ai_agent_IP

ai_agent

maintenance

instantTrialDurationMinutes

isBiopharma

enableNewMyJoveSectionDesign

educationFeatures

seoMetaApi

ai_copilot_institution_blacklist

ai_chat_institution_blacklist

freeAccessWindow

ssoRoleCapture

scheduledMaintenanceBanner

joveLabsFeatures

disable_autoplay_for_bots

extended_trial_duration

5 minutes

This work was supported by funding from Tiroler Wissenschaftsfonds (ZAP746010, F.33287/10- 2021, F.50279/7-2024).

This protocol was optimized for research on primary human neonatal melanocytes (HNM) to study the mechanisms of stress-induced premature senescence induced by tBHP (Figure 1). The melanocytes were derived from neonatal Caucasian foreskin (light pigmentation phototype) and obtained from a commercial source. According to the supplier&#8217;s documentation, human tissues are collected from donors who are fully informed and have provided consent, in compliance with established ethical and legal frameworks, including the Declaration of Helsinki and applicable data protection regulations. The cells were provided in a de-identified form. No additional ethical approval was required for their use in this study. All experiments were performed using the same melanocyte line to ensure consistency. Note that when using different primary cell lines, the culture conditions, as well as concentrations and handling procedures, may need to be further adjusted.
1. Preparations
NOTE: To initiate tBHP treatment, melanocytes must be thawed at least three days in advance to allow sufficient recovery and confluency. The treatment phase lasts 4 days, with the seeding day designated as Day 0. Details of all the materials used in this study are given in the Table of Materials.
<ol>
	<li>To prepare the culture medium, combine melanocyte basal medium with the corresponding growth factors. Flame the lid of each vial before adding its contents to the medium to minimize contamination. Add 1% (v/v) PenStrep to the prepared medium and store it at 4 &#176;C until use.</li>
	<li>Before seeding, prepare the trypsin inhibitor solution by diluting soybean trypsin inhibitor in DPBS. Filter the solution through a 0.22 &#181;m membrane, aliquot, and store at &#8722;20 &#176;C. Once thawed, it can be used for up to 10 days.</li>
</ol>
2. Cell thawing (Day -3)
CAUTION: All materials in contact with human cells should be considered biologically contaminated and disposed of in accordance with institutional biosafety guidelines. To assess senescence, we use complementary assays that evaluate growth arrest, SA-&#946;-gal activity, and additional molecular markers. Here, we present the protocols for these assays and the expected outcomes when working with these senescence indicators.
<ol>
	<li>Pipette 20 mL of Dulbecco&#39;s Phosphate Buffer Saline (cell culture grade) into a 50 mL conical tube at room temperature. Maintain the vial containing cells on ice until thawing.</li>
	<li>Flame the lid before opening the vial containing the cells, unscrew, and flame the sides again to prevent potential contamination.</li>
	<li>Transfer 500 &#181;L of DPBS into the vial containing the cells. Gently thaw cells by pipetting up and down, then transfer the entire contents to the tube.</li>
	<li>Centrifuge at 100 &#215; g for 5 min at room temperature. The resulting pellet should appear beige to brownish (or darker, depending on the donor&#39;s ethnicity).</li>
	<li>Prepare a T75 flask with 14 mL of melanocyte medium.</li>
	<li>Flame a glass Pasteur pipette (flame each time when handling melanocytes), carefully aspirate the DPBS, and resuspend the pellet in 1 mL of medium.</li>
	<li>Transfer to the previously prepared flask.</li>
	<li>Incubate at 37 &#176;C, 5% CO&#8322;, and observe daily under the microscope. Change medium at least every 48 h. 
	&#8203;NOTE: Each cryopreserved vial contains approximately 1 &#215; 106&#160;primary human melanocytes. All experiments were performed using cells at passage 9.</li>
</ol>
3. Cell seeding (Day 0)
<ol>
	<li>Ensure confluency of 80&#8211;90% of the cells on the seeding day.</li>
	<li>Aspirate the medium from the flask and wash twice with DPBS.</li>
	<li>Detach cells by adding 2 mL of trypsin-EDTA solution and incubating for 5 min at 37 &#176;C, 5% CO&#8322;.</li>
	<li>Gently tap the flask and observe under the microscope to confirm complete cell detachment (incubate longer if necessary).</li>
	<li>Stop the reaction by adding 1.5 times the volume of trypsin inhibitor.</li>
	<li>Transfer the cell suspension to a 15 mL conical tube and dilute with DPBS to a final volume of 10 mL.</li>
	<li>Centrifuge the cell suspension at 100 &#215; g for 5 min.</li>
	<li>Aspirate the supernatant and resuspend to the desired volume in medium.</li>
	<li>For tBHP-treated plates, seed 6 &#215; 105 cells per 10 cm dish. For control plates, seed 4 &#215; 105 cells per plate. 
	NOTE: For tBHP-treated plates, seed a higher cell density to ensure sufficient cells are available for the experiments, as their growth rate will progressively decrease during treatment. If seeding cells on coverslips for microscopy experiments, coverslips must be coated with 0.1 mg/mL poly-D-lysine and completely dried prior to cell seeding.</li>
	<li>Incubate overnight at 37 &#176;C with 5% CO&#8322;. Change medium every 48 h for control plates.</li>
</ol>
4. tBHP treatment (Day 1&#8211;4)
<ol>
	<li>Prepare a 10 mM working solution from tBHP stock (diluted in DPBS or media). 
	NOTE: tBHP is light-sensitive: cover the container when working with it. The working solution can be used for up to one week when stored properly at 4 &#176;C. Treatment schedule: Day 1 (the day after seeding) marks the start of tBHP exposure. Melanocytes are treated twice daily with at least a 4 h interval between applications. This regimen is repeated from Day 1 to Day 4, for a total of 4 days of treatment. The selected tBHP concentration and treatment schedule were adapted from previous work in dermal fibroblasts, where lower concentrations were sufficient to induce senescence. In primary melanocytes, however, higher concentrations were required to achieve robust senescence induction, and 100 &#181;M tBHP was identified as optimal based on titration experiments balancing senescence induction and cell viability</li>
	<li>Add 100 &#181;M tBHP to cells for 1 h per treatment (To initiate, add the appropriate volume of working solution, ensuring to pipette into the liquid medium.)</li>
