A subscription to JoVE is required to view this content. Sign in or start your free trial.

Method Article

One-step Overlapping PCR for Rapid Synthesis of Single-guide RNA DNA Templates for the CRISPR System

220 views

DOI:

10.3791/70369

April 24th, 2026

In This Article

Summary

A one-step overlapping PCR method using four primers enables rapid, low-cost generation of DNA templates for in vitro sgRNA transcription. An optimized primer ratio (50:5:1:50) produces high-quality sgRNAs within 5 h, with functional validation demonstrated through in vitro assays and editing activity in HEK293T cells.

Abstract

The CRISPR–Cas system has revolutionized genome editing; however, conventional methods for generating single-guide RNA (sgRNA) often involve time-consuming cloning steps or expensive commercial synthesis kits. An optimized one-step overlapping PCR strategy is presented for the rapid, cost-effective synthesis of DNA templates for in vitro sgRNA transcription. Using four partially overlapping primers spanning the T7 promoter, target-specific guide sequence, and sgRNA scaffold, full-length templates are assembled in a single PCR reaction without cloning. Systematic experimental optimization established an optimal primer ratio (AF1:AF2:AF3:Tracr-R = 50:5:1:50), minimizing non-specific byproducts while maximizing full-length product yield, as confirmed by agarose gel electrophoresis. This approach was successfully extended to generate templates for Staphylococcus aureus Cas9 (saCas9) sgRNA, demonstrating cross-system applicability beyond Streptococcus pyogenes Cas9 (SpCas9). Although direct chemical synthesis of sgRNAs offers advantages such as high purity, chemical modifications to enhance stability, and reduced off-target effects, it remains prohibitively expensive for high-throughput applications or large-scale screens that require numerous sgRNAs. In vitro cleavage assays demonstrated that guide RNAs generated using this method achieve editing efficiencies comparable to those obtained via conventional plasmid-based cloning. Furthermore, ribonucleoprotein complexes assembled with these sgRNAs and delivered into HEK293T cells via electroporation resulted in detectable indel formation at the target locus, confirming functionality in vivo. Cost analysis indicates that this method substantially reduces template preparation costs compared to commercial synthesis kits while reducing turnaround time from days to hours, thereby providing an accessible and scalable approach for laboratories engaged in genetic research.

Introduction

The CRISPR–Cas system, derived from an adaptive immune mechanism in bacteria and archaea, has revolutionized genetic engineering by enabling precise genome editing across diverse organisms1,2. A key component is the single-guide RNA (sgRNA), a chimeric RNA that directs Cas nucleases to specific genomic loci; its modular design allows retargeting through modification of an approximately 20-nucleotide protospacer sequence3. Beyond SpCas9, other Cas nucleases with distinct properties have been widely adopted. Staphylococcus aureus Cas9 (saCas9) is smaller, facilitating adeno-associated virus (AAV) delivery and thereby expanding delivery options4. Each system requires specific guide RNA architectures, making a versatile synthesis method highly desirable3.

Traditional methods for generating functional guide RNAs include plasmid-based cloning, commercial sgRNA synthesis kits, or direct commercial synthesis of sgRNAs5,6. Plasmid-based cloning requires multiple labor-intensive steps—restriction digestion, ligation, transformation, and colony screening—typically taking over 48 hours2,4,6. Commercial sgRNA kits, while offering a streamlined workflow (<5 h), remain prohibitively expensive for high-throughput applications, typically costing $35–$45 per reaction. Direct chemical synthesis of sgRNAs offers advantages such as high purity, chemical modifications to enhance stability, and reduced off-target effects7; however, it is prohibitively expensive (typically $200–$280 per sgRNA) for high-throughput applications or large-scale screens requiring hundreds of sgRNAs.

In contrast, the one-step overlapping PCR method described here completes template synthesis in under 5 h using standard primers at a cost of approximately $5–8 per sgRNA, representing a substantial reduction in both time and material cost. Furthermore, sgRNAs produced by this method achieve editing efficiencies comparable to those generated by plasmid-based cloning, as confirmed by in vitro cleavage assays. A comparison of these approaches is illustrated in Figure 1.

