Effects of Regulating SPRY2 and miR-590-5p Expression on Autophagy in Human Osteoarthritis Model Chondrocytes

Summary

Inflammatory stress in an IL-1β-induced C28/I2 chondrocyte model increased miR-590-5p and reduced SPRY2 expression. Modulating this axis altered the expression of Beclin-1, LC3-II, and Bcl-2, suggesting a putative miR-590-5p/SPRY2 regulatory pathway that may influence autophagy-associated responses and chondrocyte survival in osteoarthritis.

Abstract

Osteoarthritis (OA) is a prevalent degenerative joint disease characterized by progressive cartilage destruction and loss of chondrocyte homeostasis. Although dysregulated autophagy contributes to OA pathogenesis, the molecular mechanisms governing autophagy-associated responses in chondrocytes remain incompletely understood. This study investigated the role of the miR-590-5p/SPRY2 regulatory axis in an inflammatory OA microenvironment using IL-1β-induced C28/I2 human chondrocytes. An in vitro OA model was established by treating C28/I2 cells with IL-1β. The expression of miR-590-5p and SPRY2 was evaluated using quantitative PCR and Western blotting. Gain- and loss-of-function approaches were employed to assess the effects of SPRY2 and miR-590-5p on the autophagy-associated markers Beclin-1 and LC3-II, as well as the survival-related protein Bcl-2. Bioinformatic analysis and rescue experiments were used to investigate the regulatory relationship between miR-590-5p and SPRY2. IL-1β treatment significantly increased miR-590-5p expression while reducing SPRY2 mRNA and protein levels (P < 0.05). SPRY2 overexpression markedly decreased Beclin-1 and LC3-II expression, with reductions of approximately 65% and 77%, respectively (P < 0.05). In contrast, miR-590-5p overexpression increased Beclin-1, LC3-II, and Bcl-2 expression, whereas inhibition of miR-590-5p reversed these effects and restored SPRY2 expression. Functional analyses supported SPRY2 as a putative downstream regulatory target of miR-590-5p. These findings identify the miR-590-5p/SPRY2 axis as an important regulator of autophagy-associated marker expression and chondrocyte survival under inflammatory conditions and suggest its potential relevance as a therapeutic target in OA.

Introduction

As the most prevalent form of arthritis worldwide, osteoarthritis (OA) is a leading cause of pain, mobility impairment, and physical disability, imposing a substantial burden on healthcare systems and society¹. Pathologically, OA is characterized by progressive degeneration of articular cartilage, synovial inflammation, and pathological remodeling of subchondral bone¹. Epidemiological estimates indicate that approximately 303 million individuals worldwide are affected by OA, and this number is expected to increase with population aging and rising obesity rates². In China, the prevalence of symptomatic knee OA is estimated to be 8.1%, with a disproportionately higher prevalence among women and rural populations³. Despite its high prevalence, current treatment options remain largely limited to symptom management through nonsteroidal anti-inflammatory drugs (NSAIDs) and surgical intervention for advanced disease⁴. The absence of disease-modifying osteoarthritis drugs (DMOADs) reflects an incomplete understanding of the molecular mechanisms regulating chondrocyte homeostasis and survival⁵.

The structural and functional integrity of articular cartilage depends on resident chondrocytes, which maintain extracellular matrix (ECM) turnover through a balance between anabolic and catabolic activities⁶. During OA progression, chondrocytes are exposed to abnormal mechanical stress and pro-inflammatory mediators, particularly interleukin-1β (IL-1β) and tumor necrosis factor-α (TNF-α), which promote a shift from matrix synthesis toward matrix degradation⁶. IL-1β contributes to cartilage destruction by stimulating the production of matrix metalloproteinases (MMPs) and aggrecanases while suppressing the synthesis of type II collagen and proteoglycans⁷. In addition, IL-1β induces oxidative stress and mitochondrial dysfunction, leading to chondrocyte apoptosis and senescence⁸. Consequently, identifying intracellular signaling pathways that regulate chondrocyte survival under inflammatory conditions remains a priority for OA research.