	<li>Move the plate back and forth and side to side to distribute tBHP evenly throughout the medium. 
	&#8203;NOTE: Avoid circular motions as this may cause uneven distribution of tBHP through the medium.</li>
	<li>Incubate for precisely 1 h at 37 &#176;C with 5% CO&#8322;.</li>
	<li>To terminate tBHP treatment, aspirate the medium.</li>
	<li>Wash plates twice with pre-heated DPBS (37 &#176;C).</li>
	<li>Add the appropriate volume of fresh medium to the plates.</li>
	<li>Allow cells to recover in the incubator for at least 4 h before initiating the subsequent treatment.</li>
	<li>Repeat this procedure on the same day for the second treatment and continue for the remaining days. Maintain the cells in culture after finishing the treatment until Day 9 to assess senescence markers.</li>
	<li>Monitor control plates and passage if confluent.</li>
</ol>
5. Growth curve analysis
<ol>
	<li>Count tBHP-treated cells and controls following the seeding protocol.</li>
	<li>Reseed the same initial density or all the cells in case you count fewer than the 6 &#215; 105 cells for tBHP plates.</li>
	<li>Perform cell counts on days 4, 9, and 15 of culture.</li>
	<li>Calculate the growth curve using the following formula: 
	lg (count) - log (seed) / 0.301 + cPDL 
	count: number of cells obtained at the end of the passage. 
	seed: number of cells initially plated at the start of the passage. 
	&#8203;cPDL: cumulative population doubling level carried over from previous passages.</li>
</ol>
6. SA-&#946;-galactosidase activity
<ol>
	<li>On day 9, wash cells twice in PBS before fixing with 2% formaldehyde and 0.4% glutaraldehyde.</li>
	<li>Wash cells twice with PBS.</li>
	<li>Incubate fixed cells with staining solution with a pH of 6.0 (150 mM NaCl, 2 mM MgCl, 5 mM potassium ferricyanide, 5 mM potassium ferrocyanide, 40 mM citric acid, 12 mM sodium phosphate, and 1 mg/mL 5-bromo-4-chloro-3-indolyl-&#946;-D-galactoside (X-gal).</li>
	<li>After 18 h of incubation at 37 &#176;C in the absence of CO&#8322;, wash cells twice with PBS.</li>
	<li>Image using light microscopy.</li>
	<li>Quantify the number of blue-stained cells under the microscope by counting the number of blue cells and dividing by the total number of cells in a field. Express the results as a percentage of positive cells.</li>
</ol>
7. Immunofluorescence staining
CAUTION: Formaldehyde, glutaraldehyde, and paraformaldehyde-containing waste must be handled as hazardous chemical waste and disposed of in accordance with institutional safety regulations.
<ol>
	<li>Use cells cultured on coverslips pre-coated with 0.1 mg/mL poly-D-lysine.</li>
	<li>On day 9, wash cells twice, then fix with 4% paraformaldehyde for 15 min.</li>
	<li>Wash cells twice with PBS.</li>
	<li>Permeabilize using 0.3% Triton-X and 0.1% sodium citrate in PBS.</li>
	<li>Block with 1% BSA in PBS-T for 30 min at room temperature.</li>
	<li>Incubate cells with primary antibody &#947;H2AX to detect permanent DNA damage response overnight at 4 &#176;C in a humidified chamber.</li>
	<li>The following day, wash twice with PBS.</li>
	<li>Apply a secondary antibody for 1 h at room temperature.</li>
	<li>Stain nuclei with DAPI if desired.</li>
	<li>Wash twice with PBS-T, followed by two washes with PBS and twice with ddH2O.</li>
	<li>Mount coverslips and let them dry completely before imaging.</li>
	<li>Analyze mean fluorescence intensity and/or &#947;H2AX foci using ImageJ software.</li>
</ol>
8. RNA isolation and RT-qPCR
CAUTION: &#946;-mercaptoethanol is highly toxic and must be handled in a fume hood. Waste containing &#946;-mercaptoethanol should be disposed of as hazardous chemical waste.
<ol>
	<li>On day 9, trypsinize cells using 2 mL of trypsin-EDTA.</li>
	<li>Stop the reaction by applying 1.5x the amount of trypsin inhibitor.</li>
	<li>Transfer the cell suspension to a 15 mL conical tube and centrifuge at 100 x g for 5 min.</li>
	<li>Carefully aspirate the supernatant.</li>
	<li>Lyse cell pellets by resuspending in 350 &#181;L RLT buffer containing 1% &#946;-mercaptoethanol.</li>
	<li>Isolate RNA using a column-based RNA purification kit.</li>
	<li>Determine RNA concentration using a spectrophotometer (260 nm).</li>
	<li>For cDNA synthesis, use 1 &#181;g of RNA for reverse transcription in a total reaction volume of 10 &#181;L using a standard reverse transcription mix (including RT buffer, dNTPs, random primers, reverse transcriptase, and RNase inhibitor) followed by thermal cycling conditions according to the manufacturer&#8217;s instructions.</li>
	<li>Perform RT-qPCR for SASP factors 
	NOTE: The selected SASP factors (IL-8, IL-6, and MMP-1) represent well-established components of the senescence-associated secretory phenotype and were chosen based on their relevance to skin biology, including inflammatory signaling and extracellular matrix remodeling 
	IL-6 (Fwd: 5&#8217; AAGCCAGAGCTGTGCAGATGAGTA 3&#8217; Rev: 5&#8217; TGTCCTGCAGCCACTGGTTC 3&#8217;) 
	IL-8 (Fwd: 5&#8217; ACCGGAAGGAACCATCTCAC 3&#8217; Rev: 5&#8217; AAACTGCACCTTCACACAGAG 3&#8217;) 
	MMP-1 (Fwd: 5&#8217; CATCGTGTTGCAGCTCATGA 3&#8217; Rev: 5&#8217; ATGGGCTGGACAGGATTTTG 3&#8217;) 
	GAPDH (Fwd: 5&#8217; GAGTCAACGGATTTGGTCGT 3&#8217; Rev: 5&#8217; GATCTCGCTCCTGGAAGATG 3&#8217;)</li>
	<li>Analyze relative mRNA expression using the &#916;&#916;Ct method with normalization to the housekeeping gene GAPDH.</li>
</ol>
9. Protein isolation and Western blot
<ol>
	<li>On day 9, collect protein lysates.</li>
	<li>Aspirate medium and wash plates twice using cold DPBS.</li>
	<li>Lyse cells mechanically using a cell scraper after adding 150 &#181;L RIPA buffer (50 mM Tris-HCl, pH 7.4, 150 mM NaCl, 1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS, and 2 mM EDTA) supplemented with protease inhibitors and transfer to a 1.5 mL tube.</li>
	<li>Perform three cycles of freezing and thawing followed by a 30 min incubation on ice.</li>
	<li>Centrifuge at 9600 x g at 4 &#176;C for 10 min.</li>
	<li>Determine protein concentration of the supernatant using the BCA assay.</li>
	<li>Separate equal amounts (20 &#181;g) of protein on polyacrylamide gels and transfer to activated PVDF membranes.</li>
	<li>Block membranes in 5% skim milk in TBS-T.</li>
	<li>Incubate with primary antibodies pRB and LaminB1 overnight at 4 &#176;C.</li>
	<li>The next day, wash the membranes 3x in TBS-T.</li>
	<li>Incubate in HRP-conjugated appropriate secondary antibodies for 1 h at room temperature.</li>
	<li>Detect proteins by chemiluminescence and perform densitometric analysis.</li>
</ol>

