterile ddH₂O, and resuspend the pellet (both 42 °C induced and the uninduced).
   6. Centrifuge again for 8 min (see step 1.3.4) and repeat the washing step (step 1.3.5) and centrifugation. Repeat the washing step until the supernatant is as clear as water (without turbidities and suspensions) (2-4 washes).
   7. After the last centrifugation, discard the supernatant and resuspend the pellet in 200 µL of ice-cold, sterile ddH₂O (both 42 °C induced and the uninduced).
   8. Transfer an aliquot of the resuspended pellets (50 µL of HSV-1 and 25 µL of Adeno) into precooled 1.5 mL tubes (both 42 °C induced and the uninduced). Add 50-400 ng of purified PCR product (do not exceed 5µL). Swirl tubes and incubate on ice for 5 min.
   9. Transfer the mix from the previous step into a precooled cuvette and electroporate at 2.50 kV (2,500 V, 0.2 cm cuvette) (both 42 °C induced and the uninduced one).
   10. After electroporation, allow the bacteria to recover in 1 mL of LB for 1.5 h at 32 °C. Add 1 mL of LB to the cuvette to clean it and collect everything.
   11. Spread different amounts of bacteria (10, 50, 200 µL) on LB Agar + Ampicillin (100µg/mL), X-Gal (20 µg/mL), and IPTG (0.5 mM) and let them grow overnight (ON) at 32 °C.
   12. Prepare plates with AMP/X-Gal (same concentration as in step 1.3.11) and plates with sucrose⁵.
4. Day 3
   NOTE: At this point, it is expected that colonies have grown and that they appear blue, but only on the plates where bacteria were induced at 42 °C and electroporated with the insert containing the selection cassette were plated. Once this is established, it is necessary to verify the integrity of the selection cassette in some of the colonies.
   1. Identify plates from ON where colonies are <50 to avoid picking of two or more colonies. Pick several colonies (typically 8-10 are enough to identify at least one suitable colony) and dilute them in approximately 50 µL of H₂O. Inoculate single, blue colonies in 50 µL of H₂O and streak them on both negative (LB Agar/Sucrose/Chloramphenicol) and positive (LB Agar/Ampicillin/Chloramphenicol/X-Gal/IPTG) selective plates (same concentration as in steps 1.1.2 and 1.3.11) (Figure 2).
      NOTE: It is expected to find 20-100 colonies on the plate, where 50 µL have been spread. However, if the number of colonies is lower, it does not necessarily mean that recombination is compromised.
   2. Inoculate the water from step 1.4.1 in 5 mL of LB and incubate the plates and LB culture overnight at 32 °C (Figure 2).
5. Day 4
   1. Select only blue colonies that grew on Amp/X-Gal plates and did not grow on Sucrose plates (Figure 3). For these positive clones (Table 2), transfer a 500 µL aliquot of the overnight culture into 50 mL of fresh LB.
6. Day 5
   1. For each positive clone, prepare a glycerol stab and extract and isolate the BAC plasmid (midiprep).
   2. Following BAC extraction, perform quality control to check whether the recombination has occurred correctly. Perform Sanger sequencing of insertion site. If everything looks correct, proceed with the second section.

