Lentiviral SgRNA Delivery for CRISPR/Cas9 Editing in Cre-Dependent Cas9 Knock-in Primary Mouse Hepatocytes

Summary

This protocol describes the isolation and culture of primary hepatocytes from Loxp-Stop-Loxp (LSL)-Cas9-EGFP mice and lentiviral sgRNA delivery for CRISPR/Cas9-mediated gene knockout in monolayer cultures and hepatocyte organoids. The method enables high hepatocyte yield and viability and supports efficient gene-specific knockout validation in physiologically relevant primary hepatocyte models.

Abstract

Over the past few decades, CRISPR/Cas9-mediated genome editing has transformed functional studies in cell line models by making genetic manipulation highly efficient and feasible. However, extending this technology to primary hepatocytes remains a major challenge. While cultured primary hepatocytes are indispensable for disease modeling and drug development as they retain key metabolic functions absent in cell lines, their limited in vitro lifespan and negligible proliferative capacity pose fundamental barriers to efficient genome editing. Here, we describe an effective two-step perfusion protocol that enables the isolation of primary hepatocytes with high cell viability (>90%) and high yield (approximately 1 × 10⁷ hepatocytes per adult mouse). Following isolation, lentiviral sgRNA transduction is typically performed within 3–4 h, and genome editing outcomes are assessed 5–7 days post-infection. Using hepatocytes from transgenic LSL-Cas9-EGFP mice, in which the Cas9 cassette was activated by a lentiviral vector co-expressing Cre recombinase and sgRNA, achieving up to 80% allele-level gene knockout efficiency in monolayer cultures. In addition, we achieved approximately 12% gene KO efficiency in three-dimensional hepatocyte organoids (HEOs), which more closely recapitulate the architecture and functional characteristics of native liver tissue. In this protocol, a successful experiment is defined by three criteria: sufficient hepatocyte yield (>5 × 10⁶ cells per mouse) with high viability (>85%), efficient single-guide RNA (sgRNA) delivery into hepatocytes, and validated target gene disruption at the genomic level. This protocol demonstrates the feasibility of efficient in vitro genome manipulation in both monolayer-cultured hepatocytes and HEOs, providing a robust platform for genetic modeling and functional studies of liver diseases.

Introduction

Genome-editing technologies enable precise investigation of gene function in physiologically relevant systems. Therefore, applying CRISPR/Cas9 directly to primary cells is a critical strategy, as it enables genetic investigation within a native cellular environment^1,2. For instance, this approach has enabled the modeling of cystic fibrosis in primary intestinal stem cells³, the study of Duchenne muscular dystrophy in patient-derived myoblasts⁴, and the therapeutic engineering of primary T cells for cancer immunotherapy⁵.

The liver is a vital organ that performs a wide range of essential physiological functions, including detoxification, carbohydrate metabolism, lipid metabolism, and immune responses⁶. At the cellular level, primary hepatocytes constitute the major parenchymal cell population of the liver and are responsible for most hepatic metabolic and synthetic functions⁷. Impairment or loss-of-function of hepatocytes can lead to various liver diseases, such as metabolic disorders, liver cirrhosis, and progressive liver failure⁸. Therefore, dissecting gene function in hepatocytes and establishing reliable genome-engineered hepatocyte models are essential for elucidating the cellular and molecular mechanisms of liver development and pathogenesis.

Efficient genetic manipulation of primary hepatocytes remains challenging due to their limited lifespan and minimal proliferative capacity in vitro. Substantial efforts have been devoted to prolonging the culture longevity and maintaining the functionality of primary human hepatocytes^9,10. In particular, Zhang et al. reported strategies for large‑scale expansion of patient‑derived hepatocytes combined with CRISPR/Cas9-mediated gene correction, demonstrating that primary human hepatocytes can be efficiently edited in vitro and possess translational potential for treating inherited liver disorders¹¹. However, optimization of in vitro culture conditions for primary mouse hepatocytes remains largely unexplored. Compared with human hepatocytes, which are limited in availability and subject to ethical restrictions, mouse hepatocytes provide a more accessible and convenient platform for genome-editing studies. A previously study demonstrated that electroporation of Cas9 ribonucleoproteins and mRNA into primary mouse and human hepatocytes resulted in on-target editing efficiencies of up to 95% and 52.4%, respectively¹². However, electroporation-mediated delivery approaches are limited by the requirement for specialized equipment and kits. Building on the study Zhang et al.¹³, in which several culture conditions and gene delivery approaches for primary mouse hepatocytes were systematically evaluated, we have established and optimized this protocol to provide an efficient, cost-effective and reproducible workflow for gene knockout in primary mouse hepatocytes, suitable for downstream genetic and molecular analyses.