Autophagy is an evolutionarily conserved lysosomal degradation pathway that maintains cellular homeostasis through the removal and recycling of damaged organelles and protein aggregates⁹. Basal autophagy is essential for cellular survival and energy balance; however, dysregulated autophagy can contribute to disease progression⁹. In OA, autophagy is generally regarded as a protective response that helps chondrocytes adapt to cellular stress and resist apoptosis¹⁰. Previous studies have suggested that autophagic activity declines during OA progression, particularly in advanced-stage disease, resulting in impaired cellular quality control and increased chondrocyte loss¹¹. Several proteins are commonly used as indicators of autophagy-associated activity. Beclin-1 participates in autophagosome initiation, whereas conversion of microtubule-associated protein 1 light chain 3 (LC3-I to LC3-II) is widely used as a marker of autophagosome formation¹². In contrast, B-cell lymphoma 2 (Bcl-2) inhibits Beclin-1-dependent autophagy while also exerting anti-apoptotic effects¹³. Nevertheless, interpretation of autophagy-associated markers requires caution because static measurements of LC3-II and Beclin-1 cannot independently distinguish enhanced autophagosome formation from impaired lysosomal degradation. Despite these limitations, modulation of autophagy-related pathways remains a promising therapeutic strategy for OA.

MicroRNAs (miRNAs) are short non-coding RNAs that regulate gene expression post-transcriptionally by binding to complementary sequences within the 3′-untranslated regions (3′-UTRs) of target messenger RNAs, resulting in mRNA degradation or translational repression¹⁴. Aberrant miRNA expression has been implicated in OA pathogenesis through effects on inflammation, apoptosis, and ECM remodeling¹⁵. Among these molecules, miR-590-5p has attracted attention because of its regulatory roles in bone metabolism and other pathological processes. Previous studies have shown that miR-590-5p promotes osteogenic differentiation and suppresses adipogenesis in mesenchymal stem cells¹⁶. In cancer models, miR-590-5p exhibits context-dependent functions as either an oncogenic or tumor-suppressive regulator¹⁷. Furthermore, altered microRNA expression profiles, including members of the miR-590 family, have been implicated in the pathological remodeling of joint tissues during OA¹⁸. However, evidence obtained from stem cell or cancer models cannot be directly extrapolated to mature articular chondrocytes. Therefore, the role of miR-590-5p in regulating chondrocyte responses within the inflammatory OA microenvironment remains incompletely understood.

To investigate potential downstream mechanisms of miR-590-5p in OA, in silico target prediction analyses were performed, identifying Sprouty2 (SPRY2) as a putative downstream target. SPRY2 belongs to the Sprouty family of proteins, which negatively regulate receptor tyrosine kinase signaling and suppress activation of the RAS/MAPK/ERK pathway¹⁹. Because MAPK signaling influences chondrocyte differentiation, inflammatory responses, and autophagy, SPRY2 may represent an important regulatory node in OA pathophysiology²⁰. Previous studies indicate that SPRY2 can suppress inflammatory responses in rheumatoid arthritis models²¹, participate in apoptosis-related regulation in epithelial systems²², and is associated with autophagy-related responses in ischemic injury models²³. Although these observations suggest that SPRY2 participates in the regulation of both apoptosis and autophagy, its role in articular chondrocytes remains poorly characterized. It was therefore hypothesized that miR-590-5p and SPRY2 form a regulatory axis that influences chondrocyte survival under inflammatory stress.

