ai_agent_IP

ai_agent

maintenance

instantTrialDurationMinutes

isBiopharma

enableNewMyJoveSectionDesign

educationFeatures

seoMetaApi

ai_copilot_institution_blacklist

ai_chat_institution_blacklist

freeAccessWindow

ssoRoleCapture

scheduledMaintenanceBanner

joveLabsFeatures

disable_autoplay_for_bots

extended_trial_duration

5 minutes

We thank Abbhimanyu Garg, Anil Agarwal, and Jay Horton from UT Southwestern Medical Center for providing us the Agpat2-/- mice. Andrea del Campo and Gonzalo Almarza of Faculty of Chemistry and Pharmacy of the Pontificia Universidad Cat&#243;lica de Chile for giving us access to the Oxygraph. This work was supported by the Flow Cytometry Core UC and Advanced Microscopy Unit at Pontificia Universidad Cat&#243;lica de Chile. This work was supported by FONDECYT 1221146 and 1261504, FONDEQUIP 230130 and ACT 210039 all from ANID, Chile, granted to V.C. Figure 1A was created with BioRender.com.

<ol>
	<li>Chen W, Zhao H, Li Y. Mitochondrial dynamics in health and disease: mechanisms and potential targets. Signal Transduct Target Ther. 2023;8(1):333.</li>
	<li>Huang PI, et al. PGC-1&#945; mediates differentiation of mesenchymal stem cells to brown adipose cells. J Atheroscler Thromb. 2011;18(11):966-80.</li>
	<li>Murholm M, et al. Dynamic regulation of genes involved in mitochondrial DNA replication and transcription during mouse brown fat cell differentiation and recruitment. PLoS One. 2009;4(12):e8458.</li>
	<li>Uldry M, et al. Complementary action of the PGC-1 coactivators in mitochondrial biogenesis and brown fat differentiation. Cell Metab. 2006;3(5):333-41.</li>
	<li>Trayhurn P. Origins and early development of the concept that brown adipose tissue thermogenesis is linked to energy balance and obesity. Biochimie. 2017;134:62-70.</li>
	<li>Crewe C, et al. Extracellular vesicle-based interorgan transport of mitochondria from energetically stressed adipocytes. Cell Metab. 2021;33(9):1853-68.e11.</li>
	<li>Li M, et al. Engineered mitochondria in diseases: mechanisms, strategies, and applications. Signal Transduct Target Ther. 2025;10(1):71.</li>
	<li>Caicedo A, et al. MitoCeption as a new tool to assess the effects of mesenchymal stem/stromal cell mitochondria on cancer cell metabolism and function. Sci Rep. 2015;5:9073.</li>
	<li>Chen R, Chen J. Mitochondrial transfer: a novel promising approach for the treatment of metabolic diseases. Front Endocrinol (Lausanne). 2023;14:1346441.</li>
	<li>Zhu L, et al. Mitochondrial transfer: a novel mechanism in the development of obesity and obesity-related metabolic diseases. Obesity (Silver Spring). 2026. doi:10.1002/oby.70223.</li>
	<li>Ikeda G, et al. Mitochondrial transfer: from bench to bedside. Circ Res. 2026;138(8):e326984.</li>
	<li>Clemente-Su&#225;rez VJ, Mart&#237;n-Rodr&#237;guez A, Y&#225;&#241;ez-Sep&#250;lveda R, Tornero-Aguilera JF. Mitochondrial transfer as a novel therapeutic approach in disease diagnosis and treatment. Int J Mol Sci. 2023;24(10):8848.</li>
	<li>Zong Y, et al. Mitochondrial dysfunction: mechanisms and advances in therapy. Signal Transduct Target Ther. 2024;9(1):124.</li>
	<li>Shin EH, et al. Mitochondrial transplantation: triumphs, challenges, and impacts on nuclear genome remodelling. Mitochondrion. 2025;84:102042.</li>
	<li>Nzigou Mombo B, et al. MitoCeption: transferring isolated human MSC mitochondria to glioblastoma stem cells. J Vis Exp. 2017;(120):e55245.</li>
	<li>Cautivo KM, et al. AGPAT2 is essential for postnatal development and maintenance of white and brown adipose tissue. Mol Metab. 2016;5(7):491-505.</li>
	<li>Tapia PJ, et al. Absence of AGPAT2 impairs brown adipogenesis, increases IFN stimulated gene expression and alters mitochondrial morphology. Metabolism. 2020;111:154341.</li>
	<li>Cort&#233;s VA, et al. Molecular mechanisms of hepatic steatosis and insulin resistance in the AGPAT2-deficient mouse model of congenital generalized lipodystrophy. Cell Metab. 2009;9(2):165-76.</li>
	<li>Figueroa AM, Stolzenbach F, Tapia P, Cort&#233;s V. Differentiation and imaging of brown adipocytes from the stromal vascular fraction of interscapular adipose tissue from newborn mice. J Vis Exp. 2023;(192):e64604.</li>
	<li>Ngo J, et al. Isolation and functional analysis of peridroplet mitochondria from murine brown adipose tissue. STAR Protoc. 2021;2(1):100243.</li>
