Research Article

Anticancer Effects of Key Constituents of Pileostegia tomentella via ROS-Mediated Classical Apoptosis in Non-Small Cell Lung Cancer Cells

DOI:

10.3791/69008

September 19th, 2025

 ,  ,  ,  ,  ,  , 

Corresponding Authors: Jiangcun Wei <18177479182@163.com>

* These authors contributed equally

In This Article

Summary

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

This protocol presents a method to evaluate reactive oxygen species (ROS)-mediated apoptosis induced by natural compounds in non-small cell lung cancer (NSCLC) cells.

Abstract

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

This study explores the anticancer potential of Pileostegia tomentella, with a particular focus on its ability to induce classical apoptosis in H1299 non-small cell lung cancer (NSCLC) cells through reactive oxygen species (ROS)-mediated pathways. Using a bioactivity-guided isolation approach, two active compounds, umbelliferone (UMB) and epi-Vogeloside, were identified as the major cytotoxic constituents. Both compounds exhibited significant inhibitory effects on cell viability and effectively triggered apoptotic cell death in H1299 cells. Mechanistic investigations demonstrated that treatment with UMB and epi-Vogeloside led to a marked increase in intracellular ROS levels, implicating oxidative stress as a key mediator. Western blot analysis revealed increased levels of cleaved caspase-3 and decreased expression of the anti-apoptotic protein Bcl-2, indicating activation of the intrinsic mitochondrial apoptotic pathway. Additionally, transcriptomic profiling showed widespread alterations in gene expression, further supporting disruption of cellular homeostasis. These results suggest that Pileostegia tomentella and its active constituents hold promise as potential therapeutic agents for lung cancer.

Introduction

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Cancer presents a formidable global public health challenge, characterized by a substantial annual mortality rate. Non-small cell lung cancer (NSCLC) is the principal global driver of cancer-related fatalities, constituting approximately 85% of lung cancer incidences1. Carcinogenesis, an inherently complex interplay of molecular and cellular processes, is critically influenced by disruptions in reactive oxygen species (ROS) homeostasis. ROS, which include unstable oxidants such as superoxide anions, hydroxyl radicals, and hydrogen peroxide, are byproducts of normal cellular metabolism and execute essential functions in signaling, proliferation, differentiation, and apoptosis2. An imbalance in ROS concentrations can precipitate oxidative stress, potentially activating programmed cell death pathways, notably autophagy and apoptosis, thereby impeding cancer cell proliferation and survival3. Consequently, ROS exhibit a dual role in oncology, acting as both promoters and suppressors of tumor progression. In the last decade, therapeutic strategies for NSCLC have advanced significantly, with the development of novel anticancer agents designed to exploit this dichotomous nature of ROS representing a particularly vibrant area of investigation4.

Numerous chemically synthesized anticancer agents, such as adriamycin (doxorubicin), cisplatin, and cyclophosphamide, are known to induce apoptosis in cancer cells by promoting ROS production5. Despite advancements in targeted therapies and immunotherapeutic antibodies, platinum-based chemotherapy continues to be the cornerstone of treatment for NSCLC patients. Nevertheless, the emergence of resistance and adverse side effects from chemotherapy necessitates the development of novel anti-NSCLC drugs. Consequently, exploring natural sources for anticancer compounds is increasingly recognized for its importance and potential. Recent research has highlighted that certain plant extracts and their active components exhibit potent anticancer properties, characterized by low toxicity, high specificity, and the ability to target multiple pathways6. Notably, some of these natural compounds can modulate ROS levels and signaling7, thereby inducing autophagy or apoptosis in cancer cells and exerting therapeutic effects8,9.

Pileostegia tomentella Hand. Zucc, a perennial herb from the Clematis genus within the Buttercupaceae family, is predominantly found in regions like Japan, North Korea, and China. The plant's various components, including roots, stems, leaves, and flowers, are known for their medicinal properties, offering benefits such as heat clearance, detoxification, swelling reduction, pain relief, and antibacterial and anti-inflammatory effects. Recent research has shed light on the anticancer activities of Hoshi Hairy Vine extracts or active ingredients, demonstrating tumor-suppressive effects on a range of cancers, including glioma, breast, colon, and cervical cancer10. However, the specific anticancer mechanisms of Pileostegia tomentella, particularly its potential role in modulating ROS to induce autophagy or apoptosis in cancer cells, remain largely unexplored.

Despite emerging interest in natural compounds for cancer therapy, the pro-apoptotic mechanisms of key constituents from Pileostegia tomentella in lung cancer remain unexplored. This study pioneers the identification and mechanistic dissection of umbelliferone and epi-Vogeloside as selective ROS-dependent apoptosis inducers in NSCLC.

Protocol

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

The reagents and equipment used in this study are listed in the Table of Materials.