Organoids are miniaturized, self-organizing three-dimensional (3D) structures capable of being cultured in vitro¹⁴. Supported by the extracellular matrix and a cocktail of growth factors, organoids can more accurately recapitulate organ structure and function than traditional two-dimensional (2D) cell line or animal models¹⁵. The combination of organoid culture and CRISPR/Cas9-mediated genome manipulation technology enables in vitro modeling of disease mechanisms and exploration of candidate gene-drug interactions. For example, two independent studies employed CRISPR-based loss- or gain-of-function of cancer-related genes in wild-type human colon organoids to model and investigate cancer initiation process^16,17. Yuan-Hung Lo et al. utilized CRISPR/Cas9-mediated ARID1A knockout in TP53-deficient normal human gastric organoids to recapitulate morphological dysplasia and tumorigenic progression during early gastric cancer initiation¹⁸. Beyond cancer modeling, genetically engineered organoids have been employed to dissect gene-drug interactions, identify candidate drugs for liver steatosis, and study fate transitions during blood vascular organoid development^19,20,21. These advances in genetically engineered organoid models highlight the value of CRISPR/Cas9 technology in recapitulating physiological and pathological developmental processes and in facilitating the discovery of potential drug targets.

This protocol provides an efficient, cost-effective, and reproducible workflow for performing targeted gene knockout experiments in both monolayer-cultured mouse hepatocytes and HEOs, including hepatocytes isolation, lentivirus packaging, lentivirus-mediated sgRNA delivery and the quantification of genome-editing efficiency. Using this protocol, approximately 1 × 10⁷ hepatocytes per mouse can be isolated with viability exceeding 85%, and two mice can typically be processed in parallel during a single isolation experiment. We utilized a Cre-dependent LSL-Cas9-EGFP mouse to reduce the challenge of Cas9 delivery to improve the transduction efficiency²², and the genome editing efficiency in primary adult hepatocytes reached up to 85% in monolayer cultures and 12% in HEOs, respectively. Due to the binucleated or multinucleated nature of hepatocytes, genome-editing efficiency in this study was defined based on allele-level indel frequency rather than the proportion of edited cells. Although this protocol relies on a transgenic Cas9 mouse line, it is also feasible to use wild-type mice in combination with an all-in-one sgRNA-Cas9 lentiviral vector. In addition, this protocol provides procedures for sgRNA plasmid construction and quantification of gene knockout efficiency. Overall, this workflow provides a practical and reproducible approach for gene-specific knockout validation in primary mouse hepatocytes and is primarily optimized for targeted gene perturbation studies rather than large-scale pooled CRISPR screening.

Protocol

Ethics statement
All animal procedures were performed in accordance with institutional guidelines and were approved by the Institutional Animal Care and Use Committee (IACUC) of the Shanghai Institute of Materia Medica, Chinese Academy of Sciences (Approval No. 2024-12-ZDX-010).

Figure 1 provides a schematic overview of the experimental workflow.

