A Toxin-Based Counter-Selection System for Markerless Gene Deletion and High-Density Tn5 Transposon Mutagenesis in Pectobacterium brasiliense

Summary

Here we present a protocol for generating unmarked gene deletions and constructing genome-wide Tn5 insertion mutant libraries in Pectobacterium brasiliense, a phytopathogen responsible for potato blackleg and soft rot. This approach enables efficient reverse genetic analysis and facilitates the functional characterization of virulence-associated genes in this organism.

Abstract

Pectobacterium brasiliense is a highly pathogenic bacterium responsible for potato tuber soft rot, blackleg, and aerial stem rot. Elucidation of its pathogenic mechanisms is essential for disease control; however, genetic tools for this organism remain limited. A toxin-based counter-selection system was developed to enable markerless gene deletion and high-density Tn5 transposon mutagenesis. The vmi480 toxin derived from the pLP12 plasmid was used as a counter-selection marker to construct the suicide vector pKV2. Using this system, the recA gene in the P. brasiliense SM strain was successfully deleted. The resulting recA mutant served as the parental strain for the construction of a Tn5 insertion library comprising over 12,000 mutants through conjugation with the RHO3 helper strain carrying pKV2-LLtnp. In this derivative plasmid, the vmi480 toxin was replaced with a hyperactive Tn5 transposase under the control of an outward-facing lac promoter to reduce polar effects. High-throughput tuber inoculation assays enabled the identification of pathogenicity-deficient mutants, including insertions in the type II secretion system, a key virulence determinant that mediates the secretion of plant cell wall-degrading enzymes. This platform supports functional genomics and facilitates the investigation of virulence mechanisms in this economically important pathogen.

Introduction

P. brasiliense is one of the most aggressive species within the Pectobacterium genus and is the causal agent of potato soft rot, blackleg, and aerial stem rot¹. These diseases lead to an estimated 30% yield loss in potato, a crop ranking as the world’s third most important food source and a key component of China’s agricultural production system². Despite its economic impact, the molecular mechanisms governing the pathogenicity of P. brasiliense remain insufficiently understood, largely due to the lack of efficient and reproducible genetic manipulation tools for this species

Protocol

1. Generation of a markerless recA deletion mutant in P. brasiliense

1. Extract genomic DNA from P. brasiliense SM and pKV2 plasmid (pLP12 derived with modification of antibiotic selection marker and multiple cloning site) from the E. coli donor strain using standard DNA preparation procedures.
2. Verify the quality and concentration of the extracted genomic DNA and plasmid DNA via agarose gel electrophoresis and NanoDrop spectrophotometry.
3. Linearize plasmid pKV2 by double digestion with EcoRI and NheI at 37 °C for 5 h. Verify complete digestion by agarose gel electrophore....

Results

To overcome the instability caused by the sucB mutation in P. brasiliense, the vmi480 toxin from plasmid pLP12 was employed as a counter-selection marker, and the modified suicide vector pKV2 (Figure 1A) was constructed by replacing the antibiotic resistance cassette and adjusting the cloning site configuration. To generate a markerless recA deletion mutant, ~800 bp left and right homologous arms of the recA gene were cloned into pKV2, followed by a two-st.......

Discussion

The genetic manipulation strategy developed in this study provides an option for functional genomics in P. brasiliense, a primary soft-rot pathogen of potato^9,10. By integrating a toxin-based counter-selection system into a suicide plasmid backbone, a markerless ΔrecA mutant was generated. This approach offers significant advantages over traditional sacB-based systems; while sacB often yields high background growth due to .......

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
Bacterial genomic DNA extraction kit	Extract bacterial genomic DNA	Tiangen	DP302-02
Diaminopimelic acid	0.3 mM in 1 L medium	Macklin	D836611-5g
DNA assembly kit	DNA assembly	Vazyme	C116-02
DNA purification kit	DNA purification	Tiangen	DP214-02
Kanamycin	50 mg/mL	Aladdin	K103025-25g
Glucose	0.2% (w/v)	Aladdin	G116305-250mg
Tryptone	10% in 1 L medium	OXOID	LP0042B
Yeast Extract	5% in 1 L medium	OXOID	LP0021B
NaCl	10% in 1 L medium	Biofroxx	1249KG001
Agar	15% in 1 L medium	Biofroxx	8211GR500
L-arabinose	0.3% (w/v)	Aladdin	A106196-25g
Plasmid Miniprep kit	Extract plasmid	Tiangen	DP103-02
EcoRI	Restriction endonuclease	Yugong Biotech	EG15536
NheI	Restriction endonuclease	Yugong Biotech	EG15552
HindIII	Restriction endonuclease	Yugong Biotech	EG15539
T4 DNA ligase	Linear DNA self-circularization	Yugong Biotech	EG15205
Centrifuge	RWD	M1324R
PCR Thermal Cycler	BIO-GENER	GET3XG
Digital camera	SONY	ILCE-7M4
Electrophoresis system	LY	DYY-6C
Water bath	JOANLAB	WB100-1F
Gel documentation system	Thermo Fisher Scientific	iBright CL750
Autoclave	Yamato	SQ510C
Shaking incubator	ZHICHU	ZQZY-AR8
Constant temperature incubator	ZQ	DHP-9272
NanoDrop	Thermo Fisher Scientific	Lite Plus
UV-Vis spectrophotometer	HITACHI	U-3900
Electroporator	BIO-RAD	MicroPulser
Strains and plasmids
P. brasiliense SM	Potato pathogenic bacteria	Laboratory strain collection
E. coli S17-1 λpir	E. coli competent cells	WEIDI	DL2010S
E. coli WM3064	E. coli competent cells	BIO SCI BIO	C1039
E. coli RHO3	E. coli competent cells	Laboratory strain collection
pKV2	The modified suicide plasmid	Constructed in this study
pLP12	suicide plasmid	Laboratory strain collection
pMCS2-LLtnp	Provide the fragment carrying Tn5	Laboratory strain collection
pKV2-LLtnp	The modified plasmid carrying the Tn5 fragment.	Constructed in this study
Pimers
LBF (ctgaaagcttctgcaggagctcgctgacccaacaatccttgattaagatgaggc)		Customized
LBR (gttcagccaccattctgctcctgtcatgcggcgt)		Customized
RBF (caggagcagaatggtggctgaacgggttgtgac)		Customized
RBR (gatcctgcagcggagcggccgcgcagatcgcgggcaaggttagtc)		Customized
checkF (ctatgcgcttcgcataccgtgc)		Customized
checkR (gctcttgctcataattgtcctgg)		Customized
TnpF (ggaatctagaccttgagtcgatatcactctcgtttaatgctg)		Customized
TnpR (acaaacaaaaccaaattctgtacggcgaag)		Customized
ori-F (taatcgccttgcagcacatc)		Customized
ori-R (ggtatgagtcagcaacacct)		Customized
5’ME (attcattaatgcagctggcacg)		Customized