<ol>
	<li>Hussein, R. S., Bin Dayel, S., Abahussein, O., et al. <a target="_blank" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Influences+on+skin+and+intrinsic+aging:+biological,+environmental,+and+therapeutic+insight.">Influences on skin and intrinsic aging: biological, environmental, and therapeutic insight.</a> J Cosmet Dermatol. 24, e16688 (2025).</li><li>Dorf, N., Maciejczyk, M. <a target="_blank" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Skin+senescence-from+basic+research+to+clinical+practice.">Skin senescence-from basic research to clinical practice.</a> Front Med (Lausanne). 11, 1484345 (2024).</li><li>Grenier, A., Morissette, M. C., Rochette, P. J., et al. <a target="_blank" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+combination+of+cigarette+smoke+and+solar+rays+causes+effects+similar+to+skin+aging+in+a+bilayer+skin+model.">The combination of cigarette smoke and solar rays causes effects similar to skin aging in a bilayer skin model.</a> Sci Rep. 13, 17969 (2023).</li><li>Varani, J., Dame, M. K., Rittie, L., et al. <a target="_blank" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Decreased+collagen+production+in+chronologically+aged+skin:+roles+of+age-dependent+alteration+in+fibroblast+function+and+defective+mechanical+stimulation.">Decreased collagen production in chronologically aged skin: roles of age-dependent alteration in fibroblast function and defective mechanical stimulation.</a> Am J Pathol. 168, 1861-1868 (2006).</li><li>Zhang, S., Duan, E. <a target="_blank" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fighting+against+skin+aging:+the+way+from+bench+to+bedside.">Fighting against skin aging: the way from bench to bedside.</a> Cell Transplant. 27, 729-738 (2018).</li><li>Hussen, N. H. a., Abdulla, S. K., Ali, N. M., et al. <a target="_blank" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+antioxidants+in+skin+aging+and+the+molecular+mechanism+of+ROS:+a+comprehensive+review.">Role of antioxidants in skin aging and the molecular mechanism of ROS: a comprehensive review.</a> Aspects Mol Med. 5, 100063 (2025).</li><li>Addor, F. A. S. <a target="_blank" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Beyond+photoaging:+additional+factors+involved+in+the+process+of+skin+aging.">Beyond photoaging: additional factors involved in the process of skin aging.</a> Clin Cosmet Investig Dermatol. 11, 437-443 (2018).</li><li>Mucha, M., Skrzydlewska, E., GÄ™gotek, A. <a target="_blank" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Natural+protection+against+oxidative+stress+in+human+skin+melanocytes.">Natural protection against oxidative stress in human skin melanocytes.</a> Commun Biol. 8, 1283 (2025).</li><li>Hughes, B. K., Bishop, C. L. <a target="_blank" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Current+understanding+of+the+role+of+senescent+melanocytes+in+skin+ageing.">Current understanding of the role of senescent melanocytes in skin ageing.</a> Biomedicines. 10, 3111 (2022).</li><li>Kami&#324;ski, K., Kazimierczak, U., Kolenda, T. <a target="_blank" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Oxidative+stress+in+melanogenesis+and+melanoma+development.">Oxidative stress in melanogenesis and melanoma development.</a> Contemp Oncol (Pozn). 26, 1-7 (2022).</li><li>Jim&#233;nez-Cervantes, C., Mart&#237;nez-Esparza, M., P&#233;rez, C., et al. <a target="_blank" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inhibition+of+melanogenesis+in+response+to+oxidative+stress:+transient+downregulation+of+melanocyte+differentiation+markers+and+possible+involvement+of+microphthalmia+transcription+factor.">Inhibition of melanogenesis in response to oxidative stress: transient downregulation of melanocyte differentiation markers and possible involvement of microphthalmia transcription factor.</a> J Cell Sci. 114, 2335-2344 (2001).</li><li>Da&#324;czak-Pazdrowska, A., Gornowicz-Porowska, J., Pola&#324;ska, A., et al. <a target="_blank" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cellular+senescence+in+skin-related+research:+targeted+signaling+pathways+and+naturally+occurring+therapeutic+agents.">Cellular senescence in skin-related research: targeted signaling pathways and naturally occurring therapeutic agents.</a> Aging Cell. 22, e13845 (2023).</li><li>Green, K. J., Pokorny, J., Jarrell, B. <a target="_blank" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dangerous+liaisons:+loss+of+keratinocyte+control+over+melanocytes+in+melanomagenesis.">Dangerous liaisons: loss of keratinocyte control over melanocytes in melanomagenesis.</a> Bioessays. 46, e2400135 (2024).</li><li>Ali, L., Al Niaimi, F. <a target="_blank" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pathogenesis+of+melasma+explained.">Pathogenesis of melasma explained.</a> Int J Dermatol. 64, 1201-1212 (2025).</li><li>Low, E., Alimohammadiha, G., Smith, L. A., et al. <a target="_blank" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=How+good+is+the+evidence+that+cellular+senescence+causes+skin+ageing.">How good is the evidence that cellular senescence causes skin ageing.</a> Ageing Res Rev. 71, 101456 (2021).</li><li>Chin, T., Lee, X. E., Ng, P. Y., et al. <a target="_blank" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+cellular+senescence+in+skin+aging+and+age-related+skin+pathologies.">The role of cellular senescence in skin aging and age-related skin pathologies.</a> Front Physiol. 14, 1297637 (2023).</li><li>Gerasymchuk, M., Robinson, G. I., Kovalchuk, O., et al. <a target="_blank" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modeling+of+the+senescence-associated+phenotype+in+human+skin+fibroblasts.">Modeling of the senescence-associated phenotype in human skin fibroblasts.</a> Int J Mol Sci. 23, 7124 (2022).</li><li>Zimmermann, T., Pommer, M., Kluge, V., et al. <a target="_blank" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+cellular+senescence+in+human+primary+melanocytes+and+malignant+melanoma+cells+in+vitro.">Detection of cellular senescence in human primary melanocytes and malignant melanoma cells in vitro.</a> Cells. 11, 1489 (2022).</li><li>Tang, J., Li, Q., Cheng, B., et al. <a target="_blank" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Primary+culture+of+human+face+skin+melanocytes+for+the+study+of+hyperpigmentation.">Primary culture of human face skin melanocytes for the study of hyperpigmentation.