1. Construction of sgRNA plasmid

1. Order a pair of forward and reverse oligos for generating the sgRNA cloning fragment.
   Oligo_gSP_F: TATATATCTTGTG
   GAAAGGACGAAACACCGNNNNNNNNNNNNNNNNNNNN
   Oligo_gSP_R: AGCCTTATTTTAAC
   TTGCTATTTCTAGCTCTAAAACNNNNNNNNNNNNNNNNNNNN
   NOTE: The N20 sequence is the specific sgRNA sequences. In this protocol, the mouse Apob gene is used here as an example, and the oligo sequences are as follows:
   mApob_gSP_F: TATATATCTTG
   TGGAAAGGACGAAACACCG
   ACCCCACCATCCATCCGCCA
   mApob_gSP_R: AGCCTTATT
   TTAACTTGCTATTTCTAGCTCTAA
   AACTGGCGGATGGATGGTGGGGT
2. Prepare the PCR reaction mixture freshly as following: 1.5 µL of 10 µM mApob_gSP_F, 1.5 µL of 10 µM mApob_gSP_R, 25 µL of 2× KAPA HiFi Master Mix and 22 µL of nuclease-free water (NFW).
   NOTE: Keep the 2× KAPA HiFi Master Mix on ice and prepare the PCR mixture immediately before use.
3. Perform PCR in a PCR thermal cycler using the following program: initial denaturation at 95 °C for 3 min, following 10 cycles of denaturation at 98 °C for 20 s, annealing at 65 °C for 15 s, extension at 72 °C for 15 s, with a final extension at 72 °C for 1 min.
4. Purify the PCR product using a PCR purification kit according to the manufacturer’s instructions (See Table of Materials for details).
5. Prepare the digested backbone vector using the following reaction system: 4 µg of Cre recombinase and sgRNA co-expressing lentiviral vector (See Supplement Materials for annotated plasmid map and for full plasmid sequence), 3 µL of BsmBI-v2, 5 µL of buffer r3.1 and appropriate volume of NFW to a final volume of 50 µL.
   NOTE: The choice of sgRNA backbone vector is flexible.
6. Incubate the digestion reaction in a PCR thermal cycler at 55 °C for 3 h.
7. Load the digested DNA together with a DNA ladder and run a 1% agarose gel at 120 V for 30 min to confirm the complete digestion. In addition to the larger fragment, release a ~2 kb fragment from the vector.
8. Purify the digested vector using a PCR purification kit according to the manufacturer’s instructions.
9. Prepare the Gibson assembly reaction mixture as following: 50 ng of digested vector, 20 ng of annealed PCR product, 5 µL of Gibson Assembly master mix and appropriate volume of NFW to a final volume of 10 µL.
10. Incubate the Gibson assembly reaction mixture in a PCR thermal cycler at 50 °C for 30 min.
11. Store the assembled product at -20 °C or proceed to transformation into the Stbl3 competent cells immediately.
    1. Add 1 µL of Gibson assembled product to 50 µL of competent cells.
       NOTE: The volume of DNA should not exceed 5% volume of competent cells.
    2. Incubate the mixture on ice for 30 min, followed by heat shock at 42 °C for 45 s.
    3. Immediately place the cells on ice for 2 min, then add 1000 µL of pre-warmed Luria-Bertani (LB) medium and incubate at 37 °C with shaking at 250 rpm for 1 h.
    4. Plate 1 mL of the transformation mixture on pre-warmed 10-cm round petri dish (ampicillin) using a spreader.
    5. Grow the plate inverted overnight at 37 °C.
12. Pick up clones and sequence them using pLKO1_5 primer (5’-GACTATCATATGCTTACCGT).
13. Expected Sequence (U6 promoter-sgRNA sequence-scaffold): GACTATCATATGCTTACCGTAA
    CTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGT
    GGAAAGGACGAAACACCGNNNNNNNNNNNNNNNNNN
    NNGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTC
    CGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTT
14. Purify the plasmid using a Plasmid DNA purification kit according to the manufacturer’s instructions for downstream lentiviral production.
    Pause Point: Purified plasmid DNA can be stored at 4 °C for up to 1 week for short-term use or at -20 °C for long-term storage before proceeding to lentiviral production.

2. Lentiviral vector packaging and titer determination

Caution: Lentiviral vectors are biohazardous. Perform all manipulations under Biosafety Level 2 (BSL-2) containment in accordance with institutional biosafety regulations. Decontaminate surfaces and waste according to institutional guidelines.