Based on these observations, it was proposed that miR-590-5p modulates autophagy-associated responses in chondrocytes by regulating SPRY2 expression. Although miR-590-5p and SPRY2 have each been studied individually in other biological contexts, their functional relationship in OA chondrocytes has not been established. In the present study, an IL-1β-induced OA model in C28/I2 human chondrocytes was used to examine the expression patterns of miR-590-5p and SPRY2 and to evaluate their effects on the expression of Beclin-1, LC3-II, and Bcl-2. By investigating the miR-590-5p/SPRY2 regulatory axis, this study provides insight into epigenetic mechanisms underlying chondrocyte survival and identifies a potential therapeutic target for OA.

Protocol

This study was conducted exclusively using the commercially available human chondrocyte cell line C28/I2. No human participants, human tissue samples, patient-derived materials, or live animals were involved in this research. Therefore, Institutional Review Board (IRB) approval and Institutional Animal Care and Use Committee (IACUC) approval were not required in accordance with institutional and national guidelines. The tools, chemicals, kits, and reagents used in the protocol are listed in the Table of Materials.

1. Cell culture and OA model construction 

The human chondrocyte cell line C28/I2 (details provided in the Table of Materials) was obtained from a commercial supplier. To ensure experimental reproducibility, cells were authenticated using short tandem repeat (STR) profiling and routinely tested to confirm the absence of mycoplasma contamination. Cells between passages 3 and 8 were used for all experiments. Cells were maintained in DMEM supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin (all culture reagents are detailed in the Table of Materials) at 37 °C in a humidified atmosphere containing 5% CO₂.

To establish the in vitro osteoarthritis (OA) model, C28/I2 cells were stimulated with recombinant human IL-1β. Based on established literature^6,7, preliminary dose-response optimization experiments designed to induce a robust catabolic state without excessive immediate cytotoxicity, the cells were treated with 20 ng/mL IL-1β for 24 h.

2. Experimental grouping and transfection 

To elucidate the mechanistic pathways, the study was divided into three main experimental modules, each with a minimum of three independent biological replicates:

1. SPRY2 Gain/Loss-of-function:
   Cells were assigned to Control, OA model, OA + empty vector (NC), OA + SPRY2 overexpression plasmid (OE-SPRY2), and corresponding small interfering RNA groups (si-NC and three specific si-SPRY2 constructs: si-695, si-800, si-896) to screen for interference efficiency.
2. miR-590-5p modulation:
   Cells were divided into Control, OA model, OA + mimic NC, OA + miR-590-5p mimic, OA + inhibitor NC, and OA + miR-590-5p inhibitor groups.
3. Functional validation of the miR-590-5p/SPRY2 regulatory relationship:
   To further evaluate the proposed regulatory relationship between miR-590-5p and SPRY2, cells were subjected to miR-590-5p mimic and inhibitor conditions to determine whether miR-590-5p modulation altered SPRY2 expression in the OA model.
   For transfection, C28/I2 cells were seeded into 6-well plates at 2 × 10⁵ cells/well. Upon reaching 70%–80% confluence, transfections were performed using a commercial lipid-based transfection reagent according to the manufacturer's protocol and established procedures for small RNA delivery in chondrocytes²⁴. Briefly, plasmids (OE-SPRY2 and NC; 2 µg/well) and oligonucleotides (miR-590-5p mimic/inhibitor and siRNAs; 50 nM) were diluted in reduced-serum medium. The lipid-DNA/RNA complexes were incubated at room temperature for 15 min before being added dropwise to cells in serum-free DMEM. At 6 h after transfection, the medium was replaced with complete DMEM containing 10% FBS, and cells were cultured for an additional 48 h before RNA and protein extraction.

3. qPCR detection

Total RNA and miRNA were isolated using a dedicated miRNA extraction kit according to the manufacturer's protocol. RNA purity and concentration were assessed using a UV-Vis spectrophotometer, and samples with A260/A280 ratios of 1.8–2.0 were used for downstream analyses. Commercial reverse-transcription reagents were used to synthesize cDNA. The qPCR cycling procedure was as follows: 95 °C for 10 min; 40 cycles of 95 °C for 10 s, 58 °C for 30 s, and 72 °C for 30 s; followed by melting-curve analysis to verify primer specificity and the absence of primer dimers. β-actin and U6 served as internal controls for mRNA and miRNA, respectively. Relative gene expression was calculated using the 2-^ΔΔCt method²⁵. All primer sequences, including those for Col-II, SPRY2, Beclin-1, LC3, Bcl-2, miR-590-5p, and reference genes, are listed in Table 1.