2. Replace the selection cassette with the desired modification

1. Day 0
   1. Streak the positive clone on LB agar. Incubate overnight at 32 °C.
2. Day 1
   1. Perform a PCR to amplify the insert/modification. Use forward and reverse primers containing at the 3' end the sequence to anneal and amplify the selection cassette and at the 5' end the same 30-80 bp homology arms used in step 1.3.1 (Table 1).
   2. Ensure identity and purity of the PCR fragment by agarose gel electrophoresis and that 260/230 and 260/280 values are in line with pure nucleic acid.
   3. Inoculate a single colony into 5 mL of LB and incubate overnight at 32 °C.
3. Day 2
   1. Transfer 2 mL of the overnight culture into 100 mL of LB and grow at 32 °C until OD₆₀₀ reaches 0.55-0.7 (in ~2.5-3 h). Prepare a water bath to 42 °C for induction and cool down to 4 °C ~250 mL of sterile ddH₂O for washes.
   2. Once the desired OD is reached, transfer 50 mL of culture into a conical tube and incubate in the 42 °C water bath for 15 min to induce λ-phage recombination proteins. Keep another 50 mL tube at 32 °C as the uninduced control.
   3. After heat induction, place the tubes on ice for 10 min.
   4. Centrifuge for 8 min at 3,200 × g at 4 °C (both 42 °C induced and the uninduced one).
      NOTE: From this point on, work on ice to maintain SW102 cell competency.
   5. Remove the supernatant and resuspend the pellet with 40 mL of prechilled water by gently swirling.
   6. Centrifuge for 5 min at 3,200 × g at 0-4 °C.
   7. Repeat the wash step (step 2.3.5) once.
   8. Remove the supernatant and gently resuspend the pellet in 100 µL of water.
   9. Transfer an aliquot of the resuspended pellets (50 µL of HSV-1and 25 µL of Adeno) into precooled 1.5 mL tubes (both 42 °C induced and the uninduced one). Add 50-400 ng of purified PCR product (do not exceed 5 µL). Swirl the tubes and incubate on ice for 5 min.
   10. Transfer the mix from the previous step into a precooled cuvette and electroporate at 2.50 kV (both 42 °C induced and the uninduced one).
   11. Allow the cells to recover in 5 mL of LB medium for 4-5 h at 32 °C with shaking.
       NOTE: The recovery time is longer than in the first recombineering step to allow degradation of residual SacB protein after cassette replacement.
   12. Plate different amounts (50, 200, 500 µL) of culture on LB agar Petri dishes containing sucrose, X-Gal, and IPTG (same concentration as in steps 1.1.2 and 1.3.11). Incubate overnight at 32 °C.
4. Day 3
   1. Screen a substantial number of colonies (20-100) to increase the likelihood of identifying positive clones that have successfully undergone recombination with the fragment carrying the desired modification and the selection cassette. Carry out a first-level screening using colony PCR. Use a Petri dish with a grid; pick colonies from a given quadrant and label them (Figure 4).
      NOTE: A particularly effective approach involves using a pair of primers in which one primer anneals outside the target region (on the viral genome) and the other within the recombined fragment (Figure 5).
   2. Check the presence and size of the PCR amplicon by agarose gel (1.5%).
   3. Pick from the correct quadrant the positive clones and inoculate in 100 mL of LB. Incubate overnight at 32 °C.
5. Day 4:
   1. Perform a midiprep to extract the plasmid from bacterial cultures.
   2. Digest the plasmid with restriction enzymes and run an agarose gel to analyze the digestion pattern.
   3. If the digestion pattern is correct, proceed with sequencing the modified region of the viral genome.
   4. After ensuring the molecular identity of recombinant clones, then proceed with transfection and rescue of viral particles.

Results

Generation of an IL12-coding oncolytic Herpes virus
As outlined in the introductory section of this work, one potential application of recombineering is the insertion of immunostimulatory transgenes into the genome of oncolytic viruses, with the aim of enhancing their immunotherapeutic potential. Below, we present an example of such an application using an oncolytic vector based on HSV-1. Specifically, this study investigates the impact of a transgene insertion into an intergenic locus within the Us1-Us2 region of the HSV-1 genome. Indeed, insertions within viral genomes can prove deleterious to viral functionality, potentially leading to replication defects that may compromise both in vivo antitumor efficacy and manufacturing yields. Such issues can ultimately render the production process incompatible with clinical development requirements. In this study, we aimed to insert an expression cassette comprising a constitutive eukaryotic promoter (enhanced CMV), followed by a short 5' untranslated region (UTR), the coding sequence of murine IL-12, and a polyadenylation signal (BGH).

The choice of IL-12 was based on its well-documented immunostimulatory effects on various immune cell populations with antitumor activity. The starting vector was a fully virulent Targeted Herpes Virus (THV) bearing a retargeting modification. In particular, this was a virus where amino acids from 6 to 38 of the glycoprotein D were replaced with a single-chain variable fragment (scFv) version of the SS1 antibody targeting the tumor-associated antigen mesothelin. However, as the Us1-Us2 locus is independent and far from the glycoprotein D gene locus exploited for retargeting, here we describe the entire arming process that can be applied to any HSV-1 genome regardless of the starting backbone.

Starting from a SW102 with BAC-THV, we performed the first step of recombineering with a DNA fragment containing the selection cassette (AmpR/LacZ/SacB) amplified by PCR using High-Fidelity DNA Polymerase with primers that annealed at their 3'-end with the selection cassette (bold) and carried at their 5'-end 50 base pairs of perfect homology to Us1 (in for primer) and Us2 (in rev primer) (the Table of Materials and Figure 6).