	<li>Reynolds ES. The use of lead citrate at high pH as an electron-opaque stain in electron microscopy. J Cell Biol. 1963;17(1):208-12.</li>
	<li>Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem. 1987;162(1):156-9.</li>
	<li>Balazova L, Palesova N, Balaz M. Mitochondrial transformation occurs in cultured adipocytes, but fails to increase adipose tissue metabolic activity in mice in vivo. Adipocyte. 2022;11(1):463-76.</li>
	<li>Yao X, et al. In-cytoplasm mitochondrial transplantation for mesenchymal stem cells engineering and tissue regeneration. Bioeng Transl Med. 2022;7(1):e10250.</li>
	<li>Robledo F, et al. Spheroids derived from the stromal vascular fraction of adipose tissue self-organize in complex adipose organoids and secrete leptin. Stem Cell Res Ther. 2023;14(1):70.</li>
	<li>Tajima H, et al. Evidence for in vivo production of Humanin peptide, a neuroprotective factor against Alzheimer&#8217;s disease-related insults. Neurosci Lett. 2002;324(3):227-31.</li>
	<li>Kim KH, Son JM, Benayoun BA, Lee C. The mitochondrial-encoded peptide MOTS-c translocates to the nucleus to regulate nuclear gene expression in response to metabolic stress. Cell Metab. 2018;28(3):516-24.e7.</li>
	<li>Li J, et al. A mitochondria-to-nucleus regulation mediated by the nuclear-translocated mitochondrial lncRNAs. PLoS Genet. 2025;21(1):e1011580.</li>
	<li>Sriram K, et al. Regulation of nuclear transcription by mitochondrial RNA in endothelial cells. Elife. 2024;13:e86204.</li>
	<li>Tormos KV, et al. Mitochondrial complex III ROS regulate adipocyte differentiation. Cell Metab. 2011;14(4):537-44.</li>
	<li>Ludwig-S&#322;omczy&#324;ska AH, Rehm M. Mitochondrial genome variations, mitochondrial-nuclear compatibility, and their association with metabolic diseases. Obesity (Silver Spring). 2022;30(6):1156-69.</li>
	<li>Nakai R, et al. Mitochondria transfer-based therapies reduce the morbidity and mortality of Leigh syndrome. Nat Metab. 2024;6(10):1886-96.</li>
	<li>Pinho SA, Anjo SI, Cunha-Oliveira T. Metabolic priming as a tool in redox and mitochondrial theragnostics. Antioxidants (Basel). 2023;12(5):1072.</li>
	<li>Kitani T, Kami D, Matoba S, Gojo S. Internalization of isolated functional mitochondria: involvement of macropinocytosis. J Cell Mol Med. 2014;18(8):1694-703.</li>
	<li>Cowan DB, et al. Transit and integration of extracellular mitochondria in human heart cells. Sci Rep. 2017;7(1):17450.</li>
	<li>Pacak CA, et al. Actin-dependent mitochondrial internalization in cardiomyocytes: evidence for rescue of mitochondrial function. Biol Open. 2015;4(5):622-6.</li>
	<li>Cabrera F, et al. Early evidence of the artificial transfer/transplant of mitochondria to oocytes and zygotes by MitoCeption. Mitochondrion. 2022;65:102-12.</li>
	<li>Masuzawa A, et al. Transplantation of autologously derived mitochondria protects the heart from ischemia-reperfusion injury. Am J Physiol Heart Circ Physiol. 2013;304(7):H966-82.</li>
	<li>Wilson-Fritch L, et al. Mitochondrial biogenesis and remodeling during adipogenesis and in response to the insulin sensitizer rosiglitazone. Mol Cell Biol. 2003;23(3):1085-94.</li>
	<li>Kim JS, Lee S, Kim WK, Han BS. Mitochondrial transplantation: an overview of a promising therapeutic approach. BMB Rep. 2023;56(9):488-95.</li>
	<li>Liao PC, et al. Isolation of mitochondria from cells and tissues. Methods Cell Biol. 2020;155:3-31.</li>
	<li>Al Amir Dache Z, Chev&#233; M, Dancourt J, Lavieu G. Quantitative cellular characterization of extracellular mitochondria uptake and delivery. Nat Commun. 2025;16(1):9053.</li>
	<li>Brestoff JR, et al. Intercellular mitochondria transfer to macrophages regulates white adipose tissue homeostasis and is impaired in obesity. Cell Metab. 2021;33(2):270-82.e8.</li>
	<li>Tiash S, Brestoff JR, Crewe C. A guide to studying mitochondria transfer. Nat Cell Biol. 2023;25(11):1551-3.</li>
	<li>Hole KL, et al. MitoTracker transfers from astrocytes to neurons independently of mitochondria. Cell Rep Methods. 2026;6(3):101338.</li>
	<li>Chen C, Li H, Zhang J, Cheng SC. Exploring the limitations of mitochondrial dye as a genuine horizontal mitochondrial transfer surrogate. Commun Biol. 2024;7(1):281.</li>
</ol>