</a> Cytotechnology. 66, 891-898 (2014).</li><li>Ku&#269;era, O., Endlicher, R., Rou&#353;ar, T., et al. <a target="_blank" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+effect+of+tert-butyl+hydroperoxide-induced+oxidative+stress+on+lean+and+steatotic+rat+hepatocytes+in+vitro.">The effect of tert-butyl hydroperoxide-induced oxidative stress on lean and steatotic rat hepatocytes in vitro.</a> Oxid Med Cell Longev. 2014, 752506 (2014).</li><li>Wedel, S., Martic, I., Hrapovic, N., et al. <a target="_blank" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=tBHP+treatment+as+a+model+for+cellular+senescence+and+pollution-induced+skin+aging.">tBHP treatment as a model for cellular senescence and pollution-induced skin aging.</a> Mech Ageing Dev. 190, 111318 (2020).</li><li>Rabin, D. M., Rabin, R. L., Blenkinsop, T. A., et al. <a target="_blank" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chronic+oxidative+stress+upregulates+drusen-related+protein+expression+in+adult+human+RPE+stem+cell-derived+RPE+cells:+a+novel+culture+model+for+dry+AMD.">Chronic oxidative stress upregulates drusen-related protein expression in adult human RPE stem cell-derived RPE cells: a novel culture model for dry AMD.</a> Aging (Albany NY). 5, 51-66 (2013).</li><li>Shakel, Z., Costa Lima, S. A., Reis, S. <a target="_blank" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Strategies+to+make+human+skin+models+based+on+cellular+senescence+for+ageing+research.">Strategies to make human skin models based on cellular senescence for ageing research.</a> Ageing Res Rev. 100, 102430 (2024).</li><li>Mort, R. L., Jackson, I. J., Patton, E. E. <a target="_blank" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+melanocyte+lineage+in+development+and+disease.">The melanocyte lineage in development and disease.</a> Development. 142, 620-632 (2015).</li><li>Goff, P. S., Castle, J. T., Kohli, J. S., et al. <a target="_blank" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation,+culture,+and+transfection+of+melanocytes.">Isolation, culture, and transfection of melanocytes.</a> Curr Protoc. 3, e774 (2023).</li><li>Martic, I., Wedel, S., Jansen-DÃ¼rr, P., et al. <a target="_blank" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+new+model+to+investigate+UVB-induced+cellular+senescence+and+pigmentation+in+melanocytes.">A new model to investigate UVB-induced cellular senescence and pigmentation in melanocytes.</a> Mech Ageing Dev. 190, 111322 (2020).</li><li>Victorelli, S., Lagnado, A., Halim, J., et al. <a target="_blank" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Senescent+human+melanocytes+drive+skin+ageing+via+paracrine+telomere+dysfunction.">Senescent human melanocytes drive skin ageing via paracrine telomere dysfunction.</a> EMBO J. 38, e101982 (2019).</li><li>Zhang, H., Davies, K. J. A., Forman, H. J. <a target="_blank" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Oxidative+stress+response+and+Nrf2+signaling+in+aging.">Oxidative stress response and Nrf2 signaling in aging.</a> Free Radic Biol Med. 88, 314-336 (2015).</li><li>Birch, J., Gil, J. <a target="_blank" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Senescence+and+the+SASP:+many+therapeutic+avenues.">Senescence and the SASP: many therapeutic avenues.</a> Genes Dev. 34, 1565-1576 (2020).</li><li>Kang, H. Y., Ortonne, J. P. <a target="_blank" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=What+should+be+considered+in+treatment+of+melasma.">What should be considered in treatment of melasma.</a> Ann Dermatol. 22, 373-378 (2010).</li><li>Davalli, P., Mitic, T., Caporali, A., et al. <a target="_blank" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ROS,+cell+senescence,+and+novel+molecular+mechanisms+in+aging+and+age-related+diseases.">ROS, cell senescence, and novel molecular mechanisms in aging and age-related diseases.</a> Oxid Med Cell Longev. 2016, 3565127 (2016).</li><li>Almeida, F. V., Douglass, S. M., Fane, M. E., et al. <a target="_blank" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bad+company:+microenvironmentally+mediated+resistance+to+targeted+therapy+in+melanoma.">Bad company: microenvironmentally mediated resistance to targeted therapy in melanoma.</a> Pigment Cell Melanoma Res. 32, 237-247 (2019).</li><li>Brenner, M., Hearing, V. J. <a target="_blank" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+protective+role+of+melanin+against+UV+damage+in+human+skin.">The protective role of melanin against UV damage in human skin.</a> Photochem Photobiol. 84, 539-549 (2008).</li><li>L&#243;pez-Ot&#237;n, C., Blasco, M. A., Partridge, L., et al. <a target="_blank" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+hallmarks+of+aging.">The hallmarks of aging.</a> Cell. 153, 1194-1217 (2013).</li><li>Videira, I. F., Moura, D. F., Magina, S. <a target="_blank" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mechanisms+regulating+melanogenesis.">Mechanisms regulating melanogenesis.</a> An Bras Dermatol. 88, 76-83 (2013).</li><li>Ratz-&#321;yko, A., Arct, J. <a target="_blank" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Resveratrol+as+an+active+ingredient+for+cosmetic+and+dermatological+applications:+a+review.">Resveratrol as an active ingredient for cosmetic and dermatological applications: a review.</a> J Cosmet Laser Ther. 21, 84-90 (2019).</li><li>Xu, M., Pirtskhalava, T., Farr, J. N., et al. <a target="_blank" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Senolytics+improve+physical+function+and+increase+lifespan+in+old+age.">Senolytics improve physical function and increase lifespan in old age.</a> Nat Med. 24, 1246-1256 (2018).</li><li>Ogrodnik, M., Evans, S. A., Fielder, E., et al. <a target="_blank" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Whole-body+senescent+cell+clearance+alleviates+age-related+brain+inflammation+and+cognitive+impairment+in+mice.">Whole-body senescent cell clearance alleviates age-related brain inflammation and cognitive impairment in mice.</a> Aging Cell. 20, e13296 (2021).</li><li>Hernandez-Segura, A., de Jong, T. V., Melov, S., et al. <a target="_blank" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unmasking+transcriptional+heterogeneity+in+senescent+cells.">Unmasking transcriptional heterogeneity in senescent cells.</a> Curr Biol. 27, 2652-2660.e4 (2017).</li></ol>