1. Seed HEK293T cells in a 15-cm culture dish with 22 mL of complete DMEM supplemented with 10% fetal bovine serum (FBS) at a density of 4.5 × 10⁶ cells per dish.
2. Perform plasmid DNA transfection as follows:
   1. Dilute a total of 48 µg of plasmid DNA, including 6 µg of VSV-G envelope expressing plasmid, 24 µg of lentiviral packaging plasmid psPAX2 and 18 µg of the sgRNA lentiviral vector, in serum-free medium to a final volume of 1.2 mL. Mix thoroughly by pipetting up and down.
   2. Dilute 120 µL of polyethyleneimine (PEI) reagent in 1.08 mL of Opti-MEM to a final volume of 1.2 mL. Mix thoroughly by pipetting up and down.
   3. Add the PEI solution to the diluted plasmid DNA solution dropwise. Mix thoroughly by pipetting up and down.
   4. Incubate the mixture at room temperature for 15 min to allow the formation of PEI/DNA complexes.
      NOTE: Perform transfection when the cells reach approximately 70%–80% confluence.
3. Add 2.4 mL of transfection mixture to the HEK293T cells and gently rock the dish to evenly distribute the complexes.
4. Incubate the cells at 37 °C in a cell incubator for 12–16 h.
5. After 12–16 h of incubation, replace the medium with 22 mL of fresh culture medium (DMEM containing 10% FBS).
6. At 48 h post-transfection, collect the viral supernatant into a 50 mL centrifuge tube and temporarily store at 4 °C. Add 22 mL of pre-warmed culture medium to the dish and incubate the cells at 37 °C for another 24 h.
7. At 72 h post-transfection, collect a second batch of viral supernatant into the former 50 mL centrifuge tube temporarily stored at 4 °C.
8. Centrifuge the pooled supernatant at 300 x g. for 5 min to remove cells and debris and subsequently filter through a 0.45 µm low-protein-binding filter.
9. Concentrate the lentivirus with Millipore 100,000 NMWL centrifugal ultrafilters at 3,000 x g at 4 °C for 30 min if necessary.
   NOTE: A high lentiviral titer is critical for efficient transduction of primary hepatocytes. Concentrating the viral supernatant can help increase the viral titer.
10. Aliquot and store the lentivirus at -80 °C until use.
    Pause Point: Lentivirus aliquots can be stored at -80 °C for several months. Avoid repeated freeze-thaw cycles to maintain viral titer.
11. Lentivirus titration
    1. Plate HEK293T cells into 12 wells of a 24-well plate at a density of 1 x 10⁵ cells per well. Incubate the cells overnight at 37 °C in a cell incubator.
    2. When the cells reach 60%–80% confluence, add serial dilutions of the viral supernatant (e.g., 0, 1, 5, 25 µL of lentivirus, with 2 replicates per condition) together with 8 µg·mL^-1 of polybrene.
       NOTE: Count the cell number in 2 wells at the time of virus addition to calculate the titer.
    3. Incubate the plate at 37 °C for 12–16 h.
    4. Replace the medium with 500 µL of fresh culture medium and incubate at 37 °C for 48–72 h.
    5. Aspirate the medium and add 500 µL of culture medium with 3 µg·mL^-1 puromycin to all wells, except the 2 wells reserved for cell number counting to determine the fraction of surviving cells.
       NOTE: If the cells reach 100% confluency, passage and re-seed into a new plate.
    6. Incubate the plate at 37 °C for 24 h.
    7. Once the negative control well (without lentivirus but with puromycin selection) is completely dead, count the number of surviving cells in each lentivirus-treated well. Then, determine the functional viral titer (transducing units per mL, TU·mL^-1) using the following formula: titer (TU·mL^-1) = Number of surviving cells / Volume of virus used (mL)
       NOTE: For example, if 1 × 10⁵ cells survive in a well after infection with 10 µL (0.01 mL) of viral supernatant, the functional viral titer is calculated as: titer (TU·mL^-1) = (1 × 10⁵) /0.01 = 1 × 10⁷ TU·mL^-1. To achieve a MOI of 5 in one well of a 6-well plate (seeding 1 × 10⁶ hepatocytes per well), the required virus volume would be: Virus volume (mL) = MOI × Number of cells / titer = 5 x 1 x 10⁶ / 1 x 10⁷ ≈ 0.5 mL.