Primer name	Forward primer (5′-3′)	Reverse primer (5′-3′)
U6	ATTGGAACGATACAGAGAAGATT	GGAACGCTTCACGAATTTG
miR-590-5p	GCGTAAGGCACGCGGTG	AGTGCAGGGTCCGAGGTATT
β-actin	TGGCACCCAGCACAATGAA	CTAAGTCATAGTCCGCCTAGAAGCA
SPRY2	TAAGCCACTGAGCAAGGAAGAT	TGGAAGGTAACACCATAAACAAGG
Bcl-2	TGGGATTCCTGCGGATTGAC	TCAGTCTACTTCCTCTGTGATGTTG
Beclin-1	TCCCGTGGAATGGAATGAGA	GTAAGGAACAAGTCGGTATCTCTG
LC3-II	CATCCAACCAAAATCCCGGT	GAGCTGTAAGCGCCTTCTAA

Table 1: Primer sequences used for quantitative PCR (qPCR) analysis. Forward and reverse primer sequences used for the amplification and quantification of target transcripts and internal reference controls by qPCR.

Unless otherwise specified, data are expressed as mean ± standard deviation (SD). Statistical significance was determined using one-way ANOVA followed by the S-N-K post hoc test. Symbols indicate: *P < 0.05 vs. Control; #P < 0.05 vs. the indicated model or negative-control group; &P < 0.05 vs. OA+Inhibitor-NC.

4. Western blot detection

Cells were harvested and lysed using RIPA buffer supplemented with protease and phosphatase inhibitor cocktails, following established protein extraction and immunoblotting procedures. After centrifugation at 14,000 × g for 15 min at 4 °C to remove cellular debris, the supernatant was collected, and protein concentrations were quantified using a BCA protein assay kit. Equal amounts of protein lysate (30 µg) were denatured, resolved by SDS-PAGE for 1.5 h, and transferred onto PVDF membranes at 300 mA for 1.5 h²⁶. Membranes were blocked with 5% non-fat dry milk in Tris-buffered saline containing 0.1% Tween 20 (TBST) for 1 h at room temperature, followed by incubation at 4 °C for 16 h with specific primary antibodies (e.g., anti-SPRY2, 1:1000 dilution). After three washes in TBST, membranes were incubated with appropriate HRP-conjugated secondary antibodies at room temperature for 2 h. Protein bands were visualized using an ECL detection system and quantified using ImageJ software.

5. Statistical analysis

Data were analyzed using statistical analysis software. All experiments were performed with at least three independent biological replicates (n ≥ 3), and quantitative data are presented as the mean ± standard deviation (SD). Before parametric testing, data normality was assessed using the Shapiro-Wilk test, and homogeneity of variance was assessed. Statistical significance among multiple groups was evaluated using one-way analysis of variance (ANOVA) followed by the Student-Newman-Keuls (S-N-K) post hoc test for multiple comparisons. P < 0.05 was considered statistically significant.

Results

Establishment of the in vitro chondrocyte inflammatory model

To investigate the molecular mechanisms underlying osteoarthritis pathology, an in vitro inflammatory model was established using C28/I2 human chondrocytes stimulated with IL-1β. The validity of this model was confirmed by assessing the expression of collagen type II alpha 1 chain (Col-II), a primary component of the hyaline cartilage extracellular matrix and a hallmark of healthy chondrocytes. Quantitative analysis revealed that exposure to IL-1β led to a statistically significant reduction in Col-II mRNA expression relative to the control group. This phenotypic alteration indicates an initial shift toward a catabolic state resembling the osteoarthritic microenvironment, thereby providing a foundational model for subsequent mechanistic studies (Figure 1).