The authors declare no competing financial interests. Lieve Declercq is affiliated with Proya Europe; however, the company had no influence on the study design, data collection, analysis, interpretation, or decision to publish. The authors further declare that artificial intelligence (AI) tools were used solely to assist with language editing and text refinement. All scientific content, experimental design, and data interpretation were developed and validated by the authors.

This protocol establishes a standardized approach for inducing stress-induced premature senescence (SIPS) in human neonatal melanocytes using tBHP, offering a robust model for studying senescence specifically in this cell type. Consistent changes in proliferation, morphology, SA-&#946;-gal activity, DNA damage markers, and SASP components support the induced phenotype. By focusing on melanocytes, cells that remain understudied in senescence research despite their key roles in skin physiology and pigmentation disorders<su...

Skin aging is composed of two distinct factors: intrinsic and extrinsic aging1,2. Intrinsic aging is caused by natural chronological processes and genetic factors, while extrinsic aging results from cumulative exposure to environmental stressors, primarily ultraviolet radiation, but also air pollution, cigarette smoke, and chemical agents, which accelerate the aging process beyond normal chronological rates3,4. Environmental exposures generate oxidative stress that overwhelms cellular antioxidant defenses, resulting in DNA damage, protein oxidation, and lipid peroxidation. These molecular alterations trigger persistent DNA damage responses and cellular dysfunction, ultimately promoting premature senescence5,6. This stress-induced senescence contributes to the clinical features of aged skin, including wrinkles, uneven pigmentation, reduced elasticity, and impaired barrier function7.
Melanocytes reside within the basal epidermis and serve as the skin&#8217;s primary defense against UV-induced damage by synthesizing melanin and transferring it to surrounding keratinocytes. Paradoxically, this protective role makes them particularly vulnerable to oxidative stress and premature senescence during extrinsic aging8,9. The melanogenesis process itself generates substantial reactive oxygen species as by-products of tyrosinase-catalized reactions, creating an inherent oxidative burden that is further amplified by environmental exposures such as UV radiation and pollution10,11. As a result, chronic environmental stress can induce oxidative damage, mitochondrial dysfunction, and ultimately cellular senescence12. Despite their importance, key questions remain about the molecular pathways governing melanocyte senescence and how oxidative stress initiates this process. Moreover, the influence of senescent melanocytes on the surrounding skin microenvironment as a driver of age-related skin changes, particularly through the release of SASP factors, remains insufficiently understood13,14.
Although melanocytes are particularly susceptible to oxidative stress&#8211;induced senescence, experimental models to study this process remain limited15,16. Most senescence research continues to rely on replicative or stress-induced senescence models in fibroblasts, but these approaches do not capture the distinct biology of melanocytes or their potential to influence skin aging through cross-talk with neighboring cells and their own SASP profile17. This gap highlights the need for melanocyte-specific senescence models that more accurately reflect their physiological responses to environmental stressors18,19 and their contribution to human skin aging.
Despite the availability of stress-induced senescence approaches, their implementation in primary human melanocytes remains technically challenging and is often associated with substantial variability. Melanocytes are particularly sensitive to oxidative stress, resulting in a narrow experimental window between effective senescence induction and excessive cytotoxicity. In addition, donor-dependent differences in primary cell preparations further contribute to inconsistent outcomes across studies. These challenges are frequently underreported, and protocols are often insufficiently standardized, limiting reproducibility. The present protocol addresses this gap by providing an optimized and reproducible treatment regimen, defined dosing schedule, and standardized readouts for reliable induction and assessment of senescence in primary human melanocytes.
Tert-butyl hydroperoxide (tBHP) is a well-characterized inducer of oxidative stress that promotes senescence by generating reactive oxygen species and depleting cellular antioxidant defenses. It has been widely used to induce senescence in dermal fibroblasts, where it triggers hallmark senescence markers while maintaining cell viability20,21. Because tBHP produces sustained oxidative stress through defined biochemical pathways, it offers a reproducible and accessible system for studying oxidative stress&#8211;induced senescence and investigating the molecular mechanisms linking oxidative damage to aging processes22,23. In contrast to UV-based models, tBHP is particularly advantageous when a controlled, reproducible induction of oxidative stress is required, independent of irradiation parameters and without the need for specialized equipment.
HNM provides a relevant model for studying extrinsic aging mechanisms24. As primary cells derived from foreskin, they retain intact stress-response pathways and avoid artifacts associated with genetic modification or immortalization25. Neonatal melanocytes provide an optimal experimental model as they exhibit minimal baseline damage, enabling clear assessment of environmental stressor-induced senescence pathways26,27.
This study employs tBHP-induced oxidative stress in primary human neonatal melanocytes, overcoming limitations of non-melanocytic and immortalized cell models commonly used in senescence research. It provides a standardized platform for examining melanocyte-specific senescence mechanisms and characterizing the senescent phenotype with established markers. Overall, this protocol provides a reproducible, physiologically relevant model for studying oxidative stress&#8211;induced senescence in melanocytes.