3. Isolation, culture and genome-editing of primary mouse hepatocytes in both monolayer and organoid formats

1. Prepare collagen type I–coated plates
   1. Add 0.115 mL of glacial acetic acid solution (100%) into 100 mL of ultrapure water and filter through a 0.22 µm filter to prepare 0.02 N acetic acid solution.
   2. Dilute Rat Collagen Type I with sterile 0.02 N acetic acid solution to a final concentration of 0.05 mg·mL^-1 collagen type I solution.
   3. Add 0.25 mL of collagen type I solution per well (24-well plate).
   4. Transfer the collagen type I–coated plates to a cell incubator (37 °C and 5% CO₂) and incubate for 1 h.
   5. Wash wells three times with DPBS to remove residual acetic acid. Store the collagen type I–coated plates at 4 °C before use.
2. Prepare reagents and buffer. The recipe details are provided in the supplementary materials.
   1. Prepare perfusion buffer as Table 1 indicates.
   2. Prepare digestion buffer as Table 2 indicates.
   3. Prepare digestion buffer-chilled (DB-chilled) as Table 3 indicates.
   4. Prepare plating medium as Table 4 indicates.
   5. Prepare hepatocyte culture medium according to the supplier's instructions.
   6. Prepare Hep-medium as Table 5 indicates.
      NOTE: Prewarm the perfusion buffer and digestion buffer to 42 °C and keep the 50 mL tube filled with 10 mL of DB-chilled on ice.
3. Tubing sterilization and calibration of pump flow rate
   1. Install the tubing onto the pump head according to the manufacturer's instructions and connect a needle to the distal end of the tubing.
   2. Soak the tubing in 70% ethanol for 5 min.
   3. Rinse thoroughly with sterile deionized water or PBS to remove ethanol residues.
   4. Place the outlet end of the tubing into a sterile 50 mL tube filled with sterile deionized water or PBS.
   5. Run the pump at the desired speed (e.g., at 3 mL·min^-1) for a fixed period (e.g., 1 min).
   6. Record the actual volume (V) collected and the run time (t).
   7. Calculate the actual flow rate (F) using the formula: F (mL·min^-1) = V (mL) / t (min).
   8. Compare the measured flow rate with the theoretical setting.
   9. If the deviation exceeds ± 5%, adjust the pump speed accordingly and repeat calibration until the error is within the acceptable range.
4. Mouse anesthesia and surgery
   1. Dissolve the entire lyophilized active component (tiletamine-zolazepam anesthetic mixture) in the provided diluent to achieve a final concentration of 50 mg·mL^-1 tiletamine hydrochloride and 50 mg·mL^-1 zolazepam hydrochloride.
   2. Calculate the injection volume of anesthesia mixture for each mouse based on body weight.
   3. Administer the calculated volume of anesthesia mixture via intraperitoneal injection.
   4. Place the anesthetized mouse near the edge of a sterile dissection tray.
   5. Saturate the mouse fur and the surgical area with 70% ethanol.
   6. Incise the abdominal skin to expose the abdominal cavity.
   7. Gently retract the intestines towards the right side of the body using blunt forceps.
5. Hepatocytes isolation and purification
   1. Slow down the pump to the lowest flow rate or turn off the pump.
   2. Insert the needle into the vena cava.
   3. Cut the portal vein using surgical scissors.
   4. Clamp the portal vein with forceps for 3-5 s.
   5. Confirm successful perfusion by observing the following indicators.
      1. Gradually increase the perfusion flow.
      2. Cut the portal vein and confirm continuous outflow.
      3. Re-clamp the portal vein incision.
   6. Perform this clamp-release cycle for 3-4 times.
   7. Replace the perfusion buffer with digestion buffer.
   8. Turn on the pump and clamp the portal vein.
   9. Remove the needle before air enters.
   10. Confirm proper digestion by the following observations.
       1. Gently press the liver tissue with forceps.
       2. Verify that the tissue becomes soft and pliable.
       3. Release hepatocytes from the tissue.
          NOTE: Keep the liver away from fur and blood to avoid contamination. Remove the gall bladder.
   11. Place the whole liver into the tube labeled "DB-chilled".
   12. Transfer the liver with digestion buffer to a 10-cm dish.
       NOTE: Carry out the following steps in the biological hood.
   13.  Puncture the liver at several positions with forceps and gently release hepatocytes with a cell lifter.
   14.  Rinse a 70 µm strainer with 1 mL of plating medium and then filter 10 mL of cell suspension through the strainer.
       NOTE: Pre-rinsing the strainer helps reduce surface tension, facilitating the filter of hepatocytes with minimal mechanical force applied.
   15.  Add 10 mL of plating medium to rinse plate and filter the suspension through the 70 µm strainer.
   16.  Centrifuge using a refrigerated centrifuge with swinging-bucket rotor at 50 x g for 2 min at 4 °C.
       NOTE: Centrifuge with low acceleration and low braking to minimize the loss of cell viability.
   17. Decision criteria / troubleshooting:
       1. The expected pellet morphology is a dense, compact, brownish pellet at the bottom of the tube, indicating successful hepatocyte collection.
   18.  Aspirate most of the supernatant and resuspend the cells in approximately 1 mL of the remaining medium.
   19.  Add 10 mL of plating medium to resuspend the cells.