Figure 1: Establishment of the in vitro osteoarthritis (OA) model in C28/I2 human chondrocytes. Cells were treated with 20 ng/mL IL-1β for 24 h. The relative mRNA expression of Col-II was determined by qPCR, with β-actin serving as the normalization control. Data are presented as the mean ± standard deviation (SD) from three independent biological replicates (n = 3). Statistical analysis was performed using one-way ANOVA. *P < 0.05 compared to the Control group. Please click here to view a larger version of this figure.

Validation of SPRY2 overexpression efficiency in C28/I2 cells

Before assessing the functional role of Sprouty2 (SPRY2) in this model, the transfection efficiency of the SPRY2 overexpression vector was verified. Chondrocytes were transfected with either the overexpression plasmid (OE) or a negative control empty vector (NC). Both qPCR and Western blot analyses showed robust upregulation of SPRY2 at the mRNA and protein levels in the OE group compared with the NC and untreated control groups. These data, presented in Figure 2, confirm that the experimental system maintained elevated SPRY2 levels, enabling investigation of its specific biological effects.

Figure 2: Validation of SPRY2 overexpression in C28/I2 chondrocytes. Cells were transfected with either an empty vector (NC) or a SPRY2 overexpression plasmid (OE). The relative mRNA and protein levels of SPRY2 were evaluated via qPCR and Western blot, respectively. β-actin was utilized as an internal loading control. Data are expressed as the mean ± SD (n = 3). *P < 0.05 compared to the NC group. Please click here to view a larger version of this figure.

SPRY2 overexpression attenuates autophagy and modulates apoptosis markers under inflammatory conditions

Subsequent experiments sought to determine whether SPRY2 functions as a regulator of autophagy and apoptosis within the inflammatory context. Following the establishment of the OA model, IL-1β treatment alone induced a marked increase in the autophagy markers Beclin-1 and LC3-II, suggesting a compensatory autophagic response to inflammatory stress. Concurrently, Bcl-2 expression was elevated in the model group. However, the introduction of the SPRY2 overexpression vector significantly altered this profile. As depicted in Figure 3, the Model+OE-SPRY2 group exhibited a significant reduction in both Beclin-1 and LC3-II mRNA levels compared to the Model and Model+NC groups. Furthermore, SPRY2 overexpression attenuated the inflammation-induced elevation of Bcl-2. These findings suggest that SPRY2 negatively regulates the expression of autophagy-associated markers in inflammatory chondrocytes.

Figure 3: SPRY2 overexpression attenuates autophagy and modulates apoptosis markers under IL-1β-induced inflammatory conditions. The relative mRNA expression levels of SPRY2, Bcl-2, Beclin-1, and LC3-II were quantified by qPCR in Control, Model (IL-1β-treated), Model+NC, and Model+OE-SPRY2 groups. β-actin served as the internal control. Data are presented as the mean ± SD (n = 3). Statistical significance was determined by one-way ANOVA followed by the S-N-K post hoc test. *P < 0.05 compared to the Control group; #P < 0.05 compared to the Model+NC group. Please click here to view a larger version of this figure.

miR-590-5p upregulates autophagy-associated markers and promotes chondrocyte survival

Next, the functional impact of miR-590-5p on autophagy-associated and survival-related markers was investigated. As shown in Figure 4, transfection with a miR-590-5p mimic in the OA model significantly increased Bcl-2, Beclin-1, and LC3-II expression, contrasting with the inhibitory effects observed after SPRY2 overexpression. Conversely, inhibition of miR-590-5p markedly reduced Bcl-2 and Beclin-1 expression, whereas the reduction in LC3-II did not reach statistical significance. These results suggest that miR-590-5p increases expression of autophagy-associated markers and survival-related Bcl-2 in chondrocytes, warranting further investigation into its potential downstream regulatory targets.