Overlap extension PCR (OE-PCR) provides a rapid, ligase-independent strategy for assembling DNA fragments8. This approach has been adapted for sgRNA template synthesis using overlapping primers. In a one-step reaction using four partially overlapping primers, competitive binding occurs: the outer primers (AF1 and Tracr-R) define the amplification boundaries, while the inner primers (AF2 and AF3) must be diluted to ensure orderly extension from both ends toward the center. Despite this theoretical framework, a critical parameter affecting assembly efficiency—the optimal primer ratio—has not been systematically investigated. Furthermore, the broader applicability of such OE-PCR methods across different CRISPR systems remains underexplored.

To address these limitations, a study was designed to optimize and validate a one-step overlapping PCR method for sgRNA template synthesis. The optimal primer ratio was established through a structured experimental design, with agarose gel electrophoresis used to identify conditions yielding a single, correctly sized product. Following optimization, the method's versatility was evaluated across two widely used CRISPR systems (SpCas9 and saCas9), with successful amplification of both templates. Functional validation using in vitro cleavage assays demonstrated that sgRNAs generated using this method achieve efficiencies comparable to those obtained via plasmid-based cloning.

To further assess functionality in a cellular context, SpCas9 sgRNA was complexed with Cas9 protein to form ribonucleoprotein (RNP) complexes and delivered into HEK293T cells via electroporation. Genome editing at an endogenous locus was evaluated using a T7 Endonuclease I (T7EI) assay, with cleavage patterns on agarose gels indicating detectable indel formation in vivo. Collectively, these findings demonstrate that this method reliably produces high-quality, functional sgRNA templates. The following protocol describes the detailed procedure using SpCas9 as a representative example, with primer templates provided for adaptation to other Cas nucleases.

Access restricted. Please log in or start a trial to view this content.

Protocol

The use of the commercially available HEK293T cell line (ATCC CRL-3216) was conducted in accordance with the Ethical Committee of the First People's Hospital of Chenzhou City, University of South China guidelines for the use of human-derived cell lines. The reagents, software, and equipment used are listed in the Table of Materials.

1. Design of sgRNA target sequences

  1. Identify the target genomic region using established online tools (e.g., CRISPRscan, CHOPCHOP, or Broad Institute CRISPick)3.
  2. Access the CHOPCHOP web server at https://chopchop.cbu.uib.no/3,9.
  3. Enter the target gene information and select the appropriate CRISPR/Cas system (e.g., EGFR for CRISPR/Cas9) (Figure 2A).
  4. Review the output table, including rank, target sequence, genomic location, strand, GC content (%), self-complementarity, predicted off-target sites (MM0, MM1, MM2, MM3), and efficiency score (Figure 2B).
  5. Select a guide RNA sequence with high on-target efficiency and low predicted off-target activity.
  6. Record the final sgRNA target sequence for primer design (e.g., EGFR target sequence: "CTTAATTCCTTGATAGCGACGG") (Figure 2B).

2. Synthesis and preparation of four overlapping primers

  1. Design four oligonucleotide primers (AF1, AF2, AF3, Tracr-R) with overlapping regions as follows (Figure 3A):
    AF1: 5′–TTCTAATACGACTCACTATAG
    [target seq]GTTTTAGAGCTAGAAATAG–3′
    AF2: 5′–GTTTTAGAGCTAGAAATAGCAAGT
    TAAAATAAGGCTAGTCCGTTATCAAC–3′
    AF3: 5′–GGCTAGTCCGTTATCAACTTG
    AAAAAGTGGCACCGAGTCGGTGCTT–3′
    Tracr-R: 5′–AAAAAAGCACCGACTCGGTGCCAC–3′
    NOTE: Replace [target seq] in the AF1 primer with the sequence obtained in step 1.6.
  2. Synthesize primers at a 25 nmol scale with standard desalting purification.
  3. Resuspend dried primers in nuclease-free water to a stock concentration of 100 µM. Centrifuge at 5000 × g for 1 min at room temperature.

3. Primer concentration optimization and one-step overlapping PCR for sgRNA template synthesis

  1. Prepare primer mixtures with varying AF2 and AF3 concentrations according to Table 1. Maintain AF1 and Tracr-R at 10 µM.
  2. Prepare PCR reactions in 0.2 mL nuclease-free tubes according to Table 2. Use a high-fidelity DNA polymerase.
  3. Mix gently by pipetting five times. Do not vortex. Centrifuge at 5000 × g for 1 min.
  4. Run PCR using the cycling conditions described in Table 3.