   20.  Add 10 mL of freshly prepared Percoll solution (prepared by diluting 1 mL of 10 × PBS with 9 mL of Percoll) to the cell suspension and mix gently by inverting the tube.
   21.  Centrifuge using a refrigerated centrifuge with swinging-bucket rotor at 200 x g for 10 min at 4 °C.
   22.  Abort and repeat the isolation if any of the following occur (Decision Criteria / Troubleshooting)
       1. No visible hepatocyte pellet forms after the first low-speed or Percoll centrifugation, e.g., the cells remain dispersed in the supernatant.
       2. During mechanical dissociation, hepatocytes are difficult to release from the digested liver tissue, indicating insufficient digestion.
       3. If any of the above issues occur during hepatocyte isolation, do not hesitate to repeat the isolation, as hepatocytes obtained under these conditions are usually have inadequate hepatocyte yield and viability.
   23.  Add 20 mL of plating medium to resuspend the cells.
   24.  Centrifuge using a refrigerated centrifuge with swinging-bucket rotor at 50 x g for 2 min at 4 °C.
   25.  Aspirate most of the supernatant and resuspend the cells in approximately 1 mL of the remaining medium.
   26. Add 10 mL of plating medium to resuspend the cells.
   27. Dilute 10 μL of cell suspension with 10 μL of trypan blue and perform cell counting using an automated cell counter.
       NOTE: Keep the cell suspension on ice until counting to maintain viability.
   28. Decision criteria / troubleshooting:
       1. Recommended minimum cell number: ≥ 2 x 10⁶ hepatocytes per liver.
       2. If below threshold: Hepatocyte viability and transduction efficiency are usually compromised. Revisit the perfusion and collagenase digestion troubleshooting steps to improve yield before proceeding to sgRNA/lentivirus transduction.
6. Plating and gene-editing of monolayer-cultured primary mouse hepatocytes
   1. Hepatocytes plating for monolayer culture
      1. Dilute the cell suspension to a density of 3.8–6 × 10⁵ cells·mL^-1 by adding appropriate volume of plating medium, and mix gently by inverting the tube.
      2. Add 500 µL of the cell suspension to each well of the collagen type I–coated 24 well plates.
         NOTE: The recommended seeding density for mouse primary mouse is 1–1.5 × 10⁵ cells/cm². When adjusting the seeding volume of the cell suspension or the lentivirus volume for different plate formats, the required volumes can be scaled according to the plate surface area. The surface area of one well of 24-, 12-, and 6-well plates is 1.9, 3.6, and 9.5 cm², respectively.
      3. Transfer the plate to a cell incubator and gently move the plate in a back-and-forth and side-to-side manner to distribute the cells evenly.
      4. Incubate the cells for at least 3 h to allow attachment to the bottom of the wells.
         NOTE: Based on Percoll gradient centrifugation, this protocol yields relatively pure primary hepatocytes. Twelve hours after plating, hepatocytes can be readily identified under the microscope by their characteristic polygonal morphology, abundant cytoplasm, and the presence of a substantial fraction of binucleated cells (see Figure 2A).
   2. Lentivirus transduction of monolayer-cultured hepatocytes
      1. Aspirate the plating medium and gently rinse each well with DPBS to remove non-adherent cells.
         NOTE: Lentiviral transduction is optimally performed when hepatocytes are freshly plated. However, hepatocytes plated within 24 h are also acceptable.
      2. Add 500 µL of HCM with 8 µg·mL⁻¹ of polybrene to each well.
      3. Add appropriate volume of lentivirus into wells.
         NOTE: A lentiviral MOI of approximately 30 is suitable for efficient delivery of CRISPR/Cas9 components into primary mouse hepatocytes.
      4. Incubate the plate at 37 °C for 12–16 h.
      5. Aspirate the medium containing lentivirus and gently rinse each well with DPBS to remove dead cells. Replace with fresh HCM and subsequently change the medium every 2 days.
      6. Observe the expression of EGFP everyday post-transduction.
   3. Quantification of gene-editing efficiency
      NOTE: In this protocol, sample collection is recommended within 7 days after lentivirus transduction, as editing is largely completed while cell viability generally remains acceptable (>50%).
      1. Aspirate the HCM and rinse each well gently with DPBS to remove dead cells.
      2. Add 500 µL of pre-warmed accutase to each well and incubate at 37 °C for 3–5 min to dissociate the cells into a single-cell suspension.
      3. Perform fluorescence activating cell sort (FACS) to enrich EGFP positive cells or directly proceed to genomic DNA isolation.
         NOTE: Set the gating strategy based on the negative control cells (un-transfected) to define the EGFP-positive population. Enrichment of EGFP-positive hepatocytes by FACS can improve the gene-editing efficiency by removing un-transduced cells.
      4. Collect the dissociated cells into a 1.5 mL centrifuge tube.
      5. Add 15 µL of commercial lysis buffer into tube and incubate at 95 °C for 10 min.
      6. Add 15 µL of commercial stabilizing buffer to the tube and mix thoroughly by pipetting up and down with a 200-µL pipette to complete preparation of the DNA solution.
         NOTE: For small number of cells, direct lysis is recommended for genomic DNA preparation. Because the lysate is used directly as PCR template, DNA purification and quantification are not required.