The authors have no conflicts of interest to declare.

Biological implications of mitochondrial transfer in adipogenesis 
Our results show that although exogenous mitochondria from both human and murine sources can be incorporated into the endogenous mitochondrial network of differentiating preadipocytes, an artificial increase in mitochondrial mass is insufficient to drive the brown adipogenic program. These findings suggest that the mitochondrial expansion characteristic of brown adipogenesis is a consequence of cellular differe...

Beyond their primary bioenergetic roles, mitochondria serve as signaling hubs in multiple cellular processes, including cell differentiation1,2,3,4. Brown adipose tissue (BAT) possesses a notably high mitochondrial mass to support its thermogenic activity, highlighting its role in whole-body energy balance and in the pathogenesis of obesity5. While mitochondrial mass is regulated by the balance between biogenesis and mitophagy, it remains unclear whether mitochondrial mass expansion during brown adipocyte differentiation is functionally required for adipogenesis or merely a consequence of the process.
Physiological mitochondrial transfer between cells has been documented both in vitro and in vivo, where it contributes to tissue adaptation under pathological conditions, including adipose tissue dysfunction associated with obesity and insulin resistance6,7. Furthermore, artificial mitochondrial transfer in vitro has been shown to enhance the respiratory capacity of recipient cells8. Together, these findings support the concept that mitochondrial transfer can modify cellular metabolic function and may contribute to tissue adaptation under conditions of bioenergetic stress9,10,11. Compared with pharmacological or genetic strategies that stimulate endogenous mitochondrial biogenesis by activating nuclear and mitochondrial transcriptional programs, mitochondrial transfer directly delivers organelles to recipient cells, enabling rapid modification of mitochondrial mass independently of transcriptional manipulations12,13. This approach is critical for correcting defects in mitochondrial diseases but also allows to study mitochondrial actions without the potential off-target effects of pharmacological or genetic approaches14.
In the present study, we investigated the effect of artificially increasing the mitochondrial mass by exogenous mitochondrial transfer in differentiating brown adipocytes. This approach enabled direct assessment of the impact of mitochondrial mass on the adipogenic program. To achieve this, mitochondrial transfer protocols originally developed for mesenchymal stem cells were adapted15 using both human hepatic cells and murine preadipocytes as mitochondrial donors. A method for tracking human mitochondria in differentiating mouse cells was developed using genetic tools combined with imaging techniques, demonstrating that mitochondria from both origins are incorporated into the endogenous mitochondrial network and persist throughout adipogenic differentiation.
To model defective adipogenesis associated with low mitochondrial mass, differentiating brown adipocytes derived from 1-acylglycerol-3-phosphate-O-acyltransferase 2 (AGPAT2)-deficient (Agpat2-/-) mice were used. AGPAT2 is highly expressed in adipose tissue, where it catalyzes the formation of phosphatidic acid in the glycerolipid biosynthesis pathway. AGPAT2 deficiency causes severe lipodystrophy in both humans and mice and impairs adipogenesis in white and brown adipocyte models in association with reduced mitochondrial mass16,17,18. Incorporation of exogenous mitochondria into differentiating preadipocytes slightly altered lipid droplet size distribution but did not increase the expression of mature brown adipocyte markers or rescue the adipogenic impairment of Agpat2-/- preadipocytes.