4. Electrophoresis and recovery of DNA templates

  1. Prepare a 2% agarose gel by dissolving 2 g agarose in 100 mL of 1× TAE buffer. Cool to 50–60 °C, add 5 µL nucleic acid stain, and cast the gel.
  2. Allow the gel to solidify for 30 min at room temperature.
  3. Load 10 µL PCR product mixed with 2 µL of 6× loading buffer. Include a 100 bp DNA ladder.
  4. Run electrophoresis at 100 V for 30–40 min.
  5. Visualize under UV illumination. Confirm that Condition 9 (AF1:AF2:AF3:Tracr-R = 50:5:1:50) produces a single ~120 bp band (Figure 4A).
  6. Use optimized primer concentrations: AF1 10 µM, AF2 1 µM, AF3 0.2 µM, Tracr-R 10 µM.
  7. Excise the target band using a sterile scalpel. Limit UV exposure to ≤30 s.
    NOTE: Store gel slices at −20 °C for up to 1 week or proceed immediately.

5. Purification of DNA templates

  1. Purify DNA using a gel extraction kit according to the manufacturer's instructions10.
  2. Elute DNA in 20–30 µL pre-warmed (60 °C) nuclease-free water.
  3. Measure DNA concentration. Typical yield: 15–50 ng/µL; A260/A280: 1.8–2.0.
    NOTE: Store purified DNA at −20 °C for up to 1 year.

6. In vitro transcription and purification of sgRNA

  1. Assemble the transcription reaction using a T7 RNA synthesis kit (Table 4). Prepare on ice11.
    NOTE: Use RNase-free materials and decontaminate all surfaces.
  2. Incubate at 37 °C for 16 h.
  3. Add 1 µL DNase I and incubate at 37 °C for 15 min.
  4. Purify sgRNA using an RNA clean-up kit12.
  5. Elute in 30–50 µL nuclease-free water.
  6. Quantify sgRNA. Expected yield: 700–900 ng/µL; A260/A280: 1.9–2.1.
    NOTE: Store sgRNA at −80 °C for up to 1 year.

7. In vitro cleavage assay to verify sgRNA activity

  1. Prepare and purify target DNA. Adjust concentration to 60 ng/µL13.
  2. Assemble the cleavage reaction (Table 5)—pre-incubate without DNA at 25 °C for 30 min. Include a negative control.
  3. Add 1 µL target DNA.
  4. Incubate at 37 °C for 2 h.
  5. Add 4 µL of 6× loading buffer to stop the reaction.
  6. Run products on a 2% agarose gel at 100 V for 30–40 min.
  7. Visualize under UV light. Confirm cleavage (e.g., 617 bp → 414 bp + 203 bp) (Figure 4C).

8. Cellular validation of sgRNA-guided Cas9 editing

  1. Prepare the ribonucleoprotein (RNP) complex by mixing Cas9 protein and sgRNA at a 1:2 molar ratio. Combine 10 µL Cas9 (4 mg/mL), 280 µL sgRNA (60 ng/µL), and 200 µL DMEM. Incubate for 15 min.
  2. Culture HEK293T cells to ~80% confluency. Harvest and adjust to 3 × 106 cells per sample.
  3. Combine the RNP complex with the cells and incubate for 10 min at room temperature.
  4. Transfer to a 2 mm electroporation cuvette. Electroporate at 115 V, 4 ms, one pulse (575 V/cm). Immediately add 10 mL complete medium and transfer to a 6-well plate.
  5. Incubate at 37 °C with 5% CO2 for 48 h.
  6. Extract genomic DNA from treated and control cells. Measure concentration.
    NOTE: Store DNA at −20 °C for up to 6 months.
  7. Amplify the target locus by PCR (Table 6 and Table 7).
    NOTE: Expected product size: 617 bp for EGFR.
  8. Verify PCR products on a 2% agarose gel. Purify the correct band and quantify DNA.
  9. Perform heteroduplex formation (Table 8 and Table 9).
  10. Add 1 µL T7 Endonuclease I and incubate at 37 °C for 15 min. Inactivate at 85 °C for 10 min.
  11. Add loading buffer and run on a 2% agarose gel.
  12. Visualize under UV light. Confirm indel formation (617 bp → 414 bp + 203 bp) (Figure 4D).

Access restricted. Please log in or start a trial to view this content.

Results

Successful application of the one-step overlapping PCR protocol produces a single, sharp DNA band of the expected size when analyzed by agarose gel electrophoresis.