The PCR product was purified from a 1% agarose gel using a Gel and PCR Clean-Up System and then electroporated into electrocompetent SW102 bacteria following our Recombineering protocol. After a 1.5 h recovery in LB without antibiotics, bacteria were plated on LB Agar + Ampicillin, X-Gal, and IPTG. Blue colonies were then spread on negative and positive selective plates as shown in Figure 7. Ampicillin-resistant, sucrose-sensitive, and blue colonies were inoculated in LB medium + Chloramphenicol. In the second step, positive SW102 bacteria from the first selection step were transformed by electroporation with a DNA string containing an mIL12 expression cassette amplified by PCR with the same homology arms (Table of Materials and Figure 6).

After 4 h of recovery, the bacteria were plated on LB Agar + Chloramphenicol, X-Gal, IPTG, and sucrose. Sucrose-resistant, white, isolated colonies were picked and screened by Colony-PCR, using as a forward primer an oligonucleotide annealing inside the IL-12 coding sequence and as a reverse primer one that anneals on the viral genome (Figure 8). Positive clones were inoculated in 100 mL of LB, and DNA was extracted by Midiprep. To confirm that recombination occurred correctly, the Midi Prep product was digested and sequenced (Figure 9A). Finally, DNA was transfected into SKOV3 cells (P0) and amplified by infection at 0.1 MOI (P1) (Figure 9B). Viral productivity (PFU/cell) was monitored in cell lysates from 12 to 72 h post infection, showing no relevant dampening in replication and yield for IL-12-armed virus (Figure 9C).

Figure 1: General strategy of two-step recombineering protocol. The two steps of recombineering are depicted in a cartoon. The selection cassette is depicted as segmented DNA containing AMPr (green), BGal (Blue), and SacB (red). Please click here to view a larger version of this figure.

Figure 2: Step I colony screening and validation. Representative cartoon of double streak and inoculum of blue colonies from step I recombineering. Please click here to view a larger version of this figure.

Figure 3: Validation of AmpR and SacB functionality after step I recombineering. Five colonies streak are represented. Please click here to view a larger version of this figure.

Figure 4: Colony PCR-based screening of step II recombineering. Colony PCR from petri dish with grid. Please click here to view a larger version of this figure.

Figure 5: Strategies of colony PCR oligo design. Oligo design to assess recombineering bona fide in a deletion (left) or insertion (right) Please click here to view a larger version of this figure.

Figure 6: Layout of engineered viruses at different recombineering steps. Representation of viral genomes with Us and Ul regions highlighted Please click here to view a larger version of this figure.

Figure 7: Selection of recombinant clones in the first step. SW102 bacteria were plated on positive and negative selective plates. Correct recombination products are Ampicillin-resistant and appear blue on positive selective plates (Ampicillin, Chloramphenicol, X-Gal, and IPTG) and do not grow on sucrose. Abbreviations: A = ampicillin; S = sucrose; X-Gal = (5-bromo-4-chloro-3-indolyl-beta-D-galactopyranoside); IPTG = Isopropyl β-D-1-thiogalactopyranoside. Please click here to view a larger version of this figure.

Figure 8: Screening by colony PCR. Positive clones were identified by the presence of an amplification band at ~1,300 bp (arrow). 1 kb ladder on the left. Please click here to view a larger version of this figure.

Figure 9: Assessment of cloning and viral particle production and monitoring. A) Sanger sequence of the region of interest. B) Viral particles were produced in SKOV3 cells and monitored by GFP encoded into the BAC region. C) Viral yield was monitored at P1 by infection at 0.1 MOI and collection of samples over 3 days as three biological replicates. Abbreviations: GFP = Green Fluorescent Protein; P1 = Passage 1; MOI = Multiplicity of infection. Please click here to view a larger version of this figure.

Component	Final concentration
H2O	add to 20 µL
Buffer	4 µL (1x)
10 mM dNTPs	200 µM each
Forward primer	0.5 µM
Reverse primer	0.5 µM
Template DNA	10 ng
DMSO	2%
Phusion High–Fidelity DNA Polymerase	0.02 U/µL

Step	Temperature	Time	Repetition
Initial Denaturation	98 °C	60 s	1x
Denaturation	98 °C	10 s	30x
Annealing	60 °C	20 s
Extension	72 °C	2 min
Final extension	72 °C	5 min	1x

Table 1: PCR setup for amplification of dsDNAs. The table indicates how to assemble reagents (water, buffer, dNTPs, primers, Taq polymerase, DNA template) and thermal cycles.