<table><tbody><tr><td>100 mm plate</td><td>SPL Life Science</td><td>10101SPL</td><td></td></tr><tr><td>10x Tris/Glycine Buffer</td><td>BioRad</td><td>1610734</td><td></td></tr><tr><td>12 mm glass coverslips</td><td>Marienfeld</td><td>111520</td><td></td></tr><tr><td>12-well plate</td><td>SPL Life Science</td><td>30012SPL</td><td></td></tr><tr><td>16% Paraformaldehyde Aqueous Solution</td><td>Invitrogen</td><td>28908</td><td></td></tr><tr><td>18 mm glass coverslips</td><td>HART</td><td>-</td><td></td></tr><tr><td>24-well plate</td><td>SPL Life Science</td><td>30024SPL</td><td></td></tr><tr><td>3,3&amp;prime;,5-Triiodo-L-thyronine sodium salt (T3)</td><td>Sigma</td><td>T6397</td><td></td></tr><tr><td>3-Isobutyl-1-methylxanthine (IBMX)</td><td>Calbiochem</td><td>410957</td><td></td></tr><tr><td>30% Acrylamide/Bis Solution, 37.5:1</td><td>BioRad</td><td>1610158</td><td></td></tr><tr><td>35 mm plate</td><td>SPL Life Science</td><td>20035SPL</td><td></td></tr><tr><td>6-well plate</td><td>SPL Life Science</td><td>30006SPL</td><td></td></tr><tr><td>60 mm culture dish</td><td>SPL Life Science</td><td>20060SPL</td><td>Used for primary preadipocyte and DNA/qPCR experiments; supplier/catalog not provided</td></tr><tr><td>AccuRuler RGB Plus Pre-stained Protein Ladder</td><td>Maestrogen</td><td>02102-250</td><td></td></tr><tr><td>ACK lysing buffer</td><td>Gibco</td><td>A10492-01</td><td></td></tr><tr><td>Actrapid 100 UI/mL (Insulin)</td><td>Novo Nordisk</td><td>A10AB01</td><td></td></tr><tr><td>ADP</td><td>Merck</td><td>117105</td><td></td></tr><tr><td>Agarose</td><td>FERMELO BIOTEC</td><td>FER00AL200G</td><td>Used for RNA integrity verification; supplier/catalog not provided</td></tr><tr><td>Ammonium Persulfate</td><td>BioRad</td><td>1610700</td><td></td></tr><tr><td>Anti-rabbit IgG, HRP-linked Antibody</td><td>Cell Signaling</td><td>7074</td><td></td></tr><tr><td>Anti-rat IgG, HRP-linked Antibody</td><td>Cell Signaling</td><td>7077</td><td></td></tr><tr><td>Antibiotic-antimycotic</td><td>Gibco</td><td>15240062</td><td></td></tr><tr><td>Axio Observer inverted microscope stand</td><td>Carl Zeiss</td><td>431007-9901-000</td><td>Added from Supplemental Methods</td></tr><tr><td>BCA Protein Assay Kit</td><td>Thermo Scientific</td><td>D49328</td><td></td></tr><tr><td>BD Cytometer Setup and Tracking beads</td><td>BD Biosciences</td><td>-</td><td>Added from Supplemental Methods; catalog not provided</td></tr><tr><td>BD FACSDiva Software v8.0.3</td><td>BD Biosciences</td><td>-</td><td>Added from Supplemental Methods</td></tr><tr><td>BD LSRFortessa X-20 cell analyzer</td><td>BD Biosciences</td><td>-</td><td>Existing entry standardized to match supplemental file</td></tr><tr><td>BioRender</td><td>BioRender</td><td>-</td><td>Used to create Figure 1 workflow</td></tr><tr><td>Blotting-grade blocker</td><td>BioRad</td><td>170-6404</td><td></td></tr><tr><td>BODIPY 493/503</td><td>Invitrogen</td><td>D3922</td><td></td></tr><tr><td>Bovine Serum Albumin (BSA)</td><td>Sigma</td><td>A1470</td><td></td></tr><tr><td>CaCl2</td><td>Calbiochem</td><td>208291</td><td></td></tr><tr><td>cDNA Reverse Transcription Kit</td><td>Invitrogen</td><td>4374966</td><td></td></tr><tr><td>Cell Strainer 100 &amp;mu;m, nylon</td><td>Falcon</td><td>352360</td><td></td></tr><tr><td>Cell Strainer 40 &amp;mu;m, nylon</td><td>Falcon</td><td>352340</td><td></td></tr><tr><td>Collagenase type II</td><td>Gibco</td><td>17101-015</td><td></td></tr><tr><td>Dexamethasone</td><td>Sigma</td><td>D4902</td><td></td></tr><tr><td>DMEM Powder, High Glucose, Pyruvate</td><td>Thermo Scientific</td><td>12800017</td><td></td></tr><tr><td>DMEM/F-12, no phenol red</td><td>Thermo Scientific</td><td>21041025</td><td></td></tr><tr><td>DMEM/F-12, powder</td><td>Gibco</td><td>12500062</td><td></td></tr><tr><td>DMSO</td><td>Sigma</td><td>D8418</td><td>Solvent for induction medium; supplier/catalog not provided</td></tr><tr><td>EMBed-812 EMBEDDING KIT (Epon)</td><td>Electron Microscopy Sciences</td><td>14120</td><td></td></tr><tr><td>Ethanol