<table><tbody><tr><td>0.22 &amp;micro;m membrane filter</td><td>Merck&amp;nbsp;</td><td>SLGVR33RS</td><td></td></tr><tr><td>1 M citric acid&amp;nbsp;</td><td>Merck&amp;nbsp;</td><td>K91567844</td><td>prepare in aq. dest.</td></tr><tr><td>1 M MgCl&lt;sub&gt;2&lt;/sub&gt;</td><td>Merck</td><td>A649033</td><td>prepare in aq. dest.</td></tr><tr><td>1 M Na&lt;sub&gt;2&lt;/sub&gt;HPO&lt;sub&gt;4&lt;/sub&gt;</td><td>Merck</td><td>K56036736</td><td>prepare in aq. dest.</td></tr><tr><td>10 M NaOH</td><td>Lab Honeywell</td><td>30620</td><td>prepare in aq. dest.</td></tr><tr><td>37% formaldehyde</td><td>Sigma</td><td>252549</td><td></td></tr><tr><td>4% paraformaldehyde</td><td>CarlRoth</td><td>0335.3</td><td></td></tr><tr><td>5 M Sodium Chloride&amp;nbsp;</td><td>Sigma</td><td>S3014</td><td>prepare in aq. dest.</td></tr><tr><td>50% glutaraldehyde</td><td>Sigma</td><td>G6403</td><td></td></tr><tr><td>5-Brom-4-Chlor-3-indolyl-&amp;beta;-D-Galactopyranosid (X-Gal)</td><td>Sigma</td><td>B9146</td><td></td></tr><tr><td>Alexa Fluor-conjugated secondary antibody 2 mg/mL</td><td>Invitrogen</td><td>A11008</td><td></td></tr><tr><td>BSA (bovine serum albumin)</td><td>Sigma</td><td>A7030</td><td></td></tr><tr><td>Chemiluminescent substrate</td><td>Sigma</td><td>WBKLS0500</td><td></td></tr><tr><td>Costar CellLifter&amp;nbsp;</td><td>Corning</td><td>3008</td><td></td></tr><tr><td>Coverslips for cell culture/microscopy</td><td>Epredia</td><td>CB00200RA120MNZ0</td><td></td></tr><tr><td>DermaLife Basal Medium</td><td>CellSystems</td><td>LM-0004</td><td></td></tr><tr><td>DermaLife M Melanocyte Kit&amp;nbsp;</td><td>CellSystems</td><td>LS-1041</td><td></td></tr><tr><td>Dulbecco&#039;s Phosphate Buffered Saline&amp;nbsp;</td><td>Sigma</td><td>D8537</td><td></td></tr><tr><td>Human neonatal melanocytes</td><td>CellSystems</td><td>FC-0023</td><td></td></tr><tr><td>LaminB1 antibody (rabbit)</td><td>Abcam</td><td>AB16048</td><td>Dilution 1:1000 in 5% BSA</td></tr><tr><td>Mounting medium containing DAPI</td><td>Abcam</td><td>AB104139</td><td></td></tr><tr><td>Penicillin-Streptomycin solution&amp;nbsp;</td><td>Sigma</td><td>P4333</td><td></td></tr><tr><td>Polyacrylamide gradient gels</td><td>Bio-Rad</td><td>456-8095</td><td></td></tr><tr><td>Poly-D-Lysine, 0.1 mg/mL&amp;nbsp;</td><td>Gibco</td><td>A38904-01</td><td></td></tr><tr><td>Potassium ferricyanide</td><td>Sigma</td><td>P8131</td><td></td></tr><tr><td>Potassium ferrocyanide</td><td>Sigma</td><td>P-9387</td><td></td></tr><tr><td>pRB antibody (rabbit)</td><td>CellSignalling</td><td>93085</td><td>Dilution 1:1000 in 5% BSA</td></tr><tr><td>Protease inhibitor cocktail</td><td>self prepared</td><td>N/A</td><td>500 mM NaF; 2 &amp;micro;g/ml Aprotinin; 1 mM PMSF; 1 mM activated Na-Orthovanadate</td></tr><tr><td>RIPA buffer&amp;nbsp;</td><td>self prepared</td><td>N/A</td><td>containing: 50 mM Tris-HCl; 1% NP-40; 0.5% Na-deoxycholate; 0.1% SDS; 150 mM NaCl; 2 mM EDTA</td></tr><tr><td>RLT buffer</td><td>Qiagen</td><td>1015762</td><td>Included in RNeasy Mini Kit&amp;nbsp;</td></tr><tr><td>RNeasy Mini Kit</td><td>Qiagen</td><td>74106</td><td></td></tr><tr><td>Skim milk powder (for 5% milk in TBS-T)</td><td>Sigma</td><td>70166</td><td></td></tr><tr><td>Sodium citrate (for 0.1% solution)</td><td>Sigma</td><td>S4641</td><td></td></tr><tr><td>Soybean trypsin inhibitor, 0.5 mg/mL&amp;nbsp;</td><td>Thermofisher</td><td>17075-029</td><td></td></tr><tr><td>tert-Butyl hydroperoxide (tBHP)</td><td>Sigma</td><td>458139</td><td></td></tr><tr><td>Triton X-100 (for 0.3% solution)</td><td>Sigma</td><td>T9284</td><td></td></tr><tr><td>Trypsin-EDTA solution</td><td>Sigma</td><td>T3924</td><td></td></tr><tr><td>&amp;beta;-mercaptoethanol</td><td>CarlRoth</td><td>4227.3</td><td></td></tr><tr><td>&amp;gamma;H2AX antibody (rabbit)</td><td>CellSignalling</td><td>2577S</td><td>Dilution 1:200&amp;nbsp;</td></tr></tbody></table>