Colony no.	Growth  on Amp	Blue color	Growth on sucrose	Suitable for protocol step 2
1	+	+	+
2	-	-	-
3	+	+	-	+
4	+	+	-	+
5	+	-	+

Table 2: Example of positive and negative colonies from recombineering according to blue/white screening, AMP resistance, and SacB functionality.

Discussion

This "RECOMBINEERING" (homologous RECOMBInation-mediated genetic engiNEERING) protocol uses a two-step strategy: first, integration of a selection cassette into the genomic locus of interest, and second, replacement of this cassette with the desired modification (Figure 1).

The selection markers used include ampicillin resistance (AmpR), beta-galactosidase (β-gal), and sacB. AmpR enables antibiotic resistance-based selection, β-gal allows blue/white screening, and sacB confers sucrose sensitivity for counterselection. Colonies integrating the cassette appear blue on induced plates; growth in non-induced controls suggests poor-quality materials. The functionality of all markers must be verified before proceeding.

In the second step, sacB expression allows counterselection on sucrose plates. Colonies may still appear due to sacB mutations, which can be mitigated by using additional markers or by screening more colonies. Positive recombinants are confirmed by colony PCR with primers spanning the integration junction.

Recombineering efficiency can exceed 80% when supported by careful design. Genome analysis should precede manipulation, with special attention to repetitive regions such as HSV-1 repeats that harbor clinically relevant genes (e.g., ICP34.5, ICP4)5. Editing such loci often requires double recombineering, with verification that integration occurred at the intended site.

Oligonucleotide design is also critical. While 30 bp homology arms are generally sufficient, extending to 100 bp can improve efficiency in challenging regions²⁸. High-purity DNA, competent cells, and calibrated equipment are essential. If efficiencies drop, competence should be tested with a control plasmid.

Robust screening is especially important after the second step. Colony PCR with primers spanning the integration junction helps avoid false positives from residual DNA or selection cassettes (Figure 5). ssDNA substrates can further enhance recombination efficiency compared with dsDNA.

Recombineering is versatile but limited by efficiency in large or repetitive regions. Mixed clones may also occur from overcrowded plates or from BACs carrying multiple molecules. These are best resolved by reselection of isolated colonies, or, if necessary, by segregation strategies such as retransformation into fresh strains.

Compared with traditional cloning approaches that rely on restriction enzymes and ligases, recombineering enables seamless, site-specific modification of large DNA constructs. Its precision and versatility expand applications across synthetic biology, virology, and genomics, supporting both basic research and translational development.

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
Ampicillin	any	any	molecular grade
For oligo to amplify Il-12: CTGGCTAGCGTTTAA ACGGGCCCTCTAGACTCG AGCGGCCGCACGCCACCA TGTGTCCTCAGAAGCTAACC	any	any	HPLC purified
For oligo to amplofy AmpR/LacZ/SacB  cassette: CTGGCTAGCGTTTAAA CGGGCCCTCTAGACTCGAG CGGCCGCACGCCACCACC CCTATTTGTTTATTTTTC	any	any	HPLC purified
IPTG	any	any	molecular grade
LB agar
LB medium
Phusion Hot Start II High-Fidelity DNA Polymerase	Thermo Scientific	F549S
Rev oligo to amplify Il12: GGCAACTAGAAGGCA CAGTCGAGGCTGATCAGC GGTTTAAACTTAAGCTTTC AGGCGGAGCTCAGATAG	any	any	HPLC purified
Rev oligo to amplofy AmpR/LacZ/SacB  cassette: GGCAACTAGAAGGCAC AGTCGAGGCTGATCAGC GGTTTAAACTTAAGCTTT TATTTGTTAACTGTTAATTG	any	any	HPLC purified
SacB/AmpR/LacZ selection cassette	this manuscript	-	-
Sucrose	any	any	molecular grade
SW102 with BAC-HSV-1 or BAC-Adv	this manuscript	-	-
Tryptone	any	any	molecular grade
Wizard SV Gel	Promega	A9281
X-gal	any	any	molecular grade
Yeast extract	any	any	molecular grade