absolute</td><td>Merck</td><td>100983</td><td></td></tr><tr><td>Ethylene glycol-bis(&amp;beta;-aminoethyl ether)-N,N,N&amp;prime;,N&amp;prime;-tetraacetic acid tetrasodium salt (EGTA)</td><td>Merck</td><td>324626</td><td></td></tr><tr><td>FAST SYBR MASTER MIX</td><td>Thermo Scientific</td><td>4385612</td><td></td></tr><tr><td>FCCP</td><td>Sigma</td><td>C2920</td><td></td></tr><tr><td>Fetal bovine serum</td><td>Capricorn Scientific</td><td>BS-16A</td><td></td></tr><tr><td>Floreada.io</td><td>Floreada.io</td><td>-</td><td>Flow cytometry analysis software</td></tr><tr><td>Fluoromount-G</td><td>Thermo Scientific</td><td>7984-25</td><td></td></tr><tr><td>GAPDH Antibody</td><td>Santa Cruz</td><td>sc-32233</td><td></td></tr><tr><td>Glucose</td><td>Gibco</td><td>15023-021</td><td></td></tr><tr><td>Glutamate</td><td>Sigma</td><td>G1626</td><td></td></tr><tr><td>Glutaraldehyde 25% Aqueous Solution</td><td>Electron Microscopy Sciences</td><td>16210</td><td></td></tr><tr><td>Goat anti-Mouse IgG (H+L) Secondary Antibody, HRP</td><td>Invitrogen</td><td>62-6520</td><td></td></tr><tr><td>GraphPad Prism v10.6.1</td><td>GraphPad Software</td><td>-</td><td>Statistical/logarithmic regression analysis software</td></tr><tr><td>Halt Protease and Phosphatase Inhibitor Cocktail 100X</td><td>Thermo Scientific</td><td>78442</td><td></td></tr><tr><td>HEPES</td><td>Biological Industries</td><td>41-122-100</td><td></td></tr><tr><td>Histone H3 (1G1)</td><td>Santa Cruz</td><td>sc-517576</td><td></td></tr><tr><td>Hoechst 33342</td><td>Life Technologies</td><td>H3570</td><td></td></tr><tr><td>ImageJ v1.54s</td><td>NIH</td><td>-</td><td>Lipid droplet image analysis software</td></tr><tr><td>Immun-Blot PVDF Membrane</td><td>BioRad</td><td>1620177</td><td></td></tr><tr><td>Indomethacin</td><td>Sigma</td><td>I7378</td><td></td></tr><tr><td>Insulin syringe</td><td>Cranberry</td><td>AAJECIN3</td><td>Used for cell homogenization; supplier/catalog not provided</td></tr><tr><td>KCl</td><td>Calbiochem</td><td>529552</td><td></td></tr><tr><td>KH2PO4</td><td>Calbiochem</td><td>529568</td><td></td></tr><tr><td>KHCO3</td><td>Sigma</td><td>60339</td><td></td></tr><tr><td>LAMP-1 Antibody</td><td>Abcam</td><td>ab25245</td><td></td></tr><tr><td>Lane Marker Reducing Sample Buffer</td><td>Thermo Scientific</td><td>39000</td><td></td></tr><tr><td>Malate</td><td>Sigma</td><td>M1000</td><td></td></tr><tr><td>MgCl2</td><td>Calbiochem</td><td>208291</td><td>Component of mitochondrial assay solution; supplier/catalog not provided</td></tr><tr><td>MgSO4</td><td>Sigma</td><td>M2643</td><td></td></tr><tr><td>Microvolume UV-Vis spectrophotometer</td><td>NanoDrop</td><td>ND-1000</td><td>Used for DNA/RNA quantification; supplier/catalog not provided</td></tr><tr><td>MilliQ water sterile</td><td>-</td><td>-</td><td></td></tr><tr><td>MitoTracker Deep Red FM</td><td>Thermo Scientific</td><td>M22426</td><td></td></tr><tr><td>MitoTracker Green</td><td>Thermo Scientific</td><td>M7514</td><td></td></tr><tr><td>NaCl</td><td>Merck</td><td>1064041000</td><td></td></tr><tr><td>Nikon C2plus confocal laser scanning microscope</td><td>Nikon</td><td>C2-SCHJ-1</td><td>Added from Supplemental Methods</td></tr><tr><td>Nikon Ti2 inverted microscope</td><td>Nikon</td><td>MEA54010</td><td>Added from Supplemental Methods</td></tr><tr><td>NIS-Elements AR software v5.11.03</td><td>Nikon</td><td>MQS31000</td><td>Added from Supplemental Methods</td></tr><tr><td>Nuclease-free water</td><td>Winkler</td><td>BM-0140</td><td></td></tr><tr><td>Optical 96-well qPCR plate</td><td>Thermo Scientific</td><td>4346907</td><td>Used for qPCR; supplier/catalog not provided</td></tr><tr><td>Optical adhesive film</td><td>Thermo Scientific</td><td>4311971</td><td>Used for qPCR plate sealing; supplier/catalog not provided</td></tr><tr><td>Orbital shaker</td><td>Lab-Line</td><td>4630-1</td><td>Used during blocking/permeabilization; supplier/catalog not provided</td></tr><tr><td>Osmium Tetroxide</td><td>Electron Microscopy Sciences</td><td>19100</td><td></td></tr><tr><td>Oxygraph+</td><td>Hansatech</td><td>-</td><td></td></tr><tr><td>PBS 