Figure 4: miR-590-5p increases autophagy-associated marker expression and survival-related Bcl-2 expression. The relative mRNA expression levels of Bcl-2, Beclin-1, and LC3-II were measured by qPCR in the OA model following transfection with a miR-590-5p mimic, inhibitor, or their respective negative controls (NC). β-actin served as the normalization control. Data are shown as the mean ± SD (n = 3). *P < 0.05 compared to the Model+Mimic-NC group; #P < 0.05 compared to the Model+Inhibitor-NC group (for Bcl-2 and Beclin-1). Please click here to view a larger version of this figure.

IL-1β modulates the miR-590-5p/SPRY2 axis and autophagy-associated marker expression 

To elucidate the upstream regulatory mechanisms controlling SPRY2 and its relationship with miR-590-5p, their expression profiles were examined under inflammatory conditions. Following morphological observation of the IL-1β-induced C28/I2 cell model (Figure 5A), the transfection efficiencies for SPRY2 genetic manipulation were verified. Both qPCR and Western blot analyses confirmed robust SPRY2 upregulation in the overexpression (OE) group and successful knockdown across the small interfering RNA (siRNA) groups compared to their respective controls (Figures 5B and 5C). Conversely, miR-590-5p levels were significantly upregulated following IL-1β treatment.

Figure 5: Morphological observation and validation of SPRY2 transfection efficiencies. (A) Morphological observation of C28/I2 cells following IL-1β treatment (20×, phase contrast micrograph). (B) Relative mRNA and protein expression levels of SPRY2 in Control, NC, and SPRY2 overexpression (OE) groups. (C) Representative Western blot images confirming SPRY2 overexpression (left) and SPRY2 knockdown by specific siRNAs (si-896, si-800, si-695) compared to controls (right). β-actin served as the internal loading control. Data are expressed as the mean ± SD (n = 3). *P < 0.05 compared to the Control group. Please click here to view a larger version of this figure.

To determine whether this inverse expression pattern reflected a potential regulatory relationship, TargetScan Human 7.1 was used to identify an 8mer putative binding site for hsa-miR-590-5p within the 3′-UTR of human SPRY2 (nucleotides 236–243). The sequence alignment in Figure 6 illustrates the predicted seed-region complementarity. Rescue experiments were then performed to functionally examine whether miR-590-5p modulation altered SPRY2 expression in the OA model. After confirming the transfection efficiencies of the miR-590-5p mimic and inhibitor (Figures 7A, B), rescue assays showed that miR-590-5p inhibition reversed the OA-associated suppression of SPRY2 mRNA expression (Figure 7C). The miR-590-5p mimic did not further reduce SPRY2 expression beyond the marked suppression induced by IL-1β, whereas miR-590-5p inhibition significantly increased SPRY2 expression relative to the inhibitor negative control. These findings support an inverse, putative regulatory relationship between miR-590-5p and SPRY2 in inflammatory chondrocytes.

Figure 6: In silico prediction of the putative miR-590-5p/SPRY2 regulatory interaction. Bioinformatic analysis was performed using TargetScan Human 7.1^31,32 to identify putative miRNA binding sites. The schematic illustrates the predicted sequence alignment and seed-region complementarity between hsa-miR-590-5p and the 3′-UTR of human SPRY2 (nucleotides 236–243). Please click here to view a larger version of this figure.

Figure 7: Effects of miR-590-5p modulation on SPRY2 expression in chondrocytes. Transfection efficiencies were confirmed by qPCR for the miR-590-5p mimic (A) and inhibitor (B) relative to their respective controls. (C) Relative SPRY2 mRNA expression was measured across the indicated experimental groups following miR-590-5p modulation in the OA model. U6 and β-actin were used as internal controls for miRNA and mRNA quantification, respectively. Data are presented as mean ± SD (n = 3). *P < 0.05 compared to the Control group; #P < 0.05 compared to the respective Mimic-NC or Inhibitor-NC group; &P < 0.05 compared to the OA+Inhibitor-NC group. Please click here to view a larger version of this figure.