Suboptimal primer ratios, particularly those with excessive concentrations of inner primers (AF2 and AF3), result in additional bands larger than the expected product, indicating non-specific amplification or primer-dimer formation, along with faint bands corresponding to incomplete assembly intermediates (Figu...

Access restricted. Please log in or start a trial to view this content.

Discussion

A streamlined, economical protocol for synthesizing sgRNA DNA templates via a one-step overlapping PCR strategy is described. This method eliminates the need for plasmid construction and cloning, reducing template preparation time from several days to approximately 5 h. A key aspect of this approach is the systematic optimization of the primer ratio, determined to be 50:5:1:50 (AF1:AF2:AF3:Tracr-R), corresponding to working concentrations of 10 µM, 1 µM, 0.2 µM, and 10 µM, respectively. This ...

Access restricted. Please log in or start a trial to view this content.

Disclosures

The authors have nothing to disclose.

Acknowledgements

This work was supported by the Health Research Project of the Hunan Provincial Health Commission (grant number W20243264), the Natural Science Foundation of Hunan Province (grant number 2023JJ50368), the Key Research Project of the Department of Education of Hunan Province (grant number 24A0607), and the Innovative Team Project of the First People's Hospital of Chenzhou (grant number CX202103).

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
100 bp DNA LadderTIANGENMD109DNA size marker for electrophoresis
2Taq Plus MasterMixCWBIOCW2849MPCR amplification reagent
50 bp DNA LadderTIANGENMD108DNA size marker for small fragments
6DNA loading bufferTIANGEN1109565Sample loading buffer for electrophoresis
Agarose Gel DNA Recovery KitTIANGENDP219DNA purification from agarose gel
Agarose I Thermo Scientific 17850Agarose gel preparation
Broad Institute CRISPickhttps://portals.broadinstitute.org/gppx/crispick/publicsgRNA design tool
CentrifugeHENGNUO2-16RSample centrifugation
Certified Copper Fetal Bovine SerumUmedium, Beijing BioTopped Technology Co., Ltd3023ACell culture supplement
CH3CO2HShanghai Aladdin Biochemical Technology Co., LtdA758682TAE buffer solution preparation reagents
CHOPCHOPhttps://chopchop.cbu.uib.no/sgRNA design tool
CO2 incubatorThermo Scientific51032874Mammalian cell culture incubation
CRISPRscanhttps://www.crisprscan.org/sgRNA design tool
DMEM (Dulbecco's Modified Eagle Medium)KeyGEN BioTECHKGL1211-500Cell culture medium
dsDNaseThermo Scientific EN0771Removal of DNA template after transcription
ECM 830 Square Wave Electroporation SystemBTXECM830Electroporation of cells
EDTA Na2BioSharpBS108TAE buffer solution preparation reagents
Electric thermostatic water bathSHANGHAI SUMSUNG LABORATORY INSTRUMENT CO.,LTDDKD8Temperature-controlled incubation
Electrophoresis Apparatus TrophoresisLIUYIDYCP-31BNAgarose gel electrophoresis
Gel Imaging analysis systemShanghHai JiaPengZF-258Gel visualization and imaging
GenCRISPR SpCas9GenScriptZ03624-GMP-2.5Cas9 nuclease for genome editing
Genomic DNA extraction kitTIANGENYDP304Genomic DNA isolation
HiScribe T7 High Yield RNA Synthesis KitNEBE2040SIn vitro transcription of sgRNA
MiniAmp ThermocyclerThermo Scientific A37834PCR amplification
NanoDrop 2000c SpectrophotometerThermo Scientific 2000cNucleic acid quantification
Nucleic acid stain (e.g., GeneRed)TIANGENRT211DNA visualization in agarose gel
PCR Using Q5 Quick-Load High-Fidelity 2X Master MixNEBM0578High-fidelity PCR amplification
Primers (AF1, AF2, AF3, Tracr-R)GenScriptOligonucleotides for sgRNA template assembly
Tris-baseBioSharpBS083TAE buffer solution preparation reagents
VAHTS RNA Clean BeadsVAHTSN412-01RNA purification