10X Biologia Molecular</td><td>Winkler</td><td>BM-1340</td><td></td></tr><tr><td>Plan Apo 60x oil immersion objective, NA 1.4</td><td>Nikon</td><td>MRD01605</td><td>Added from Supplemental Methods</td></tr><tr><td>Plan-Apochromat 10x/0.45 M27 air objective</td><td>Carl Zeiss</td><td>420640-9900-000</td><td>Added from Supplemental Methods</td></tr><tr><td>R software v4.5.2</td><td>R Foundation</td><td>-</td><td>Used for data analysis</td></tr><tr><td>Real-time PCR instrument</td><td>Thermo Scientific</td><td>Quantum Studio 3</td><td>Used for reverse transcription and qPCR; supplier/catalog not provided</td></tr><tr><td>Reynolds Stain (Lead Citrate 3%)</td><td>Electron Microscopy Sciences</td><td>22410-1</td><td></td></tr><tr><td>RIPA lysis buffer</td><td>Thermo Scientific</td><td>89901</td><td></td></tr><tr><td>Rosiglitazone</td><td>Merck</td><td>557366</td><td></td></tr><tr><td>RStudio</td><td>Posit</td><td>-</td><td>Used for R analysis; manuscript/supplement cites RStudio</td></tr><tr><td>Saponin</td><td>Sigma</td><td>47036</td><td></td></tr><tr><td>Sodium bicarbonate</td><td>Sigma</td><td>S5761</td><td></td></tr><tr><td>Sodium Cacodylate</td><td>Electron Microscopy Sciences</td><td>12300</td><td></td></tr><tr><td>Sodium Dodecyl Sulfate</td><td>BioRad</td><td>1610301</td><td></td></tr><tr><td>Sodium hydroxide (NaOH)</td><td>Merck</td><td>B0547933</td><td>Solvent for T3; supplier/catalog not provided</td></tr><tr><td>Sucrose</td><td>Merck</td><td>573113</td><td>Component of mitochondrial isolation buffer; supplier/catalog not provided</td></tr><tr><td>Tetramethylethylenediamine (TEMED)</td><td>BioRad</td><td>1610800</td><td></td></tr><tr><td>Thermo Scientific F200C TEM</td><td>Thermo Scientific</td><td>-</td><td></td></tr><tr><td>TOMM20 antibody</td><td>Cell Signaling</td><td>42406</td><td></td></tr><tr><td>Tris Buffered Saline (TBS-10X)</td><td>Cell Signaling</td><td>12498</td><td></td></tr><tr><td>TRIzol reagent</td><td>Invitrogen</td><td>15596018</td><td></td></tr><tr><td>Trypsin-EDTA (0.25%)</td><td>Gibco</td><td>25200056</td><td></td></tr><tr><td>Tuberculin syringe</td><td>NIPRO</td><td>JD-01T2516/IB</td><td>Used for cell disruption; supplier/catalog not provided</td></tr><tr><td>TURBO DNA-free Kit</td><td>Thermo Scientific</td><td>AM1907</td><td></td></tr><tr><td>Tween 20, Molecular Biology Grade</td><td>Promega</td><td>H5152</td><td></td></tr><tr><td>Ultracut R</td><td>Leica</td><td>-</td><td></td></tr><tr><td>Uranyl Acetate</td><td>Electron Microscopy Sciences</td><td>22400</td><td></td></tr><tr><td>VAP-A Antibody</td><td>Santa Cruz</td><td>sc-293278</td><td></td></tr><tr><td>Vinculin Antibody</td><td>Santa Cruz</td><td>sc-73614</td><td></td></tr><tr><td>Westar Supernova</td><td>Cyanagen</td><td>XLS3</td><td></td></tr><tr><td>Zeiss LSM 880 confocal laser scanning microscope with Airyscan detector</td><td>Carl Zeiss</td><td>421102-9010-000</td><td></td></tr><tr><td>ZEN software</td><td>Carl Zeiss</td><td>-</td><td>Airyscan/deconvolution software</td></tr><tr><td>Gene</td><td>Forward (5&amp;rsquo;&amp;rarr;3&amp;rsquo;)</td><td>Reverse (5&amp;rsquo;&amp;rarr;3&amp;rsquo;)</td><td></td></tr><tr><td>H-mtDNA</td><td>CACTTTCCACACAGACATCA</td><td>CACTTTCCACACAGACATCA</td><td></td></tr><tr><td>PPARy</td><td>CACAATGCCATCAGGTTTGG</td><td>GCTGGTCGATATCACTGGAGATC</td><td></td></tr><tr><td>PPAR&amp;alpha;</td><td>ACAAGGCCTCAGGGTACCA</td><td>GCCGAAAGAAGCCCTTACAG</td><td></td></tr><tr><td>PCG&amp;alpha;-1</td><td>AACCACACCCACAGGATC</td><td>TCTTCGCTTTATTGCTCCATGA</td><td></td></tr><tr><td>UCP1</td><td>GAGGTGTGGCAGTGTTCATTG</td><td>GGCTTGCATTCTGACCTTCA</td><td></td></tr><tr><td>PRDM16</td><td>GACATTCCAATCCCAGA</td><td>CACCTCTGTATCCGTCAGCA</td><td></td></tr><tr><td>PLIN1</td><td>GGGCTGTCTGAGACTGAGGT</td><td>GCAGAACTCTCTGGAGCACG</td><td></td></tr><tr><td>FATP4</td><td>ACCCAAAGCTGCCATTGTG</td><td>GCATGCGGAATCCAAGTACCA</td><td></td></tr><tr><td>36b4</td><td>CACTGGTCTAGGACCCGAGAAG</td><td>GGTGCCTCTGGAGATTTTCG</td><td></td></tr></tbody></table>

