An Optimized Sequential Isolation of Crypts and Mesenchymal Stromal Cells from Porcine Intestinal Tissue

Summary

This study provides a stepwise protocol for the sequential isolation of intestinal crypts and intestinal mesenchymal stromal cells (iMSCs) from porcine jejunal tissue. The method generates 2D enteroid monolayers and iMSCs suitable for developing reproducible, physiologically relevant epithelial-stromal co-culture models to investigate cellular crosstalk during intestinal homeostasis and regeneration.

Abstract

The intestinal epithelium closely interacts with the underlying intestinal mesenchymal stromal cells (iMSCs) to regulate development, homeostasis, and regeneration. However, standardized methods for sequentially isolating both epithelial and stromal fractions from porcine tissue are limited. This protocol describes an optimized stepwise process for isolating crypts and iMSCs from the same jejunal segment of piglets. The method uses an ethylenediaminetetraacetic acid/dithiothreitol (EDTA/DTT)-based dissociation buffer to release crypts, followed by collagenase/dispase digestion of the extracellular matrix to isolate iMSCs. This approach minimizes spatial variations in the isolated cells. The isolated crypts were successfully cultured and formed typical expanding, two-dimensional (2D) enteroid monolayers on collagen hydrogel-coated plates. The cultured iMSCs adhered to culture flasks and expressed stromal markers such as platelet-derived growth factor receptor alpha (PDGFRα) and cluster of differentiation 81 (CD81), as determined by immunostaining. Overall, this optimized isolation protocol yields both epithelial and stromal cells from the same piglet jejunal segment, providing a reproducible foundation for future research involving intestinal organoids and iMSC co-culture systems to elucidate mechanisms controlling epithelial-stromal interactions in pigs, a translationally relevant model for replicating human physiology and advancing animal sciences.

Introduction

The intestinal epithelium is a dynamic tissue that undergoes continuous self-renewal and differentiation to maintain intestinal homeostasis and facilitate regeneration after mucosal injuries^1,2. Intestinal epithelial cells originate from intestinal stem cells (ISCs), and they interact with diverse microenvironment factors^3,4,5,6,7,8. The subepithelial compartments, mainly the lamina propria and muscularis mucosa, consist of diverse cell populations from different lineages⁹. Among these cell populations, intestinal mesenchymal stromal cells (iMSCs), including fibroblasts and myofibroblasts, produce trophic and growth factors that modulate ISC stemness, proliferation, and differentiation to regulate epithelial homeostasis and regeneration^6,7,10,11.

To study these cellular interactions, recent studies have developed novel approaches to unravel possible mechanisms of action that drive intestinal epithelial cell and iMSC crosstalk. Co-culture systems that combine organoids with stromal or immune cells have advanced our understanding of epithelial-subepithelial cellular interactions during development, regeneration, drug screening, and disease modeling^{12,13,14,15,16,17}. However, most organoid co-culture studies have used murine tissues, which often fail to effectively mimic human physiology and disease phenotypes, limiting their clinical translational relevance¹⁸.

In most murine intestinal isolation protocols, epithelial and stromal cells are obtained from separate tissue segments, which may yield samples that reflect slightly different characteristics, potentially affecting reproducibility across experiments^19,20. Currently, there are no standardized optimized protocols for isolating porcine intestinal crypts and iMSCs from the same tissue sample. Moreover, practical limitations in obtaining suitable human intestinal samples have led many researchers to rely on mismatched cell types from different organs (such as human enteroids with skin fibroblasts) to evaluate epithelial-mesenchymal cellular crosstalk, potentially confounding data interpretation^21,22,23.

Although a recently published human intestinal biopsy protocol isolated crypts and obtained fibroblasts through outgrowth from the leftover epithelium-depleted tissue, comparable standardized approaches are lacking in pigs²⁴. Pigs are used as a suitable animal model for translational research due to their anatomic and physiologic resemblance to humans^{2,18,25,26,27,28,29}. Therefore, this method presents a sequential isolation protocol that recovers intestinal crypts and iMSCs from the same porcine jejunal segment based on the physiologic, anatomic, and morphologic structure of the intestine^4,30. The procedure provides a reproducible framework for isolating both crypts and iMSCs suitable for future porcine intestinal co-culture studies.

Protocol

A 5 cm segment was dissected from the excised proximal jejunum of 21-day-old piglets housed in the pig facility at the University of Maryland, College Park. The procedure (R-JUN-22-30) used to sacrifice the piglet followed guidelines for animal care and use policies approved by the university's Institutional Animal Care and Use Committee. Before proceeding with the isolation steps, the protocol outline is presented in Figure 1, and the list of reagents and equipment used for the sequential isolation of the porcine intestinal crypts and iMSCs is provided in the Table of Materials.

