Method Article

Recombineering-based Manufacturing of Engineered Viral Vectors for Research and Therapy

DOI:

10.3791/68988

⸱

September 26th, 2025

In This Article

Summary

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Recombineering, a recombination-mediated genetic engineering method, enables precise viral genome modifications without relying on enzymatic digestion. This approach is crucial for basic research, such as targeted deletions, and for developing engineered viruses used in oncolytic therapies, gene therapy, and genetic vaccines, expanding possibilities in both research and clinical applications.

Abstract

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

The increasing demand for engineered viral vectors in both basic and translational research has underscored the need for flexible, rapid, and scalable methods to generate recombinant DNA viruses. Strategies relying on restriction enzyme digestion and ligation are constrained by sequence-dependent limitations and time-consuming cloning steps. Here, we describe the recombination-mediated genetic engineering method (recombineering) that circumvents these limitations by enabling precise and seamless modifications of viral genomes in bacterial artificial chromosomes (BACs). This approach allows for efficient deletion, insertion, or substitution of coding or non-coding genetic elements, providing a powerful platform for high-throughput viral vector development. Recombineering is particularly valuable in basic research applications, such as the deletion or mutation of viral genes to investigate their function. More importantly, this methodology enables the generation of tens of recombinant viruses encoding distinct immunostimulatory or therapeutic payloads in parallel, making it exceptionally well-suited for the rapid preclinical evaluation of novel constructs. While this technology can be potentially implemented for any scientific purpose, this article focuses on the application of recombineering in two specific areas: the generation of oncolytic viruses based on herpes simplex virus, and the development of non-replicative adenoviral vectors for gene transfer. In conclusion, recombineering offers a versatile approach to viral genome engineering, significantly accelerating the pipeline from design to functional testing. Its relevance spans from fundamental virology to translational medicine to meet evolving research and clinical needs.

Introduction

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Viral vectors have emerged as potent tools in gene therapy, oncolytic virotherapy, and genetic vaccine development due to their natural ability to deliver genetic material into host cells. They leverage viruses' natural tropism and transduction mechanisms, facilitating both transient and long-term gene expression. They are able to survive in the extracellular environment, to attach to a specific cellular receptor (that defines the viral tropism) and promote their internalization, to hijack the host cell gene expression machinery and drive the expression of their own genes, and to elude membrane-bound and intracellular sensors of the innate immune arm

Access restricted. Please log in or start a trial to view this content.

Protocol

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

As a prerequisite to recombineering, a proficient bacterial strain (e.g., SW102) with a BAC-Genome of Interest must be available. Although recombineering is a highly efficient method to enrich colonies that have undergone the desired modification, here, we describe a two-step recombineering strategy, referred to as the first and second steps (Figure 1). In the first step, an expression cassette containing both positive and negative selection markers is inserted into the locus of interest. In the second step, this cassette is replaced with the actual genetic modification intended for the final genome. The selection markers used in this stu....

Access restricted. Please log in or start a trial to view this content.

Results

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Generation of an IL12-coding oncolytic Herpes virus
As outlined in the introductory section of this work, one potential application of recombineering is the insertion of immunostimulatory transgenes into the genome of oncolytic viruses, with the aim of enhancing their immunotherapeutic potential. Below, we present an example of such an application using an oncolytic vector based on HSV-1. Specifically, this study investigates the impact of a transgene insertion into an intergenic locus within the Us1.......

Access restricted. Please log in or start a trial to view this content.

Discussion

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

This "RECOMBINEERING" (homologous RECOMBInation-mediated genetic engiNEERING) protocol uses a two-step strategy: first, integration of a selection cassette into the genomic locus of interest, and second, replacement of this cassette with the desired modification (Figure 1).

The selection markers used include ampicillin resistance (AmpR), beta-galactosidase (β-gal), and sacB. AmpR enables antibiotic resistance-based selection, β-gal allows blue/white scre.......

Access restricted. Please log in or start a trial to view this content.

Disclosures

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

The authors have no relevant financial or non-financial interests to disclose.

Acknowledgements

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

This work was supported by: PRIN 2022-MUR Italy, Grant 20224NCSN5 (PreMeRetHOn). POR Campania: piattaforma per lo sviluppo di nuove tecnologie vaccinali. PNRR CN3 National Center for Gene Therapy and Drugs based on RNA Technology. PNRR PE13 One Health Basic and Translational Research Actions addressing Unmet Needs on Emerging Infectious Diseases. The authors thank Geneart synthesis service for providing custom DNAs. The authors also express sincere gratitude to Michele Veneruso, who contributed to the successful completion of this study.

....

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
Ampicillinanyanymolecular grade
For oligo to amplify Il-12: CTGGCTAGCGTTTAA
ACGGGCCCTCTAGACTCG
AGCGGCCGCACGCCACCA
TGTGTCCTCAGAAGCTAACC
anyanyHPLC purified
For oligo to amplofy AmpR/LacZ/SacB  cassette: CTGGCTAGCGTTTAAA
CGGGCCCTCTAGACTCGAG
CGGCCGCACGCCACCACC
CCTATTTGTTTATTTTTC
anyanyHPLC purified
IPTGanyanymolecular grade
LB agar
LB medium
Phusion Hot Start II High-Fidelity DNA Polymerase Thermo ScientificF549S
Rev oligo to amplify Il12: GGCAACTAGAAGGCA
CAGTCGAGGCTGATCAGC
GGTTTAAACTTAAGCTTTC
AGGCGGAGCTCAGATAG 
anyanyHPLC purified
Rev oligo to amplofy AmpR/LacZ/SacB  cassette: GGCAACTAGAAGGCAC
AGTCGAGGCTGATCAGC
GGTTTAAACTTAAGCTTT
TATTTGTTAACTGTTAATTG 
anyanyHPLC purified
SacB/AmpR/LacZ selection cassettethis manuscript--
Sucroseanyanymolecular grade
SW102 with BAC-HSV-1 or BAC-Advthis manuscript--
Tryptoneanyanymolecular grade
Wizard SV GelPromegaA9281
X-galanyanymolecular grade
Yeast extractanyanymolecular grade

References

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,
  1. Froechlich, G., et al. Integrity of the antiviral STING-mediated DNA sensing in tumor cells is required to sustain the immunotherapeutic efficacy of herpes simplex oncolytic virus. Cancers (Basel). 12 (11), 3407(2020).
  2. Froechlich, G., et al.

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Request permission to reuse the text or figures of this JoVE article

Request Permission

Tags

RecombineeringViral VectorsViral Genome EngineeringBacterial Artificial ChromosomesRecombinant DNA VirusesOncolytic VirusesHerpes Simplex VirusAdenoviral VectorsGene TransferHigh Throughput Vector Development

Related Articles