References

  1. Tamura, R., Kamiyama, D. CRISPR-Cas9-mediated knock-in approach to insert the GFP(11) tag into the genome of a human cell line. Methods Mol Biol. 2564, 185-201 (2023).
  2. Cong, L., et al. Multiplex genome engineering using CRISPR/Cas systems. Science. 339 (6121), 819-823 (2013).
  3. Jinek, M., et al. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science. 337 (6096), 816-821 (2012).
  4. Ran, F. A., et al. Genome engineering using the CRISPR-Cas9 system. Nat Protoc. 8 (11), 2281-2308 (2013).
  5. Mali, P., et al. RNA-guided human genome engineering via Cas9. Science. 339 (6121), 823-826 (2013).
  6. Graf, R., Li, X., Chu, V. T., Rajewsky, K. sgRNA sequence motifs blocking efficient CRISPR/Cas9-mediated gene editing. Cell Rep. 26 (5), 1098 (2019).
  7. Hendel, A., et al. Chemically modified guide RNAs enhance CRISPR-Cas genome editing in human primary cells. Nat Biotechnol. 33 (9), 985-989 (2015).
  8. Brunetti, L., et al. Highly efficient gene disruption of murine and human hematopoietic progenitor cells by CRISPR/Cas9. J Vis Exp. (134), e57278 (2018).
  9. Labun, K., et al. CHOPCHOP v3: expanding the CRISPR web toolbox beyond genome editing. Nucleic Acids Res. 47 (W1), W171-W174 (2019).
  10. Bien, H. . Qiagen QIAquick gel extraction kit (28704 and 28706), centrifuge processing. , (2015).
  11. MalagodaPathiranage, K., Banerjee, R., Martin, C. T. A new approach to RNA synthesis: immobilization of stably and functionally co-tethered promoter DNA and T7 RNA polymerase. Nucleic Acids Res. 52 (17), 10607-10618 (2024).
  12. Xiao, G., et al. Direct detection from sputum for drug-resistant Mycobacterium tuberculosis using a CRISPR-Cas14a-based approach. BMC Microbiol. 25 (1), 188 (2025).
  13. Higuchi, R., Krummel, B., Saiki, R. K. A general method of in vitro preparation and specific mutagenesis of DNA fragments: study of protein and DNA interactions. Nucleic Acids Res. 16 (15), 7351-7367 (1988).
  14. Hu, Z., et al. Customized one-step preparation of sgRNA transcription templates via overlapping PCR using short primers and their application in vitro and in vivo gene editing. Cell Biosci. 9 (1), 25 (2019).
  15. Pan, C., et al. A new method to synthesize multiple gRNA libraries and functional mapping of mammalian H3K4me3 regions. Nucleic Acids Res. 51 (9), e52 (2023).
  16. Shalem, O., et al. Genome-scale CRISPR-Cas9 knockout screening in human cells. Science. 343 (6166), 84-87 (2014).
  17. Wang, T., Wei, J. J., Sabatini, D. M., Lander, E. S. Genetic screens in human cells using the CRISPR-Cas9 system. Science. 343 (6166), 80-84 (2014).
  18. Nageshwaran, S., et al. CRISPR guide RNA cloning for mammalian systems. J Vis Exp. (140), e57998 (2018).
  19. Basila, M., Kelley, M. L., Smith, A. V. B. Minimal 2'-O-methyl phosphorothioate linkage modification pattern of synthetic guide RNAs for increased stability and efficient CRISPR-Cas9 gene editing avoiding cellular toxicity. PLoS One. 12 (11), e0188593 (2017).
  20. Kratschmer, C., Levy, M. Effect of chemical modifications on aptamer stability in serum. Nucleic Acid Ther. 27 (6), 335-344 (2017).
  21. Maio, G., et al. Systematic optimization and modification of a DNA aptamer with 2'-O-methyl RNA analogues. ChemistrySelect. 2 (7), 2335-2340 (2017).
  22. Pasternak, A., et al. A chemical synthesis of LNA-2,6-diaminopurine riboside, and the influence of 2'-O-methyl-2,6-diaminopurine and LNA-2,6-diaminopurine ribosides on the thermodynamic properties of 2'-O-methyl RNA/RNA heteroduplexes. Nucleic Acids Res. 35 (12), 4055-4063 (2007).
  23. Shang, Z., et al. CRISPR/Cas12a with Universal crRNA for Indiscriminate Virus Detection. Molecules. 29 (24), 5842 (2024).
  24. Wang, Z., et al. crRNA scaffold remodeling controls CRISPR–Cas12a activity for enhanced performance. Nucleic Acids Res. 54 (5), 2310-2325 (2026).

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Tags

DNA Template SynthesisIn Vitro TranscriptionPrimer OptimizationAgarose Gel ElectrophoresisRibonucleoprotein ComplexElectroporationGenome Editing