1. Chemical composition of Pileostegia tomentella and NSCLC target prediction

The chemical constituents of Pileostegia tomentella were analyzed using high-performance liquid chromatography combined with linear ion trap-Orbitrap mass spectrometry (HPLC-LTQ/MS). Extracts were dissolved in appropriate solvents and filtered before injection. Chromatographic separation was achieved using a reversed-phase column under a gradient elution program tailored for the compound classes. Mass spectrometry data were collected in positive electrospray ionization mode across a mass range of 100-1500 m/z. Molecular structures of identified compounds were drawn using generic chemical drawing software and saved in SDF format. These structural files were submitted to an online target prediction tool to identify potential biological targets, with the top 20 targets selected for further validation. NSCLC-associated targets were retrieved from a publicly accessible gene database. The overlapping targets from both datasets were identified as potential therapeutic targets of Pileostegia tomentella.

2. Component-target network construction

Protein-protein interaction data for predicted targets were obtained from an open-access protein interaction database. Interaction data were imported into general network visualization software to construct the compound-target interaction network. Network topological properties, including degree centrality, betweenness, and closeness, were analyzed using built-in analytical tools to identify key regulatory nodes.

3. KEGG pathway enrichment analysis

Functional enrichment of predicted target proteins was performed using KEGG pathway analysis via publicly available enrichment tools and statistical software. Pathways with adjusted p-values less than 0.05 were considered significant. Significant pathways were integrated with compound-target data to build a "compound-target-pathway" interaction network using generic network visualization software. Network topology analysis highlighted key biological regulatory hubs, illustrating the multi-component and multi-target mechanisms of Pileostegia tomentella.

4. Extraction of Pileostegia tomentella constituents

Dried vine stems of Corydalis spinosa were grounded into a fine powder. The powdered material was extracted with 70% ethanol under ultrasonic treatment at room temperature for a defined period. The crude extract was filtered and concentrated under reduced pressure. Liquid-liquid partitioning was performed using solvents of increasing polarity, including petroleum ether, ethyl acetate, and n-butanol. The ethyl acetate fraction, which showed the highest biological activity in preliminary assays, was collected, concentrated, freeze-dried, and stored at -20 °C until further use.

5. Cell line and treatment conditions

The human lung cancer cell line H1299 was cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum at 37 °C in a humidified atmosphere containing 5% CO2. Cells were seeded at an appropriate density and allowed to adhere overnight before treatment. The cells were exposed to varying concentrations (500 µg/mL, 750 µg/mL, and 1,000 µg/mL) of two test compounds, UMB and epi-Vogeloside, as listed in Table 1. After 24 h of incubation under standard culture conditions, the cells were harvested for subsequent analyses to assess the biological effects of the compounds.

6. MTT assay for cell viability

The cytotoxic effects of the compounds were evaluated using a colorimetric MTT assay. H1299 cells were seeded into 96-well plates at a defined density and allowed to adhere overnight. Cells were then treated with the test compounds for 72 h under standard culture conditions. Following treatment, a solution of MTT was added to each well and incubated to allow viable cells to convert MTT into insoluble purple formazan crystals. After incubation, the medium was removed, and the formazan crystals were dissolved in dimethyl sulfoxide (DMSO). Absorbance was measured at 570 nm using a microplate reader. The absorbance values correspond to cell viability, providing a quantitative assessment of compound cytotoxicity.

7. Assessment of membrane integrity via LDH release

Cell membrane integrity was assessed by measuring lactate dehydrogenase (LDH) release as an indicator of cytotoxicity. H1299 cells were treated with the test compounds for 24 h, 48 h, or 72 h. At each time point, culture supernatants were collected and subjected to an LDH activity assay according to the manufacturer's protocol. Since LDH is released only from cells with damaged membranes, the absorbance values measured reflect the extent of membrane damage induced by the compounds over time.

8. Flow cytometric analysis of apoptosis

Apoptosis induction was assessed by flow cytometry using Annexin V and 7-Aminoactinomycin D (7-AAD) staining. Following treatment with the test compounds, H1299 cells were collected by centrifugation, washed with cold phosphate-buffered saline, and resuspended in binding buffer. Cells were then incubated with Annexin V conjugated to a fluorescent dye and 7-AAD according to the staining protocol. Samples were immediately analyzed by flow cytometry. This method allowed differentiation among viable cells (unstained), early apoptotic cells (Annexin V positive, 7-AAD negative), and late apoptotic or necrotic cells (positive for both stains).

9. Intracellular ROS quantification

Intracellular reactive oxygen species (ROS) levels were measured using a fluorescence-based assay. H1299 cells were seeded in 12-well plates at a density of 1 × 105 cells per well and cultured until reaching approximately 80% confluence. Cells were then treated with the designated compounds for 72 h. Following treatment, cells were incubated with 1 µM of the ROS-sensitive fluorescent probe 2',7'-dichlorodihydrofluorescein diacetate (DCFH-DA) at 37 °C for 30 min in the dark. After incubation, cells were harvested, and fluorescence intensity was measured at an emission wavelength of 525 nm using a fluorescence microplate reader. The fluorescence intensity corresponds to the intracellular ROS levels.

10. Real-time quantitative PCR (RT-qPCR)

H1299 cells were seeded in 6-well plates at a density of 2 × 105 cells per well and cultured until reaching approximately 80% confluence. Cells were then treated with the designated compounds for 72 h. Total RNA was extracted using a widely used phenol-chloroform method. Complementary DNA (cDNA) synthesis was performed using a reverse transcription kit according to the manufacturer's instructions. Quantitative real-time PCR (qRT-PCR) was conducted using a real-time PCR system with specific primers (listed in Table 2). Relative gene expression levels were calculated using the comparative Ct method, with housekeeping genes used as internal controls.