1. Pre-isolation preparation stage

1. Prepare 30 mL of wash buffer per 5 cm tissue segment in 50 mL conical tubes.
2. Adjust the volume based on the number of tissue samples collected.
   NOTE: Check Table 1 for wash buffer composition. All tissue preparation and cell isolation steps are done on a benchtop.

2. Intestinal tissue preparation stage

1. Place the excised intestinal tissue into the 30 mL of wash buffer in 50 mL conical tubes.
   NOTE: The excised tissues can be placed in a cold wash buffer for an hour before use.
2. Flush the tissue 3× with chilled wash buffer using a 21 G syringe to remove luminal contents.
3. Place the tissue on a sterilized polystyrene foam surface and carefully remove the mesenteric and adipose tissue from the serosa.
4. Dissect the tissue longitudinally using a surgical blade to open the lumen (Figure 2A).
5. Transfer the partially cleaned dissected tissue into fresh wash buffer and wash twice, or until the buffer becomes clear.
6. Place the tissue into the wash buffer in a 100 mm Petri dish and cut it into 10-15 mm pieces using a new surgical blade (Figure 2B,C). This step increases the surface area exposed to the digestion buffer.
7. Transfer the minced tissue into a new 50 mL conical tube.
8. Wash gently with wash buffer and allow the minced tissue to settle by gravity for approximately 30 s (Figure 2D).
9. Gently aspirate the supernatant, leaving only enough buffer to cover the tissue pieces in the conical tube.
10. Epithelial dissociation stage
    1. Add 30 mL of prewarmed epithelial dissociation buffer (Table 2) and incubate for 20-30 min at 37 °C in a static bead bath or a shaking water bath at approximately 9 × g.
    2. Gently shake the tube every 15 min to increase the release of the crypts from the epithelial membrane.
    3. Allow the tissue to settle and gently aspirate the supernatant with a serological pipette, leaving only enough buffer to cover the settled tissue in the conical tube.
    4. Add 30 mL of fresh wash buffer to the settled tissue and shake vigorously to release the villi, crypts, and debris (Figure 3A). Let the tissue remnants settle, then gently decant the wash buffer supernatant, which contains the suspended crypt segments, through a 100 µm cell strainer into a new 50 mL conical tube.
       1. Repeat the process of adding fresh wash buffer to the remnant tissue and decanting three times (3×). Pipette 10 µL of wash buffer containing the crypts into a 100 mm Petri dish and examine the crypt density under a stereo microscope.
          NOTE: Keep each wash buffer containing crypts after every wash.
    5. After the third wash, the wash buffer containing the crypts should be clear with minimal debris (Figure 3B).
       NOTE: Keep the tissue remnants with the extracellular matrix (ECM) in the conical tube for subsequent iMSC isolation processing.
    6. Centrifuge the crypt suspension at 150 × g for 2 min at room temperature to pellet the crypt fragments.
    7. Aspirate and resuspend the crypt pellet in epithelial culture medium.
    8. Centrifuge the resuspended crypts again at 150 × g for 2 min to collect the crypt fragment pellet.
    9. Add epithelial culture medium to resuspend the crypts and pipette 5× using a 1,000 µL pipette tip.
    10. Seed approximately 100 resuspended crypts onto pre-prepared collagen type 1 hydrogel-coated 6-well plates to culture and expand the crypts into two-dimensional (2D) enteroid monolayers.
        NOTE: Check the collagen hydrogel-coated plate preparation in Table 3. The final collagen type 1 concentration should be 1.0 mg/mL. Avoid plating excessively dense crypts or debris fragments to prevent yeast or fungal contamination. Antibiotic-antimycotic (anti-anti) in the wash buffer and culture medium should provide protection.
    11. Examine cells under an inverted phase-contrast microscope before incubating at 37 °C in a humidified 5% CO₂ incubator.
    12. Replace the culture medium within 12 h after seeding to remove floating debris and reduce bacterial contamination.
    13. Grow the enteroids using epithelial culture medium (Table 4) and replace the medium every other day until around day 8, when the expanded 2D monolayers reach ≥85 % confluence for subculturing.
11. Extracellular matrix dissociation stage
    NOTE: Continue the isolation process with the leftover tissue fragments that contain the extracellular matrix in the conical tube (Figure 3C and Figure 4A).
    NOTE: Although EDTA in the epithelial dissociation buffer can inhibit collagenase activity, the previous three washing steps remove all EDTA and DTT. Thus, collagenase activity should not be affected in the subsequent process.
    1. Mince the remaining tissue again into small pieces before proceeding to isolate the iMSCs in the lamina propria.
    2. Add 25 mL of extracellular digestion buffer (Table 5) to the tissue and incubate in a static bead bath for 15-20 min at 37 °C (Figure 4B).
    3. Shake vigorously after incubation.
       NOTE: The supernatant will become cloudy with fewer floating tissue fragments. Pipette 10 µL of the supernatant under an inverted microscope to examine the density of the iMSCs in the supernatant. Continue incubating the tissue in the beadbath for an extra 15 min if the observed iMSC density is low.
    4. Gently decant the supernatant (immediately after vigorous shaking in step 2.2.3) through a 100 µm cell strainer into a new conical tube to minimize debris.
    5. Centrifuge the cell suspension at 280 × g for 5 min at room temperature to pellet the iMSCs.
    6. Aspirate the supernatant and resuspend the iMSCs in mesenchymal culture medium (see iMSC culture media in Table 6).
    7. Centrifuge the resuspended iMSCs again at 280 × g for 5 min to wash off the dissociation buffer.
    8. Aspirate and resuspend the iMSCs in mesenchymal culture medium.
    9. Plate the iMSCs in a T75 culture flask at approximately 5 × 10⁵ cells per flask.
       NOTE: Ensure the plated cells cover approximately 60% of the flask surface area because mesenchymal cells require moderate to high seeding density for optimal growth.
    10. Replace the culture medium within 12 h after plating to remove excess debris and prevent bacterial contamination.
    11. Examine fibroblast-like cells under an inverted phase-contrast microscope on day 2 post-seeding.
        NOTE: Change the mesenchymal culture medium every other day. The iMSCs should reach approximately 85 % confluence and be ready for subculturing by day 4.