         Pause Point: Prepared DNA solution can be stored at 4 °C for up to 24 h if immediate downstream analysis is not possible. For longer storage, keep at -20 °C.
      7. Design and order the gene specific primers for amplification of the sgRNA target region.
         mApob_NGS-F: ACACTCTT
         TCCCTACACGACGCTCTTC
         CGATCTtccgcctccgaagaccctgt
         mApob_NGS-R: GACTGGAG
         TTCAGACGTGTGCTCTTCC
         GATCTctggtgtccaagaacagtag
         NOTE: Design PCR primers flanking the sgRNA target site; primers located approximately 100 bp away from the sgRNA sequence are recommended.
      8. Prepare the 1st PCR reaction mixture as follows: 3 µL of DNA solution, 1.5 µL of 10 µM mApob_NGS_F, 1.5 µL of 10 µM mApob_NGS_R, 25 µL of 2× KAPA HiFi Master Mix and 19 µL of NFW.
      9. Perform the 1st PCR in a PCR thermal cycler using the following program: initial denaturation at 95 °C for 3 min, following 30 cycles of denaturation at 98 °C for 20 s, annealing at 55 °C for 15 s, extension at 72 °C for 15 s, with a final extension at 72 °C for 1 min.
      10. Run 3 µL of the 1st PCR product on an agarose gel to confirm amplification. The expected fragment size is 227 bp.
          NOTE: A successful PCR reaction should produce a single, clear band at the expected size under the recommended conditions, typically detectable within 30 cycles (Figure S2A). If no band is observed after ≥ 35 cycles, lyse the cells again and re-prepare the genomic DNA before repeating the PCR.
      11. Purify the 1st PCR product using a PCR purification kit or beads purification according to the manufacturer's instructions.
      12. Elute the 1st PCR product in 20–30 µL of NFW and quantification the concentration of it using nanodrop or Qubit 3.0.
          NOTE: The 1st PCR product can be used to quantify the gene-editing efficiency via sanger sequencing and the Inference of CRISPR Edits (ICE) algorithm²³.
      13. Order the indexed primers for next generation sequencing (NGS) on the Illumina platform.
          NEBNext_i501: AATGATACG
          GCGACCACCGAGATCTACAC
          TATAGCCTACACTCTTTCCCT
          ACACGACGCTCTTCCGATCT
          NEBNext_i701: CAAGCAGAA
          GACGGCATACGAGATCGTGA
          TGTGACTGGAGTTCAGACGT
          GTGCTCTTCCGATCT
      14. Prepare the 2nd PCR reaction mixture as following: 5 ng of 1st PCR product, 1.5 µL of 10 µM NEBNext_i501, 1.5 µL of 10 µM NEBNext_i701, 25 µL of 2× KAPA HiFi Mater Mix and appropriate volume of NFW to a final volume of 50 µL.
      15. Perform the 2nd PCR in a thermal cycler using the following program: initial denaturation at 95 °C for 3 min, following 8 cycles of denaturation at 98 °C for 20 s, annealing at 65 °C for 15 s, extension at 72 °C for 15 s, with a final extension at 72 °C for 1 min.
      16. Run 3 µL of the 2nd PCR product on a 1% agarose gel to confirm amplification. The expected fragment size is 284 bp.
      17. Purify the 2nd PCR product using a PCR purification kit or beads purification according to the manufacturer's instructions.
      18. Elute the 2nd PCR product in 20–30 µL of NFW and quantification the concentration of it using nanodrop or Qubit 3.0.
      19. Perform sequencing on an Illumina sequencing platform.
          NOTE: Use a library with a minimum concentration of 3 ng·µL⁻¹ and a total volume of at least 15 µL for sequencing submission.
      20. Analyze the NGS data using the CRISPR editing analysis algorithm to quantify gene-editing efficiency²⁴.
      21. For data analysis, the sgRNA sequence used was “ACCCCACCATCCATCCGCCA”, and the reference PCR amplicon sequence was “ATCAGTGCCTGCAGTGGATCAAG
          TACCTGCCTGAGCTCCGCCTCCG
          AAGACCCTGTAGAGCAAGCAGCA
          GGGGCTAGGCCCGTGGCCAGGCCA
          CAGCCAGGAAGCCACCCCACCATC
          CATCCGCCATGGGCCCACGAAAGC
          CTGCCCTGCGGACGCCGTTACTGCT
          GCTGTTCCTGCTACTGTTCTTGGACA
          CCAGCGTCTGGGCTCGTGAGTTAGG
          GTGGAAGCCTGGGAG”. All other analysis parameters were set to default.
          NOTE: In this study, quantification was performed using NGS-based methods, which provide higher accuracy despite longer processing time.
7. Culture and gene-editing of mouse hepatocyte organoids
   1. Hepatocytes organoid initiation
      1. Count 20,000 hepatocytes from step 3.5.25 and transfer them into a 1.5 mL centrifuge tube.
      2. Centrifuge at 50 x g for 2 min at 4 °C.
      3. Remove the supernatant.
      4. Gently resuspend hepatocytes in 30 µL of basement membrane matrix with an appropriate volume of lentivirus and mix thoroughly using a precooled pipette.
      5. Seed 30 µL of the cell-Matrigel-lentivirus mixture as a single dome into each well of a 24-well plate.
         NOTE: An MOI of 5–10 is used to balance transduction efficiency and organoid viability. Handle the basement membrane matrix on ice to prevent solidification, and prewarm the culture plates at 37 °C.
      6. Transfer the plate to a cell incubator and incubate for at least 15 min to allow the basement membrane matrix to solidify, then add 500 µL of Hep-medium.
      7. Change the Hep-medium every 3 days.
      8. Observe the expression of EGFP and growth state of organoids.
      9. At 7–14 days post-transduction, once organoid growth and EGFP expression are confirmed, harvest cells for quantification of gene-editing efficiency as described in step 3.6.3.