11. Immunoblotting for protein expression

Western blot analysis was conducted on H1299 cells cultured and treated. Total protein was extracted using an appropriate lysis buffer, and lysates were clarified by centrifugation at 10,000 × g for 15 min at 4 °C. Protein concentrations were determined using a spectrophotometric assay. Equal amounts of protein from each sample were separated by SDS-PAGE and transferred onto a polyvinylidene difluoride (PVDF) membrane. Membranes were blocked with 5% non-fat dry milk for 2 h at room temperature and then incubated overnight at 4 °C with primary antibodies specific for Bcl-2, caspase-3, PARP1, BAX, GAPDH, and Tubulin at optimized dilutions. After washing, membranes were incubated with appropriate secondary antibodies for 2 h at room temperature. Protein bands were visualized and imaged using a chemiluminescent substrate. Densitometric analysis was performed with image analysis software, and band intensities were normalized to GAPDH and Tubulin as loading controls.

12. Immunofluorescence microscopy of Caspase-3

The expression and subcellular localization of caspase-3, a key apoptotic protein, were evaluated by immunofluorescence staining. After treatment, H1299 cells were fixed with paraformaldehyde, permeabilized with a mild detergent solution, and incubated with a primary antibody against caspase-3. A fluorescently labeled secondary antibody was then applied to detect the primary antibody signal. Cell nuclei were counterstained using a DNA-binding fluorescent dye. The stained cells were visualized under a fluorescence microscope. The intensity and cellular distribution of the fluorescence signal provided qualitative and spatial information on caspase-3 activation, supporting its involvement in the compound-induced apoptotic response.

13. Transcriptomic sequencing

To profile the cellular transcriptional response to the test compounds, total RNA was extracted from treated H1299 cells and assessed for integrity using standard quality control methods. Sequencing libraries were prepared following established protocols and subjected to high-throughput sequencing using a next-generation sequencing platform. Raw sequencing data were processed through a conventional bioinformatics pipeline, which included quality control filtering, alignment to the reference genome, and quantification of transcript abundance. Differential gene expression analysis was conducted to identify genes with statistically significant changes in expression following treatment. Enrichment and pathway analyses of the differentially expressed genes were performed to elucidate the key biological processes affected by the compounds, thereby providing a comprehensive transcriptomic overview of their molecular effects.

14. Statistical analysis

All data are expressed as the mean ± standard deviation (SD) from at least three independent experiments. Statistical significance between groups was determined using standard methods, including Student's t-test or one-way ANOVA, where appropriate. Differences were considered statistically significant for P-values less than 0.05.

Results

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Screening of key components of Pileostegia tomentella against lung cancer
An overview of the experimental design is presented in Figure 1. HPLC-LTQ/Orbitrap MS was employed to characterize seven principal bioactive constituents present in Pileostegia tomentella (Table 3). Subsequently, an in silico target prediction was conducted on these compounds using the SwissTargetPrediction database11, filtering results to include only those with interaction probabilities exceeding 0.1. This analysis yielded 260 prospective gene targets. Concurrently, NSCLC-associated targets were sourced from the GeneCards database. A comparative assessment identified 59 overlapping genes between the predicted compound targets and the NSCLC-relevant genes (Figure 2A). To visually represent these relationships, a compound-target interaction network was constructed utilizing Cytoscape. This network aimed to elucidate the potential molecular mechanisms underpinning P. tomentella's therapeutic effects in NSCLC (Figure 2B). Topological analysis of this network, assessing parameters such as degree, betweenness centrality, and closeness centrality, underscored EGFR, AKT1, and PTGS2 as pivotal nodes (Table 4), suggesting their critical role in mediating the observed therapeutic activity. Furthermore, functional annotation through KEGG pathway enrichment, executed via the DAVID bioinformatics platform, pinpointed key signaling pathways likely modulated by the identified candidate targets (Figure 2C).

UMB and epi-Vogeloside treatments affect cell viability
The cytotoxic potential of UMB and epi-Vogeloside, two pharmacologically active compounds derived from Pileostegia tomentella, was evaluated in H1299 cells subjected to escalating concentrations (100-1,000 µg/mL) over time intervals of 24 h, 48 h, and 72 h. MTT assays demonstrated a pronounced decline in cell viability that was both dose- and time-responsive following exposure to either compound (Figure 3A). To elucidate the mode of cell death, apoptosis was quantified by flow cytometry using Annexin V-PE and 7-AAD staining. A notable increase in early apoptotic cells was detected after 72 h of treatment, with a clear concentration-dependent pattern, while negligible apoptosis was observed in untreated controls. LDH release remained relatively low in the treatment groups despite pronounced cytotoxicity, supporting apoptosis rather than necrosis as the primary mode of cell death. Intracellular ROS accumulation was further assessed to investigate upstream events. Treatment with 1,000 µg/mL of UMB or epi-Vogeloside resulted in a progressive increase in ROS levels, reaching statistical significance at 6 h and 12 h post-treatment (Figure 3B-D). Collectively, these data suggest that ROS overproduction may serve as a proximal signal initiating apoptosis in response to UMB and epi-Vogeloside exposure in NSCLC cells.