Consistent with the results in Figure 4, changes in autophagy-associated markers paralleled the effects expected from reduced SPRY2 expression, suggesting that miR-590-5p may enhance their expression by relieving SPRY2-mediated inhibition. Taken together, these findings support a putative signaling axis in which IL-1β upregulates miR-590-5p, miR-590-5p suppresses SPRY2 expression, and reduced SPRY2 is associated with increased Beclin-1 and LC3-II marker expression.

DATA AVAILABILITY:

The data for this study are provided in Supplementary File 1.

Supplementary File 1: The datasets used for this study, including qPCR source data, Western blot source images, and statistical analysis outputs.Please click here to download this file.

Discussion

Previous studies have shown that miRNAs regulate autophagy at multiple stages, including initiation, vesicle elongation, and maturation²⁷. miRNA involvement in OA pathogenesis has been increasingly documented, particularly through effects on inflammation, apoptosis, extracellular matrix remodeling, and autophagy-related pathways. miR-590-5p has been linked to cellular homeostasis and cancer-associated processes^28,29,30. In skeletal and cartilage-related contexts, miR-590-5p has been reported to promote chondrogenic differentiation of human mesenchymal stem cells 16, whereas in OA chondrocyte models, it can regulate proliferation, apoptosis, and inflammatory responses by targeting FGF^18,24. However, it remains unclear whether miR-590-5p affects autophagy-related responses in OA chondrocytes.

Therefore, RNAInter and TargetScan were used to explore potential downstream mediators, and both analyses suggested SPRY2 as a putative miR-590-5p-associated target. TargetScan Human 7.1^31,32 identified a predicted 8mer seed-region binding site at nucleotides 236–243 of the SPRY2 3′-UTR (Figure 6). SPRY2 is a negative regulator of receptor tyrosine kinase/MAPK signaling and is expressed in multiple tissues¹⁹. Intra-articular SPRY2 gene transfer has been reported to attenuate adjuvant-induced arthritis in rats²¹. SPRY2 overexpression can inhibit HGF/SF-mediated cell growth, invasion, migration, and cytokinesis³³, whereas loss of Spry2 function has been associated with MAPK-ERK hyperactivation and increased B-cell proliferation³⁴. SPRY2 has also been implicated in apoptosis-related regulation²², miRNA-associated migration control³⁵, and autophagy-related responses in ischemic models²³. Together, these studies support SPRY2 as a regulatory node linking inflammatory signaling, survival-related pathways, and autophagy-associated responses.

Given the previously unreported relationship between miR-590-5p and SPRY2 in OA chondrocytes, bioinformatic prediction of their potential interaction prompted further experimental investigation. The present results showed that SPRY2 was significantly downregulated whereas miR-590-5p was upregulated in IL-1β-stimulated C28/I2 chondrocytes, implicating this axis in inflammatory chondrocyte responses. Functionally, SPRY2 overexpression decreased Beclin-1 and LC3-II expression, supporting an inhibitory effect on autophagy-associated marker expression. Conversely, miR-590-5p inhibition reduced Beclin-1 and Bcl-2 expression and restored SPRY2 expression, consistent with a putative inverse regulatory relationship. Because Bcl-2 can inhibit Beclin-1-dependent autophagy while also exerting anti-apoptotic effects13, the concurrent elevation of Bcl-2 with Beclin-1 and LC3-II should be interpreted in a context-specific manner. In this inflammatory OA model, Bcl-2 upregulation may primarily reflect a survival-related anti-apoptotic response, whereas increased Beclin-1 and LC3-II expression may reflect relief of SPRY2-associated suppression. These findings suggest a model in which miR-590-5p coordinates chondrocyte survival-related signaling and the expression of autophagy markers by suppressing SPRY2 under inflammatory stress.