3. Immunocytochemistry assay

1. Culture approximately 5,000 iMSCs per well in a 96-well plate with mesenchymal culture medium for 2-3 days until cells reach approximately 80% confluence.
2. Gently aspirate the medium and rinse the cultured iMSCs twice with 100 µL of 1× PBS/well at room temperature³¹. All references to the immunostaining kits are provided in the Table of Materials.
3. Add 100 µL of 4% paraformaldehyde (PFA) per well to fix the cultured iMSCs and incubate on a static benchtop at room temperature for 30 min.
4. Wash the fixed cultured iMSCs twice with 100 µL of 0.1% Tween-20/PBS (PBST) for 5 min each, and then permeabilize with 100 µL of 0.5% Triton X-100/PBS for 30 min.
5. Add 100 µL of 5% bovine serum albumin (BSA)/PBST per well to block nonspecific binding on the fixed cells.
   NOTE: Leave at room temperature for 1 h before washing twice with 100 µL of PBST for 5 min each.
6. Add 100 µL of diluted primary antibodies (1:250; i.e., 1 µL of primary antibody in 250 µL of antibody diluent) to each well and incubate the cells overnight at 4 °C. The primary antibodies used are PDGFRα and CD81.
   NOTE: Include negative control wells by adding only antibody diluent without primary antibodies.
7. On the second day, wash off the primary antibodies twice with 100 µL of PBST for 5 min each.
8. Dilute the secondary antibodies in 1× PBS using the following ratios: Alexa Fluor Plus 555 (1 µL:100 µL), Alexa Fluor Plus 647 (1 µL:100 µL), and DAPI (1 µL:800 µL).
9. Counterstain the cells with the diluted secondary antibodies at room temperature for 1 h.
10. Wash the cells twice with 1× PBS for 5 min each.
11. Add 100 µL of mounting medium per well, cover the plate, wrap it with aluminum foil, and store at 4 °C for up to 6 months until fluorescent imaging.

4. RNA isolation and qPCR assay

1. Extract total mRNA from iMSCs cultured in T75 flasks using the acid guanidinium thiocyanate-phenol-chloroform separation technique.
   NOTE: Determine RNA concentration and purity using a spectrophotometer.
2. Reverse transcribe total mRNA into cDNA to use as a template for the quantitative reverse transcription polymerase chain reaction (qRT-PCR) assay to verify amplification plots for the selected Sus scrofa gene primer, GAPDH (forward: ATCCTGGGCTACACTGAGGAC; reverse: AAGTGGTCGTTGAGGGCAATG), as reported in previous studies^2,28.