UMB and epi-Vogeloside induce apoptosis via modulation of pro- and anti-apoptotic factors
The pro-apoptotic activity of UMB and epi-Vogeloside was further investigated through transcriptomic and protein-level analyses of apoptosis-associated regulators. H1299 cells treated with increasing concentrations (500 µg/mL, 750 µg/mL, and 1,000 µg/mL) of each compound exhibited significant shifts in the mRNA expression of Caspase-3, BAX, PARP1, and Bcl-2 (Figure 4A). Both compounds induced a dose-dependent upregulation of Caspase-3 and BAX, coupled with a notable suppression of Bcl-2 expression, suggesting activation of intrinsic apoptotic pathways. Western blot analysis corroborated these transcriptomic changes, revealing enhanced cleavage of caspase-3 and PARP1 -- hallmark indicators of apoptosis execution. A corresponding reduction in Bcl-2 protein levels was observed, further supporting the downregulation of anti-apoptotic signaling. These effects were most prominent at the highest concentration tested (1,000 µg/mL) for both compounds (Figure 4B). Immunofluorescence staining for cleaved caspase-3 provided additional spatial and visual confirmation. Cells exposed to UMB or epi-Vogeloside displayed a marked increase in green fluorescence intensity, indicative of active caspase-3 accumulation (Figure 4C). Notably, this response intensified with higher compound concentrations and was consistent with the transcriptional and immunoblotting data. Together, these results establish that UMB and epi-Vogeloside promote apoptosis in H1299 cells through coordinated enhancement of pro-apoptotic signaling and attenuation of anti-apoptotic defenses. The consistency across gene expression, protein activation, and cellular imaging strengthens the evidence supporting their therapeutic potential as apoptosis-inducing agents in NSCLC.

UMB and epi-Vogeloside treatments induce distinct transcriptomic signatures
Transcriptomic profiling via RNA sequencing revealed substantial and distinct alterations in the gene expression profiles of H1299 cells following treatment with UMB or epi-Vogeloside. Principal component analysis (PCA) of DEseq2-normalized expression values clearly segregated samples from both UMB- and epi-Vogeloside-treated groups from the untreated control group, indicating a significant global transcriptional impact (Figure 5A). GO enrichment analysis (Gorilla tool) of differentially expressed (DE) genes in the epi-Vogeloside arm highlighted significant disparities in transcriptional patterns relative to controls; these differences were visually underscored by heatmap distributions and hierarchical clustering (Figure 5B). Volcano plots (Figure 5C) revealed that epi-Vogeloside elicited a markedly greater number of DE gene transcripts than UMB, suggesting a more extensive perturbation of the H1299 cell transcriptome. Outputs from DESeq2 differential expression analysis, including volcano plots (Figure 5D), confirmed numerous significantly up- and downregulated transcripts specifically within the epi-Vogeloside group, characterized by wide variance in both fold-change magnitudes and statistical significance. Functional GO annotation of these DE genes implicated their involvement in diverse biological processes, such as cell cycle progression, apoptosis, cell migration, differentiation, and signal transduction pathways (Figure 5E). Collectively, these comprehensive transcriptomic analyses established that epi-Vogeloside exerted a more profound and widespread impact, affecting gene expression levels, patterns, the extent of differential expression, the magnitude of fold changes, and the spectrum of implicated biological functions in H1299 cells when compared to UMB.

DATA AVAILABILITY:
All data generated in this study have been presented and discussed within the manuscript. The raw data is provided in Supplementary File 1.

Anti-cancer research flowchart: Pileostegia tomentella, apoptosis via ROS, in silico and in vitro analysis.
Figure 1: Schematic representation of the experimental workflow. Please click here to view a larger version of this figure.

Venn diagram, network map, and bar chart of drug-disease targets in bioinformatics analysis.
Figure 2: Screening of key components of Pileostegia tomentella against lung cancer. (A) Disease Target Intersection Venn Diagram. This diagram likely illustrates the overlap between the gene targets related to NSCLC and the active targets of the compounds found in Pileostegia tomentella. (B) Flow cytometry analysis of apoptosis induced by Umbelliferone and epi-Vogeloside in H1299 cells. (C) KEGG Pathway Enrichment Analysis. This analysis visualizes the signaling pathways significantly associated with the candidate targets, suggesting potential mechanisms through which Pileostegia tomentella may exert therapeutic effects in NSCLC. Please click here to view a larger version of this figure.

Cell viability analysis: dosage vs. time graphs, flow cytometry, LDH release, fluorescence microscopy.
Figure 3: Effects of UMB and epi-Vogeloside treatment on cells. (A) Cell viability assessed by MTT assay following treatment with varying concentrations of UMB and epi-Vogeloside over 24 h, 48 h, and 72 h, indicating a dose- and time-dependent cytotoxic effect. (B) Apoptosis quantified by flow cytometry using Annexin V-PE/7-AAD staining, showing increased early apoptotic cell populations after treatment. (C) LDH release assay results reflecting cell membrane integrity, with minimal LDH release observed, supporting apoptosis rather than necrosis as the primary mode of cell death. (D) Intracellular ROS levels measured at 6 h and 12 h post-treatment with 1,000 µg/mL of UMB or epi-Vogeloside, indicating progressive ROS accumulation as a potential upstream apoptotic trigger. *p < 0.05, **p < 0.01, ***p < 0.005, ****p < 0.001. Scale bars: 50 µm. Please click here to view a larger version of this figure.

