Diagnosis and Treatment of Thelazia callipaeda Infection: A Case Report

Summary

Here, we present a protocol for treating ocular infection caused by Thelazia callipaeda. in a patient without pet contact, including a standardized outpatient nematode extraction procedure, morphological identification, recombinase polymerase amplification–CRISPR-Cas12a molecular diagnosis, and postoperative care without recurrence.

Abstract

This study reports a 50-year-old male case of Thelazia callipaeda infection without a history of pet contact. The patient exhibited chronic ocular surface inflammation after exposure to wild insects and was misdiagnosed multiple times with bacterial conjunctivitis before definitive diagnosis by an ophthalmic specialist. This report emphasizes the core steps of the T. callipaeda extraction procedure. These steps include preoperative preparation, topical ocular anesthesia using 0.4% oxybuprocaine hydrochloride eye drops, sufficient exposure of the surgical field with an eyelid speculum, precise clamping and complete removal of nematodes under ophthalmic visualization, and immediate postoperative management. The entire procedure was recorded in a supplementary operative video. Additionally, the procedure can be conducted under conventional outpatient clinic conditions, making it suitable for primary medical institutions. Postoperatively, the patient received anti-infective therapy with 0.5% levofloxacin eye drops, administered four times daily, and ocular surface moisturization with 0.1% sodium hyaluronate eye drops, administered four times daily, for 1 week, with standard follow-up at 1, 3, and 6 months postoperatively. The clinical manifestations, including conjunctival hyperemia and foreign body sensation, were completely alleviated without recurrence, and ocular surface function returned to normal. Etiological confirmation was verified through morphological observation, characterized by serrated cuticular striations, a hexagonal buccal capsule, and a gravid female reproductive system, and recombinase polymerase amplification–CRISPR-Cas12a molecular detection targeting the 18S ribosomal ribonucleic acid gene. Critical procedural precautions to prevent nematode fragmentation and residual inflammation are also underscored. This case enriches the clinical reports of T. callipaeda. infection without a pet contact history and offers a practical diagnosis and treatment protocol for ophthalmologists.

Introduction

Thelazia callipaeda. is a zoonotic parasitic nematode initially reported in Asian countries, with an increasing number of cases in European nations over the past decade¹. Previous studies have identified dogs, rabbits, cattle, and humans as definitive hosts, and drosophilids as intermediate hosts^2,3. Transmission occurs via vector-mediated deposition of infective larvae when drosophilid flies feed on tear secretions, after which the larvae develop into adult worms within the conjunctival sac of the definitive host⁴.

Infection ....

Protocol

This study was approved by the Ethics Committee of the Second Affiliated Hospital of Army Medical University. No approval number was assigned by the Ethics Committee. Written informed consent was obtained from the patient for participation and publication.

The procedure was performed under sterile clinical conditions. The patient was placed in the supine position, and illumination was provided using an ophthalmic surgical shadowless lamp.

1. Preoperative Preparation

1. The patient was provided with informed consent and instructed to maintain a steady gaze during the procedure, avoid eye ....

Results

Following successful execution of the procedure, all nematodes were completely removed from the conjunctival sac without intraoperative complications. Macroscopic observation confirmed the presence of motile, translucent worms consistent with ocular parasitic infection.

Morphological examination revealed characteristic features of T. callipaeda. Under low magnification, distinct cuticular transverse striations were observed along the body surface (Figure 2

Discussion

The standardized nematode extraction procedure described in this study is defined by a series of critical steps that are essential for successful treatment of T. callipaeda. infection. Preoperative communication and informed consent not only address ethical requirements but also help reduce patient anxiety and facilitate a smooth procedure. Adequate exposure of the upper and lower conjunctival fornices is a key step, as it minimizes the risk of worms remaining hidden within recessed areas of the conjunctival sac.......

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
Blood/Cell/Tissue Genomic DNA Extraction Kit	TIANGEN Biotech (Beijing) Co., Ltd.	DP304-03	Used for extraction of genomic DNA from nematode samples
CRISPR Nucleic Acid Detection Lateral Flow Strip	Shenzhen EZassay Biotech Ltd.	HD-FMBO-96	Used for visual detection of amplified DNA
Coverslips	NEST	801009	Used to cover specimens during microscopic observation
crRNA	Sangon Biotech (Shanghai) Co., Ltd.	Custom synthesized	Guide RNA used in CRISPR–Cas12a detection (sequence: UAAUUUCUACUAAGUGUAGAUCC UUGAAAAAAUUAGAGUGCU)
Glass slides	SEP	7101	Used for mounting specimens for microscopy
Levofloxacin eye drops	Santen Pharmaceutical Co., Ltd.	J20100046	Used for postoperative anti-infective treatment
LbCas12a protein	Shanghai TOLO Biotechnology Co., Ltd.	32108-03	Enzyme used for CRISPR-based nucleic acid detection
Light microscope	Motic	BA210	Used for low- and high-magnification morphological identification
Liquid nitrogen	Chongqing Messer Gas Products Co., Ltd.	20250113	Used for rapid freezing and grinding of biological samples
Magnesium acetate	TwistDx Ltd.	TABAS03KIT	Component of RPA kit used to initiate amplification reaction
Nuclease-free water	Servicebio	G4700	Used for preparation of molecular biology reactions
Ophthalmic forceps	JZ Surgical Instruments	YA1030	Used for mechanical extraction of nematodes
Oxybuprocaine hydrochloride eye drops (0.4%)	Santen Pharmaceutical Co., Ltd.	HJ20215002	Used for topical ocular anesthesia
PBS	Boster Biological Technology	AR0032	Used for irrigation and specimen preparation
Primers (forward and reverse)	Sangon Biotech (Shanghai) Co., Ltd.	Custom synthesized	Used for amplification of target DNA in RPA reaction (Forward: CTTAATTGGTTGCATATAGTGGCTG GCATG; Reverse: CGAGTATTCAAGCATTATAAGC CCGCGTTA)
Real-time PCR detection system	Bio-Rad Laboratories, Inc.	CFX96	Used for fluorescence signal detection in CRISPR assay
Recombinase Polymerase Amplification Kit	TwistDx Ltd.	TABAS03KIT	Used for isothermal DNA amplification
Slit-lamp microscope	Haag-Streit AG	BX900	Used for ocular examination and illumination during extraction
Stereomicroscope	NOVEL	SE2200	Used for macroscopic observation of nematode specimens
ssDNA reporter	Sangon Biotech (Shanghai) Co., Ltd.	Custom synthesized	Reporter molecule used in CRISPR–Cas12a detection (FAM-TTATT-BHQ1)
TB Green Premix Ex Taq II	Takara Bio Inc.	RR820A	Used for fluorescence-based nucleic acid amplification detection
T7 High Yield RNA Transcription Kit	Novoprotein Scientific Inc.	E131-01A	Used for synthesis of RNA components