a standardized protocol for inducing stress-induced premature senescence in primary human melanocytes using tert-butyl hydroperoxide

A Standardized Protocol for Inducing Stress-Induced Premature Senescence in Primary Human Melanocytes Using Tert-butyl Hydroperoxide

Environmental stressors, including UV radiation, air pollution, or cigarette smoke, drive extrinsic skin aging. Exposure to these extrinsic aging factors promotes the accumulation of senescent cells, which contributes to the formation of wrinkles and pigmentation disorders. Melanocytes, which provide primary UV protection, exhibit reduced activity with age. Senescent melanocytes accumulate in aged skin and contribute to its aging appearance; However, there are few models to study melanocyte senescence, and this work aims to develop a reproducible model for further research. In this study, we present a senescence model of human neonatal melanocytes (HNM) using tert-butyl hydroperoxide (tBHP), a well-characterized oxidative stress inducer. tBHP disrupts redox homeostasis by depleting cellular antioxidant defenses and promoting radical overproduction, resulting in DNA and protein damage. We characterize the senescence phenotype of tBHP-treated melanocytes through the analysis of established senescence markers, including restricted growth potential, morphological changes, and SA-&#946;-Galactosidase activity. This model provides a valuable tool for investigating stress-induced premature senescence in melanocytes, offering insight into their role in extrinsic skin aging and pigmentation disorders.

tBHP treatment induces growth arrest in human neonatal melanocytes. 
tBHP treatment inhibits melanocyte proliferation compared to untreated controls (n = 3) (Figure 2A). By day 9, treated cells reach only 1.4 cPDL, whereas controls reach 3.1 cPDL. This divergence increases over time, with treated melanocytes approaching a plateau of 1.9 cPDL by day 15, while controls continue to expand to nearly 5.1 cPDL. The sustained reduction in proliferative capacity is consistent wit...

A standardized protocol for inducing premature senescence in HNM using tBHP, standardized protocols for analyzing key senescence markers, including growth arrest, SA-&#946;-galactosidase activity, and SASP factors.

Environmental stressors, including UV radiation, air pollution, or cigarette smoke, drive extrinsic skin aging. Exposure to these extrinsic aging factors ...

Our research focuses on investigating the senescence phenotype of melanocytes and its contribution to extrinsic skin aging. Established senescence models use fibroblasts and failure to capture melanocyte-specific biology. This protocol induces tBHP-mediated oxidative stress in primary human melanocytes.To begin, gather the required reagents. After thawing the melanocytes and allowing them to recover for three days, ensure that the cells reach 80 to 90%confluency on the seeding day. Aspirate the medium from the flask.Wash the cells twice with DPBS. Add two milliliters of trypsin EDTA solution to detach the cells. Place the flask in the incubator for five minutes at 37 degrees Celsius with 5%carbon dioxide.Gently tap the flask. And under the microscope, observe the cells to confirm complete detachment. Add 1.5 times the volume of trypsin inhibitor to stop the reaction.Transfer the cell suspension to a 15-milliliter conical tube. Dilute the suspension with DPBS to a final volume of 10 milliliters. Centrifuge the cell suspension at a relative centrifugal force of 100 for five minutes.Aspirate the supernatant and re-suspend the cell pellet in medium to the desired volume. Seed 600, 000 cells per 10 centimeter dish for tert-Butyl hydroperoxide, or tBHP, treated plates. Seed 400, 000 cells per plate for the control plates.Prepare a 10 millimolar working solution from the tBHP stock using DPBS or media. Add 100 micromolar tBHP to the cells for one hour per treatment. Move the plate back and forth to distribute the tBHP evenly throughout the medium.Place the cells in the incubator for precisely one hour at 37 degrees Celsius with 5%carbon dioxide. Aspirate the medium to terminate the tBHP treatment. Wash the plates twice with preheated DPBS at 37 degrees Celsius.Add the appropriate volume of fresh medium to the plates. Place the plates in the incubator and allow the cells to recover for at least four hours before the next treatment. Repeat the treatment procedure later on the same day for the second treatment.Continue the treatment regimen through day four, then maintain the cells in culture until day nine to assess senescence markers. Count the tBHP-treated cells and control cells. Reseed them at the same initial density, or if fewer than 600, 000 cells are obtained from the tBHP-treated plates, reseed all collected cells.Count the cells on days four, nine, and 15 of culture. On day nine, wash the cells twice with PBS. Fix the cells using 2%formaldehyde and 0.4%glutaraldehyde.Wash the fixed cells twice with PBS. Incubate the fixed cells in a staining solution at pH 6. Cover the plate to protect it from light, then incubate them for 18 hours at 37 degrees Celsius in the absence of carbon dioxide.Wash the cells twice with PBS. Using light microscopy, image and count the number of blue stained cells. Divide it by the total number of cells within the same field.Express the results as the percentage of positive cells. Following oxidative stress induction, tBHP treatment significantly reduced melanocyte proliferation compared to controls. The treated cells reached only 1.4 cumulative population doublings, or cPDL, by day nine, whereas controls reached 3.1 cPDL.By day 15, treated cells plateaued at 1.9 cPDL, while control cells expanded to 5.1 cPDL. Melanocytes treated with tBHP showed increased cell surface area compared to controls at all measured time points, with enlargement progressing until day 15, consistent with the enlarged and flattened morphology of senescent cells. tBHP-treated melanocytes showed an increase in senescence-associated beta-galactosidase, or SA-beta-galactosidase activity, with 32%positive cells compared with 3%in controls.The rise in SA-beta-galactosidase positivity was consistent with a senescent phenotype. Immunofluorescence analysis showed increased gamma-H2AX levels in tBHP-treated melanocytes compared with controls. The treated cells showed stronger gamma-H2AX signal than controls.Real-time quantitative polymerase chain reaction analysis demonstrated increased senescence-associated secretory phenotype factor expression, with interleukin-8 showing the largest increase. While interleukin-6 and matrix metalloproteinase-1 showed moderate increases. Western blot analysis confirmed senescence induction.Lamin B1 showed a significant reduction in tBHP-treated melanocytes compared to controls. Phosphorylated retinoblastoma protein levels were reduced in tBHP-treated melanocytes compared to controls. tBHP treatment increased transcriptional expression of p16 and p21 in melanocytes.This model allows researchers to study how senescence melanocytes affect pigmentation and communicate with surrounding cells via SASP inflammatory factors. The challenge in this protocol is precise timing. tBHP must be applied twice daily with at least four hours interval.Following this protocol, senescence can be characterized using senescence-associated beta-galactosidase staining, immunofluorescence, RT-qPCR, and Western blotting of established senescence markers.