Gene expression and protein analysis; bar graphs, Western blots, fluorescence microscopy; apoptosis study
Figure 4: Apoptosis-related protein and mRNA expression in H1299 cells treated with UMB and epi-Vogeloside. (A) RT-qPCR analysis showing the mRNA levels of apoptosis-related proteins. (B) Western blot analysis depicting the protein expression levels. (C) Cellular immunofluorescence highlighting the activation of Caspase-3. Scale bars: 50 µm; *p < 0.05, **p < 0.01, ***p < 0.005, ****p < 0.001. Please click here to view a larger version of this figure.

Gene ontology enrichment bar charts: molecular function analysis, enrichment scores, GO term comparison.
Figure 5: Integrated transcriptomics of Umbelliferone and epi-Vogeloside treated H1299 cells. (A) GO analysis of the effect of UMB treatment on H1299 cells. (B) KEGG analysis of UMB treatment. (C) GO analysis of epi-Vogeloside treatment. (D) KEGG analysis of epi-Vogeloside treatment. Please click here to view a larger version of this figure.

GroupTreatment
Control groupNo drug treatment
Experiment 1Treated with 500 µg/mL UMB
Experiment 2Treated with 750µg/mL UMB
Experiment 3Treated with 1000 µg/mL UMB
Experiment 4Treated with 500 µg/mL epi-Vogeloside
Experiment 5Treated with 750µg/mL epi-Vogeloside
Experiment 6Treated with 1000 µg/mL epi-Vogeloside

Table 1: Cell grouping and processing.

GenePrimer DirectionSequence (5′→3′)
Bcl-2ForwardGGTGGGGTCATGTGTGTGG
ReverseCGGTTCAGGTACTCAGTCATCC
Caspase-3ForwardGAAATTGTGGAATTGATGCGTGA
ReverseCTACAACGATCCCCTCTGAAAAA
PARPForwardTGCAGGAGGAGCAACTGACT
ReverseGGTCTCCTCCTCAGCATCTC
GAPDHForwardAATCCCATCACCATCTTCCA
ReverseTGGACTCCACGACGTACTCA

Table 2: Primer sequences.

Molecule IDMolecule nameMWAlogPHdonHaccOB (%)Caco-2BBBDLFASA-TPSARBN
MOL002558Skimmetin162.151.631327.370.740.520.050.4350.440
MOL000655Loganic acid376.4-2.336104.92-1.81-2.510.40.26166.144
MOL013083Skimmin 324.31-0.274838.35-1.02-1.570.320.3129.593
MOL003025vogeloside388.41-1.784105.62-1.17-1.580.460.24144.145
MOL002095diethyl phthalate222.262.240452.190.720.570.070.3852.66
MOL003018secologanin388.41-1.9841023.59-1.58-2.160.360.27151.988
MOL000651Sweroside aglycone196.220.151468.680.15-0.030.080.355.761

Table 3: Screening of key components.

NameBetweenness unDirCloseness unDirDegree unDir
EGFR208.72259090.01388944
AKT1202.09899120.01408545
PTGS293.300486020.01265837
GSK3B47.287340760.01123629
TNF199.6854630.01428646
MMP253.553565190.01204834
NFKB155.472218160.01204835
ERBB2170.96567580.01298739
MMP9147.31305230.01333342
PDGFRB122.51102670.01030920
ESR183.594800440.01234635

Table 4: Topological parameters of the "Drug-Constituent-Target" network.

Supplementary File 1: Raw data generated in the study. Please click here to download this File.

Discussion

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Non-small cell lung cancer (NSCLC) remains a pressing global health concern, characterized by its aggressive biology, rapid clinical progression, and high metastatic potential, frequently resulting in poor patient outcomes12. Although standard interventions, such as surgical resection, radiotherapy, and chemotherapy, offer therapeutic benefit in early-stage disease, their effectiveness diminishes in advanced stages due to the emergence of drug resistance and the burden of systemic toxicity. The underlying pathogenesis of lung cancer is complex and not yet fully delineated13,14. In Traditional Chinese Medicine (TCM), NSCLC has historically been associated with internal imbalances such as qi deficiency, phlegm accumulation, and toxin formation15,16. While these conceptual frameworks offer cultural insight, they lack direct molecular correlates and are therefore not emphasized in the mechanistic interpretation of this study.