exogenous mitochondrial transfer in differentiating brown adipocytes and agpat2-deficient preadipocytes

Exogenous Mitochondrial Transfer in Differentiating Brown Adipocytes and AGPAT2-Deficient Preadipocytes

Mitochondria are key signaling hubs; however, whether mitochondrial mass expansion is mechanistically required for differentiation remains an open question. AGPAT2 catalyzes the conversion of lysophosphatidic acid into phosphatidic acid, and its deficiency leads to adipose tissue deficiency and impaired adipogenesis associated with reduced mitochondrial mass. The impact of mitochondrial mass expansion on adipogenesis was assessed by transferring exogenous mitochondria into differentiating brown adipocytes. Whether mitochondrial transfer could rescue the impaired adipogenesis of AGPAT2-deficient cells was also investigated. Human and murine mitochondria were successfully transferred and incorporated into the endogenous mitochondrial network of differentiating mouse preadipocytes and persisted throughout brown adipogenesis. Adipogenic differentiation was required for the retention of transferred mitochondria. Mitochondrial transfer did not modify the expression of molecular markers of mature brown adipocytes or lipid droplet content, although it affected the relative distribution of lipid droplet size in a species-dependent manner. In Agpat2-/- preadipocytes, mitochondrial transfer failed to rescue adipogenesis, indicating that mitochondrial mass expansion alone is insufficient to reverse the mechanisms leading to lipodystrophy in this model. These results indicate that, although exogenous human and murine mitochondria can be incorporated into the mitochondrial network of differentiating adipocytes, they do not directly influence the adipogenic program.