a-standardized-protocol-for-inducing-stress-induced-premature

Research

JoVE Journal

Biology

This video describes a method to measure UV sensitivity in a humanized mouse model—a mouse model that mimics human skin. We determine the minimal erythematous dose (MED) of UV radiation that can cause erythema or edema on the skin. The method can help to find out the efficacy of drugs used to reduce UV sensitivity.

Minimum Erythematous Dose Assay: A Method for Measuring UV Sensitivity in Mouse Models

Epidermal melanin is induced by topical application of forskolin in a murine model of the fair-skinned UV-sensitive human.    Pharmacologic manipulation of cAMP levels in the skin and epidermal darkening strongly protect against UV-mediated inflammation (sunburn) as measured by the minimum erythematous dose (MED) assay.

Pharmacologic Induction of Epidermal Melanin and Protection Against Sunburn in a Humanized Mouse Model

This work describes an in vitro differentiation protocol to produce pigmented, mature melanocytes from human pluripotent stem cells via a neural crest and melanoblast intermediate stage using a feeder-free, 25 day protocol.

Feeder-free Derivation of Melanocytes from Human Pluripotent Stem Cells

Here, we discuss a series of protocols for induction and validation of cellular senescence in cultured cells. We focus on different senescence-inducing stimuli and describe the quantification of common senescence-associated markers. We provide technical details using fibroblasts as a model, but the protocols can be adapted to various cellular models.

Induction and Validation of Cellular Senescence in Primary Human Cells

The following procedure describes a method for spatial and temporal control of melanocytic tumor initiation in murine dorsal skin, using a genetically engineered mouse model. This protocol describes macroscopic as well as microscopic cutaneous melanoma initiation.

Spatial and Temporal Control of Murine Melanoma Initiation from Mutant Melanocyte Stem Cells

The aim of this protocol is to induce transient in vivo production of nonlethal levels of reactive oxygen species (ROS) in mouse skin, further promoting physiological responses in the tissue.

Stimulation of Stem Cell Niches and Tissue Regeneration in Mouse Skin by Switchable Protoporphyrin IX-Dependent Photogeneration of Reactive Oxygen Species In Situ

This paper reports that the addition of Y-27632 to TIVA medium can significantly increase the yield of melanocytes from adult skin tissues.

Y-27632 Enriches the Yield of Human Melanocytes from Adult Skin Tissues

We present a protocol for the development and use ofan oxidative stress-model by treating retinal pigment epithelial cells with H2O2, analyzing cell morphology, viability, density, glutathione, and UCP-2 level. It is a useful model to investigate the antioxidant effect of proteins secreted by transposon-transfected cells to treat neuroretinal degeneration.

Induction and Analysis of Oxidative Stress in Sleeping Beauty Transposon-Transfected Human Retinal Pigment Epithelial Cells

Here, we describe an optimized direct reprogramming system for melanocytes and a high-efficiency, concentrated virus packaging system that ensures smooth direct reprogramming.

Direct Reprogramming of Mouse Fibroblasts into Melanocytes

This method studies how senescent skin fibroblasts affect healthy ones. Senescence is induced via UVB exposure, and the conditioned medium is applied to normal fibroblasts. It helps evaluate bioactive compounds targeting altered cell-to-cell communication in skin aging.

Novel Combination Of Antioxidants To Restore Healthy Intercellular Communication In An In vitro Model Using Conditioned Medium From Senescent Cells

Universität Innsbruck.  A standardized protocol for inducing premature senescence in HNM using tBHP, standardized protocols for analyzing key senescence markers, including growth arrest, SA-β-galactosidase activity, and SASP factors.

A Standardized Protocol for Inducing Stress-Induced Premature Senescence in Primary Human Melanocytes Using Tert-butyl Hydroperoxide

Explore More Videos