Results

Figure 1 presents a schematic overview of the experimental workflow for lentivirus-mediated CRISPR/Cas9 gene editing in primary hepatocytes cultured in monolayer and HEO formats.

To evaluate whether the HCM supports monolayer-cultured hepatocytes for gene-editing applications in vitro, we monitored cell morphology, the expression of the hepatic metabolic marker Cytochrome P450 3A4 (CYP3A4) and cell viability over time (Figure 2

Discussion

This protocol provides an efficient, cost-effective, and reproducible workflow for CRISPR/Cas9-mediated genome editing in both monolayer-cultured mouse hepatocytes and HEOs, achieving high genome-editing efficiency (~80%) in monolayer cultures and moderate efficiency (~12%) in HEOs. Unlike monolayer cultures, where EGFP-positive cells were enriched by FACS for downstream analysis, organoids were analyzed as bulk populations, and the coexistence of edited and non-edited cells during organoid expansion may further lower th...

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
KAPA HiFi hotstart Master Mix	roche	kk2631
1M HEPES	Dalian Meilun Biotechnology	MA0036
A83-01	Selleck Chemicals	S7692
accutase	STEMCELL Technologies	07920
Advanced DMEM/F12	Thermo Fisher Scientific	2842961
Agarose	Thermo Fisher Scientific	75510019
B27 minus vitamin A	Thermo Fisher Scientific	12587010
BsmBI-v2	New England Biolabs	R0739S
CellTiter-Meiluncell Luminescent Cell Viability Assay reagent	Dalian Meilun Biotechnology	PWL111
CHIR-99021	Sigma-Aldrich	SML1046
collagen type I solution from rat	Sigma-Aldrich	C3867-1VL
DMEM	Thermo Fisher Scientific	6125120
DMEM	Thermo Fisher Scientific	11885084	low glucose
DPBS	Thermo Fisher Scientific	6125527
EDTA	Dalian Meilun Biotechnology	MB5737
Ethanol	China National Pharmaceutical Group Corporation	10009218
Fetal bovine serum	Dalian Meilun Biotechnology	F0226F
Gibson Assembly Master Mix	ABclonal Biotechnology	RM20523
Glacial acetic acid solution	China National Pharmaceutical Group Corporation	10000208
GlutaMAX	Thermo Fisher Scientific	2277245
HBSS	Thermo Fisher Scientific	14175095	no calcium, magnesium, phenol red
HBSS	Dalian Meilun Biotechnology	MA0034	with calcium, magnesium, phenol red
Hepatocyte Culture Medium (HCM)	Lonza	CC3198
Human [Leu15]-gastrin I	Tocris Bioscience	10047-33-3
Liberase	Sigma-Aldrich	5401119001
MagMAX Pure Bind Beads	Thermo Fisher Scientific	A58523
Matrigel	Corning	354230
N-acetyl-L-cysteine	Sigma-Aldrich	A9165
Nicotinamide	Sigma-Aldrich	N0636
Opti-MEM	Thermo Fisher Scientific	41116155	serum-free transfection medium
PCR purification kit	zymo research	D4014
Penicillin-streptomycin	Dalian Meilun Biotechnology	MA0110
Percoll	cytiva	10313229
Plasmid DNA purification kit	Nanjing Vazyme Biotech	DC201-01
pMD2.G	Addgene	12259	VSV-G envelope expressing plasmid
Polybrene	Sigma-Aldrich	TR-1003-G
Polyethyleneimine	Yeasen Biotech	40816ES01
psPAX2	Addgene	12260	lentiviral packaging plasmid
Puromycin	Yeasen Biotech	60209ES10
Recombinant Human EGF	PeproTech	AF-100-15
Recombinant Human FGF-10	Peprotech	100-26-100
Recombinant Human FGF-7	Peprotech	96-100-19-50
Recombinant Human HGF	PeproTech	96-100-39-50
RoomTemp Sample Lysis Kit	Nanjing Vazyme Biotech	P073-01
Trypan blue	Dalian Meilun Biotechnology	MA0130
Y-27632	STEMCELL Technologies	72304
Zoletil 50	virbac Corporate	/	tiletamine–zolazepam anesthetic mixture
Consumables
0.22 μm filter	Merck Millipore	SLGPR33RB
0.45 μm low-protein-binding filter	Merck Millipore	SLHPR33RB
1.5 mL centrifuge	axygen	MCT-150-C
10 cm Culture Dish	NEST Biotechnology	704001
100,000 NMWL centrifugal ultrafilters	Merck Millipore	UFC9100096
24 well plate	NEST Biotechnology	702001
50 mL centrifuge tube	NEST Biotechnology	602052
70 µm cell strainer	Corning Incorporated	431751
Cel lifter	Corning Incorporated	CLS3008
Equipment
Automated cell counter Countess3	Thermo Fisher Scientific	A50302
Benchtop refrigerated centrifuge	Thermo Fisher Scientific	ST1R plus
Biological safety cabinet	SuzhouAntaiAirtech	BSC-1304IIA2
CO2 incubator	Thermo Fisher Scientific	I160
Fluorescence activating cell sort (FACS)	BD bioscience	BD influx
Horizontal electrophoresis system	biorad
Inverted fluorescence microscope	olympus	IX71
Multi-channel peristaltic pump	longer	LEAD15-88
Nanodrop	Hangzhou Allsheng instruments	nano-300
PCR Thermal cycler	biorad	S1000 Cycler
Qubit 3.0	Thermo Fisher Scientific	Q33216
Ultra-low temperature (−80 °C) freezer	Thermo Fisher Scientific	8950086V
Software
CRISPResso2	/	https://crispresso2.pinellolab.org/submission	Analysis of genome editing outcomes from deep sequencing data
Inference of CRISPR Edits (ICE) algorithm	/	https://ice.editco.bio/#/	CRISPR editing analysis algorithm for inference of indels