Mitochondrial extraction and structural and respiratory integrity
To evaluate the impact of increased mitochondrial mass on brown adipogenesis, a mitochondrial transfer assay (MTA) was performed in undifferentiated preadipocytes (Figure 1A). Mitochondria were isolated from primary murine preadipocytes (mMito) and from the human hepatic HepG2 cell line (hMito). Western blot analysis demonstrated that both preparations were highly enriched in the mi...

Exogenous mitochondria of human and murine origin can be internalized by differentiating preadipocytes and tracked throughout adipogenic differentiation using imaging and genetic tools. While these mitochondria physically interact with the endogenous mitochondrial network, they do not increase the expression of markers associated with mature brown adipocytes.

Mitochondria are key signaling hubs; however, whether mitochondrial mass expansion is mechanistically required for differentiation remains an open ...

exogenous-mitochondrial-transfer-differentiating-brown-adipocytes

Research

JoVE Journal

Biology

Genetic Inducible Fate Mapping (GIFM) marks and tracks cells with fine spatial and temporal control in vivo and elucidates how cells from a specific genetic lineage contribute to developing and adult tissues.  Demonstrated here are the techniques required to fate map E12.5 mouse embryos for epifluorescent and explant analysis.

A Practical Approach to Genetic Inducible Fate Mapping: A Visual Guide to Mark and Track Cells In Vivo

Visualization of in vivo RNA transport is accomplished by microinjection of fluorescently labeled RNA transcripts into Xenopus oocytes, followed by confocal microscopy.

Visualizing RNA Localization in Xenopus Oocytes

Here we report protocols to detect endogenous and exogenous centromere-kinetochore proteins in human cells and quantify these protein levels at centromeres-kinetochores by indirect immunofluorescent staining through the use of fixation (paraformaldehyde, acetone, or methanol fixation).

 Immunofluorescence Analysis of Endogenous and Exogenous Centromere-kinetochore Proteins

Analysis of the mitochondrial structure-function relationship is required for a thorough understanding of the regulatory mechanisms of mitochondrial functionality. Specific methods for studying mitochondrial structure and function in live and fixed Drosophila ovaries are described and demonstrated in this paper.

Studying Mitochondrial Structure and Function in Drosophila Ovaries

Mitochondria can utilize the electrochemical potential across their inner membrane (ΔΨm) to sequester calcium (Ca2+), allowing them to shape cytosolic Ca2+ signaling within the cell. We describe a method for simultaneously measuring mitochondria Ca2+ uptake and ΔΨm in live cells using fluorescent dyes and confocal microscopy.

Simultaneous Measurement of Mitochondrial Calcium and Mitochondrial Membrane Potential in Live Cells by Fluorescent Microscopy

Here, we present a protocol for the isolation of RNA, DNA, and protein from the same sample, in an effort to reduce variation, improve reproducibility, and facilitate interpretations.

Combined Nucleotide and Protein Extractions in Caenorhabditis elegans

This report describes a protocol for the simultaneous isolation of primary brown and white preadipocytes from newborn mice. Isolated cells can be grown in culture and induced to differentiate into fully mature white and brown adipocytes. The method enables genetic, molecular, and functional characterization of primary fat cells in culture.

Isolation and Differentiation of Primary White and Brown Preadipocytes from Newborn Mice

In this work, we describe a modified protocol to test mitochondrial respiratory substrate flux using recombinant perfringolysin O  in combination with microplate-based respirometry. With this protocol, we show how metformin affects mitochondrial respiration of two different tumor cell lines.

Measuring Mitochondrial Substrate Flux in Recombinant Perfringolysin O-Permeabilized Cells

This manuscript describes a protocol to measure the basal metabolic rate and the oxidative capacity of thermogenic adipocytes in obese mice.

Determining Basal Energy Expenditure and the Capacity of Thermogenic Adipocytes to Expend Energy in Obese Mice

This protocol describes the isolation of mouse preadipocytes from subcutaneous fat, their differentiation into mature adipocytes, and the induction of insulin resistance. Insulin action is evaluated by the phosphorylation/activation of members of the insulin signaling pathway through western blot. This method allows direct determination of insulin resistance/sensitivity in primary adipocytes.

Differentiated Mouse Adipocytes in Primary Culture: A Model of Insulin Resistance

Pontificia Universidad Católica de Chile.  Exogenous mitochondria of human and murine origin can be internalized by differentiating preadipocytes and tracked throughout adipogenic differentiation using imaging and genetic tools. While these mitochondria physically interact with the endogenous mitochondrial network, they do not increase the expression of markers associated with mature brown adipocytes.

Exogenous Mitochondrial Transfer in Differentiating Brown Adipocytes and AGPAT2-Deficient Preadipocytes

Explore More Videos