Pileostegia tomentella, a plant species abundant in diverse phytochemicals including flavonoids, glycosides, coumarins, terpenoids, and aromatic compounds, has been reported to possess significant antioxidant and antineoplastic activities17. However, its biological activity, particularly against lung cancer, remains underexplored. This study identified two bioactive constituents, umbelliferone (UMB) and epi-Vogeloside, from P. tomentella, which exhibited significant antiproliferative effects in H1299 NSCLC cells, mediated through reactive oxygen species (ROS)-induced apoptosis. Treatment with UMB or epi-Vogeloside induced a dose-dependent increase in ROS generation, accompanied by elevated lactate dehydrogenase (LDH) release and apoptotic cell death. These effects suggest that oxidative stress serves as a proximal trigger of cell death via mitochondrial dysfunction. Flow cytometry, qRT-PCR, Western blotting, and immunofluorescence confirmed activation of the intrinsic apoptotic pathway, with upregulation of pro-apoptotic markers (BAX, caspase-3, PARP1) and downregulation of the anti-apoptotic protein Bcl-218.

UMB, a 7-hydroxycoumarin derivative found in various medicinal plants, has previously shown anti-inflammatory and antitumor properties19. Its incorporation into nano-delivery systems may enhance its pharmacokinetics and therapeutic potency20. Epi-Vogeloside, though traditionally used as a detoxifying agent, possesses broad pharmacological activities including antioxidant, antimicrobial, and immunomodulatory effects21.

Transcriptomic profiling revealed distinct molecular signatures induced by the two compounds. UMB significantly affected immune-related and intracellular signaling pathways, with KEGG enrichment implicating the T-cell receptor signaling axis -- suggesting potential immune modulation. Epi-Vogeloside predominantly altered genes involved in ATP metabolism and cellular energetics, reflecting a cytotoxic mechanism rooted in metabolic disruption. These findings support a model wherein UMB and epi-Vogeloside exert complementary antitumor effects via redox imbalance and pathway-specific interference. This study also highlights the value of integrating omics technologies to unravel the pleiotropic actions of phytochemicals. The application of transcriptomics and pathway enrichment helped delineate compound-specific mechanisms and provided a rationale for their use in NSCLC treatment strategies. However, this study has limitations. It was conducted in vitro using a single NSCLC cell line; in vivo validation is necessary to evaluate systemic efficacy and toxicity. In addition, the ROS detection method (DCFH-DA) lacks subcellular resolution, and future studies could employ redox proteomics or compartment-specific probes for mechanistic precision. Alternative strategies, such as CRISPR-mediated knockout of apoptosis regulators, rescue assays with ROS scavengers, or synergy testing with platinum-based chemotherapy, may further validate the current findings and enhance translational relevance. Given the central role of ROS signaling in other malignancies and chronic diseases, these compounds may also exhibit broader therapeutic applications beyond NSCLC.

In conclusion, this study provides novel molecular evidence that UMB and epi-Vogeloside, derived from Pileostegia tomentella, induce intrinsic apoptosis in NSCLC cells via ROS-mediated mitochondrial pathways. Their distinct transcriptomic impacts underscore the potential for precision targeting redox or metabolic vulnerabilities in lung cancer. Further exploration of their pharmacodynamics, bioavailability, and combinatory potential with existing therapies will be critical for advancing their translational use.

Disclosures

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

The authors have no conflicts of interest to declare.

Acknowledgements

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

This work was supported by the High-level Key Discipline Construction Project of Traditional Chinese Medicine - Ethnic Minority Pharmacy (Zhuang Pharmacy) from the State Administration of Traditional Chinese Medicine (No. zyyzdxk-2023165); the Talent Cultivation Program "Youth Project" of Guangxi International Zhuang Medical Hospital (No. 2022001); the Multidisciplinary Cross-Innovation Team Project in Chinese Medicine of Guangxi (No. GZKJ2309); the High-Level Talent Cultivation Innovation Team Program of Guangxi University of Traditional Chinese Medicine (No. 2022A008); the Key Research and Development Project of the Guangxi Science and Technology Department (No. Gui Ke AB21196057); the 2023 Three-Year Action Plan for High-Level Talent Team Construction of Guangxi International Zhuang Medical Hospital (Nos. GZCX20231203, GZCX20231202); the Third Batch of the "Qihuang Project" High-Level Talent Team Cultivation Program of Guangxi University of Traditional Chinese Medicine (No. 202414).

AUTHOR CONTRIBUTION:

Wen Zhong, Leimin Jiang, and Bing Qing contributed equally to this work and share first authorship. They were primarily responsible for experimental design, data acquisition, and interpretation of results. Xiumei Ma conducted data analysis and contributed to manuscript preparation. Shi Xianyi, Deng Qingmei, and Zhou Guangyun participated in study design, data collection, and literature research. Jiangcun Wei, the corresponding author, oversaw data analysis and interpretation and played a leading role in drafting and revising the manuscript.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
Annexin V–PE / 7-AAD Apoptosis Detection KitBD Biosciences556547Flow cytometry-based apoptosis detection
Antibody: BAXAbcamab32503Western blot for pro-apoptotic protein
Antibody: Bcl-2Abcamab182858Western blot/immunofluorescence
Antibody: Cleaved Caspase-3Abcamab32042Western blot / IF
Antibody: GAPDHAbcamab8245Internal control in Western blot
Antibody: PARP1Abcamab32064Western blot for apoptosis marker
Antibody: TubulinAbcamab78078Internal control in Western blot
ChemDrawPerkinElmer InformaticsCCG821391Structure drawing of small molecules
Chemiluminescence Imaging SystemTanon Science & TechnologyTanon 5200For visualizing protein bands
CytoscapeCytoscape.orghttps://cytoscape.orgNetwork construction and analysis
DAPI Nuclear StainSigma D9542Blue nuclear counterstain for IF
DAVIDNIHhttps://david.ncifcrf.govFunctional annotation and KEGG pathway enrichment
DMSOSigma 
MFCD00002089
Used to dissolve formazan crystals
Ethanol (for extraction)SigmaMFCD00003568Ultrasonic-assisted extraction solvent
Ethyl AcetateSigmaMFCD00009171Used for bioactive fractionation
FITC-conjugated Secondary AntibodyAbcamab6785Used in immunofluorescence
Flow CytometerThermo ScientificA29001Used for apoptosis and ROS detection
Fluorescence MicroscopeOlympus CorporationBX53FFor imaging immunofluorescence slides
Freeze DryerLabconco Corporation7670520For sample lyophilization and preservation
GeneCardsWeizmann Institutehttps://www.genecards.orgGene database for disease relevance
HPLC-LTQ-Orbitrap Mass SpectrometryThermo ScientificIQLAAEGAAVFACZMAIKCompound identification by MS
Illumina NovaSeq Sequencing PlatformIllumina Inc.20012850Used for RNA-seq
LDH Cytotoxicity Assay KitBeyotimeC0016For measuring LDH release as cytotoxicity indicator
Microplate ReaderThermo ScientificVL0000D0For absorbance measurements in MTT and LDH assays
MTT Cell Viability Assay KitBeyotime C0009SUsed for MTT assay to assess cell viability
qPCR MachineThermo Scientific4485701For gene expression analysis
R softwareR Foundationhttps://www.r-project.orgStatistical computing and pathway plotting
Reverse Transcription Kit (RT Kit)VazymeMR201For cDNA synthesis
RNA-seq Library Prep KitIllumina Inc.20020594Library preparation for sequencing
SwissTargetPredictionSwiss Institutehttp://www.swisstargetprediction.chCompound-target prediction tool
SYBR Green qPCR MixVazymeQ311-02For quantitative PCR
TRIzol Reagent (RNA extraction)Sigma T3934For total RNA extraction
Ultrasonic CleanerBransonM1800-CPXHFor ultrasonic-assisted extraction
Western Blot ApparatusThermo ScientificA56727Gel electrophoresis and protein transfer