Results

During epithelial dissociation, ethylenediaminetetraacetic acid (EDTA) chelates calcium ions to disrupt calcium-dependent cell-cell adhesions, while dithiothreitol (DTT) cleaves disulfide bonds in mucin glycoproteins to facilitate mucolysis. Thus, the combined use of a chelating compound (EDTA) and a reducing agent (DTT) enables effective release of crypts from the epithelial membrane without disrupting the extracellular matrix (ECM) structure^2,32 (

Discussion

Isolating intestinal crypts and iMSCs from the same porcine jejunal segment offers a novel approach for preserving tissue segment-specific cellular and functional characteristics. This is crucial because intestinal tissues exhibit regional and spatial identities, as demonstrated in previous porcine studies^2,36,37,38. Prior organoid studies in pigs or other species, which relied on crypts isolat...

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
0.5M EDTA	Promega	PR-V4231
1 M HEPES buffer	ThermoFisher	15630080	For collagen hydrogel plate preparation
1000 uL pipet tips	Alkali Scientific FT1000	104027-530
10x PBS	Invitrogen	AM9624	For collagen hydrogel plate preparation
1N sodium hydroxide	Thermo	SS266-1	For collagen hydrogel plate preparation
1x HBSS	ThermoFisher	14025092
1X PBS	Hyclone	SH30256FS
4 % paraformaldehyde (PFA)	ThermoFisher	AAJ61899AK
50 mL conical tubes	ThermoFisher	12-565-271
6 well plates	Fisherbrand	FB012927
7.5% Sodium Bicarbonate Solution	Corning	MT25035CI	For collagen hydrogel plate preparation
Advance DMEM/F12	Gibco	12634-010
Alexa fluor plus 647	Invitrogen	A32728	Secondary antibody
Alexa plus 555 - A32732	Invitrogen	A32732	Secondary antibody
Aluminum foil	Reynolds	https://www.amazon.com/dp/B00M8ZEAW4?ref=fed_asin_title&th=1
ANTI-ANTI	Gibco	15240096
B27	ThermoFisher	12587010
BSA	Fisherbrand	BP1600-100
CD81	Proteinintech	66866-1-ig	Primary antibody
Cell Culture Grade Water	Hyclone	SH30529FS	For collagen hydrogel plate preparation
Collagen, Type 1	Corning	356236	For collagen hydrogel plate preparation
Collagenase IV	Gibco	17104019
Corning 100 mm petri dish	Corning	07-202-011
Cryostor cell cryopreservation media	Stemcell Technologies	7930
cryovial for cells	Fisherbrand	1050026
Dako antibody diluent	Dako/Agilent	Part number: S302283-2	primary antibody diluent
Dako fluorescent mounting media	Dako/Agilent	Part number: S302380-2
DAPI	Promocell/VWR	10180-470	DNA staining
Dispase II	Roche	4942078001
DMEM, high glucose	Corning	MT10013CV
DTT	Sigma	646563
EGF	Peprotech	315-09
FBS (HI)	Avantor	1300-500H
Gastrin	Anaspec	AS-64149
Gentamicin	MP Biomedicals	ICN1676045
GlutaMax	ThermoFisher	35050061
HEPES	ThermoFisher	15630-080
Inverted flourescent microscrrope	Nikon	ECLIPSE Ti2	Flourescent imaging
Inverted phase-contrast microscope	Nikon	Eclipse TS100	For cultured cells imaging
iScript Advanced cDNA Synthesis Kit	Bio-Rad	1725038	RT-PCR kit
iTaq Universal SYBR Green Supermix	Bio-Rad	1725122	qPCR kit
LWRN conditional media	ATCC	CRL-3276	LWRN media was prepared in house according to the ATCC procedure
N-acetyl cysteine	MP Bio	194603
Nanodrop 2000 spectrophotometer	ThermoFisher	ND 2000
Nicotinamide	Sigma	N0636-100G
Optical 384-Well Plates with Barcode	Applied Biosystems	4483285	qPCR kit
PDGFRα	Abcam	ab230457	Primary antibody
Prostaglandin E2 (PGE2)	Cayman chemical	14010
QuantStudio 5	Applied Biosystem	A28570	qPCR instrument
SB202190	LC Laboratories	S-1700
Stereo microscope	Nikon	SMZ745
T 75 flask	Fisherbrand	FB012937
Triton X100	Fisherbrand	PI85111
Trizol reagent	Invitrogen	15596026
Tween 20, 100% Nonionic Detergent	Bio-rad	1706531
Y27632	ApexBio	A3008-200