While this study provides valuable mechanistic insights into the miR-590-5p/SPRY2 axis, several limitations should be acknowledged. First, all experiments were conducted in a 2D in vitro system using the immortalized C28/I2 cell line. This simplified model cannot fully recapitulate the biomechanical stress, multicellular interactions, and inflammatory microenvironment of articular cartilage in vivo, limiting the immediate translational applicability of the findings. Second, although bioinformatic predictions and rescue assays support a putative regulatory relationship between miR-590-5p and SPRY2, the absence of a dual-luciferase reporter assay prevents definitive confirmation of direct physical binding between miR-590-5p and the SPRY2 3′-UTR. Third, static measurements of Beclin-1 and LC3-II cannot distinguish increased autophagosome formation from impaired autolysosomal degradation; therefore, future studies should assess autophagic flux using approaches such as Bafilomycin A1 treatment or tandem fluorescent reporter assays. Future work should also include a broader panel of OA phenotypic markers (e.g., MMP13 and ADAMTS5), primary human chondrocytes, 3D cartilage explant models, and in vivo OA models such as destabilization of the medial meniscus to evaluate the long-term effects of miR-590-5p and SPRY2 modulation.

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
Anti-β-actin antibody	Proteintech	66009-1-Ig ; RRID: AB_2687938	Internal loading control for Western blot analysis
Anti-SPRY2 antibody	Proteintech	11383-1-AP ; RRID: AB_2196324	Detection of SPRY2 protein expression
BCA protein assay kit	Thermo Fisher Scientific	23225	Determination of total protein concentration
C28/I2 human chondrocyte cell line	Punocel	CP-H107	In vitro chondrocyte model for osteoarthritis studies
Complete DMEM	KeyGen Biotec	KGM12800S	Basal medium for routine cell culture
CWBIO Ultrapure miRNA extraction kit	CWBIO	CW0627S	Isolation of total RNA and miRNA
ECL detection system	Thermo Fisher Scientific	32106	Chemiluminescent visualization of protein bands
Fetal Bovine Serum (FBS)	Gibco	1891605	Cell culture growth supplement
GraphPad Prism version 9.0	GraphPad Software	N/A	Statistical analysis and graph generation
HiScript II Q RT SuperMix	Vazyme	R223-01	Reverse transcription of mRNA into cDNA
ImageJ software	National Institutes of Health	N/A	Quantification of Western blot band intensity
Lipofectamine 3000	Invitrogen	L3000015	Transfection of plasmids and oligonucleotides
miR-590-5p mimic, inhibitor, and NCs	RiboBio	Custom synthesized	Modulation of miR-590-5p expression
miRNA 1st Strand cDNA Synthesis Kit	Vazyme	MR101-02	Reverse transcription of miRNA into cDNA
Opti-MEM medium	Gibco	31985-062	Preparation of transfection complexes
Penicillin-streptomycin	Gibco	15140122	Prevention of bacterial contamination in cell culture
Protease and phosphatase inhibitor cocktails	MedChemExpress	HY-K0010	Protection of proteins during extraction
PVDF membranes	Millipore Sigma	ISEQ00010	Protein transfer membrane for immunoblotting
Recombinant human IL-1β	MedChemExpress	HY-P78459	Induction of OA-like inflammatory conditions
RIPA buffer	Beyotime	P0013B	Cell lysis and protein extraction
si-SPRY2 constructs and si-NC	GenePharma	Custom synthesized	Knockdown of SPRY2 expression
SPRY2 overexpression plasmid (OE) and empty vector (NC)	GeneChem	Custom constructed	Evaluation of SPRY2 overexpression effects
UV-VIS spectrophotometer (NanoDrop 2000)	Thermo Fisher Scientific	ND-2000	Measurement of RNA concentration and purity