References

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,
  1. Pyoluteorin induces apoptosis and autophagy in NSCLC cells. Biol Pharm Bull. 44 (7), 976-983 (2021).">Fan, D., Yu, S., Yang, Y., Qu, S. Pyoluteorin induces apoptosis and autophagy in NSCLC cells. Biol Pharm Bull. 44 (7), 976-983 (2021).
  2. Modulating ROS to overcome multidrug resistance in cancer. Drug Resist Updat. 41, 1-25 (2018).">Cui, Q., et al. Modulating ROS to overcome multidrug resistance in cancer. Drug Resist Updat. 41, 1-25 (2018).
  3. The double-edged roles of ROS in cancer prevention and therapy. Theranostics. 11 (10), 4839-4857 (2021).">Wang, Y., et al. The double-edged roles of ROS in cancer prevention and therapy. Theranostics. 11 (10), 4839-4857 (2021).
  4. Reactive oxygen species (ROS): Key components in cancer therapies. Anticancer Agents Med Chem. 22 (2), 215-222 (2022).">Sahoo, B. M., Banik, B. K., Borah, P., Jain, A. Reactive oxygen species (ROS): Key components in cancer therapies. Anticancer Agents Med Chem. 22 (2), 215-222 (2022).
  5. Ros in cancer therapy: The bright side of the moon. Exp Mol Med. 52 (2), 192-203 (2020).">Perillo, B., et al. Ros in cancer therapy: The bright side of the moon. Exp Mol Med. 52 (2), 192-203 (2020).
  6. Naturally occurring anticancer compounds: Shining from Chinese herbal medicine. Chin Med. 14, 48(2019).">Luo, H., et al. Naturally occurring anticancer compounds: Shining from Chinese herbal medicine. Chin Med. 14, 48(2019).
  7. Quercetin hinders microglial activation to alleviate neurotoxicity via the interplay between NLRP3 inflammasome and mitophagy. Redox Biol. 44, 102010(2021).">Han, X., et al. Quercetin hinders microglial activation to alleviate neurotoxicity via the interplay between NLRP3 inflammasome and mitophagy. Redox Biol. 44, 102010(2021).
  8. Ainsliadimer a induces ROS-mediated apoptosis in colorectal cancer cells via directly targeting peroxiredoxin 1 and 2. Cell Chem Biol. 30 (3), 295-307.e5 (2023).">Lv, C., et al. Ainsliadimer a induces ROS-mediated apoptosis in colorectal cancer cells via directly targeting peroxiredoxin 1 and 2. Cell Chem Biol. 30 (3), 295-307.e5 (2023).
  9. Andrographolide promoted ferroptosis to repress the development of non-small cell lung cancer through activation of the mitochondrial dysfunction. Phytomedicine. 109, 154601(2023).">Jiaqi, L., et al. Andrographolide promoted ferroptosis to repress the development of non-small cell lung cancer through activation of the mitochondrial dysfunction. Phytomedicine. 109, 154601(2023).
  10. Total coumarins of Pileostegia tomentella induces cell death in SCLC by reprogramming metabolic patterns, possibly through attenuating β-catenin/AMPK/sirt1. Chin Med. 18 (1), 1(2023).">Liu, Y., et al. Total coumarins of Pileostegia tomentella induces cell death in SCLC by reprogramming metabolic patterns, possibly through attenuating β-catenin/AMPK/sirt1. Chin Med. 18 (1), 1(2023).
  11. Swisstargetprediction: Updated data and new features for efficient prediction of protein targets of small molecules. Nucleic Acids Res. 47 (W1), W357-W364 (2019).">Daina, A., Michielin, O., Zoete, V. Swisstargetprediction: Updated data and new features for efficient prediction of protein targets of small molecules. Nucleic Acids Res. 47 (W1), W357-W364 (2019).
  12. New options and open issues in the management of unresectable stage III and in early-stage NSCLC: A report from an expert panel of Italian medical and radiation oncologists - interaction group. Crit Rev Oncol Hematol. 190, 104108(2023).">Catania, C., et al. New options and open issues in the management of unresectable stage III and in early-stage NSCLC: A report from an expert panel of Italian medical and radiation oncologists - interaction group. Crit Rev Oncol Hematol. 190, 104108(2023).
  13. Biomarker-targeted therapies in non-small cell lung cancer: Current status and perspectives. Cells. 11 (20), 3200(2022).">Guo, H., et al. Biomarker-targeted therapies in non-small cell lung cancer: Current status and perspectives. Cells. 11 (20), 3200(2022).
  14. Small-cell lung cancer update on targeted and immunotherapies. Int J Mol Sci. 24 (9), 8129(2023).">Mcnamee, N., Da Silva, I. P., Nagrial, A., Gao, B. Small-cell lung cancer update on targeted and immunotherapies. Int J Mol Sci. 24 (9), 8129(2023).
  15. The sodium new houttuyfonate suppresses NSCLC via activating pyroptosis through tcons-14036/mir-1228-5p/prkcdbp pathway. Cell Prolif. 56 (7), e13402(2023).">Jiang, R., et al. The sodium new houttuyfonate suppresses NSCLC via activating pyroptosis through tcons-14036/mir-1228-5p/prkcdbp pathway. Cell Prolif. 56 (7), e13402(2023).
  16. Non-small cell lung cancer in China. Cancer Commun (Lond). 42 (10), 937-970 (2022).">Chen, P., Liu, Y., Wen, Y., Zhou, C. Non-small cell lung cancer in China. Cancer Commun (Lond). 42 (10), 937-970 (2022).
  17. Mitochondriotropic antioxidant based on caffeic acid antioxcin(4) activates Nrf2-dependent antioxidant defenses and quality control mechanisms to antagonize oxidative stress-induced cell damage. Free Radic Biol Med. 179, 119-132 (2022).">Amorim, R., et al. Mitochondriotropic antioxidant based on caffeic acid antioxcin(4) activates Nrf2-dependent antioxidant defenses and quality control mechanisms to antagonize oxidative stress-induced cell damage. Free Radic Biol Med. 179, 119-132 (2022).
  18. Small-molecule inhibition of ape1 induces apoptosis, pyroptosis, and necroptosis in non-small cell lung cancer. Cell Death Dis. 12 (6), 503(2021).">Long, K., et al. Small-molecule inhibition of ape1 induces apoptosis, pyroptosis, and necroptosis in non-small cell lung cancer. Cell Death Dis. 12 (6), 503(2021).
  19. Umbelliferon: A review of its pharmacology, toxicity and pharmacokinetics. Inflammopharmacology. 31 (4), 1731-1750 (2023).">Lin, Z., Cheng, X., Zheng, H. Umbelliferon: A review of its pharmacology, toxicity and pharmacokinetics. Inflammopharmacology. 31 (4), 1731-1750 (2023).
  20. Umbelliferone (7-hydroxycoumarin): A non-toxic antidiarrheal and antiulcerogenic coumarin. Biomed Pharmacother. 129, 110432(2020).">Cruz, L. F., et al. Umbelliferone (7-hydroxycoumarin): A non-toxic antidiarrheal and antiulcerogenic coumarin. Biomed Pharmacother. 129, 110432(2020).
  21. Systematic review of lonicerae japonicae flos: A significant food and traditional Chinese medicine. Front Pharmacol. 13, 1013992(2022).">Zheng, S., et al. Systematic review of lonicerae japonicae flos: A significant food and traditional Chinese medicine. Front Pharmacol. 13, 1013992(2022).

Reprints and Permissions

Request permission to reuse the text or figures of this JoVE article

Request Permission

Tags

Pileostegia TomentellaNon Small Cell Lung CancerROS Mediated ApoptosisClassical ApoptosisUmbelliferoneEpi VogelosideCell ViabilityOxidative StressMitochondrial Apoptotic PathwayWestern Blot

Related Articles