A subscription to JoVE is required to view this content. Sign in or start your free trial.

Research Article

N6-Methyladenosine Modification of Rab27A Promotes Osteoporosis by Influencing Osteoclast Differentiation in the Ovariectomized Mouse Model

47 views

⸱

DOI:

10.3791/71964

⸱

August 11th, 2026

 ,  ,  ,  ,  ,  ,  , 
1Department of Orthopedics, Affiliated Hospital of Southwest Medical University, 2Department of Orthopedics, The People's Hospital of Pengzhou, 3Department of Clinical Skills Center, Affiliated Hospital of Southwest Medical University, 4Southwest Medical University, 5Stem Cell Immunity and Regeneration Key Laboratory of Luzhou, Affiliated Hospital of Southwest Medical University

* These authors contributed equally

In This Article

Summary

YTHDC1 promotes the cytoplasmic export of m6A-modified Rab27A, whereas IGF2BP2 stabilizes Rab27A in the cytoplasm, thereby enhancing osteoclast differentiation and contributing to osteoporosis.

Abstract

The development of novel therapies for osteoporosis has attracted increasing attention. Rab27A is upregulated during osteoclast differentiation, and N6-methyladenosine (m6A) modification has emerged as an important epigenetic regulator in orthopedic diseases. Bioinformatic analyses predicted that Rab27A contains multiple m6A modification sites and interacts with several m6A-associated proteins. Knockdown experiments were performed to evaluate the role of Rab27A in osteoclast differentiation and osteoporosis using an ovariectomized (OVX) mouse model. Rab27A depletion attenuated osteoporosis and increased the bone formation percentage from 14.73% to 28.13% (P < 0.05) in OVX mice. Western blotting and quantitative PCR demonstrated that Rab27A knockdown reduced the protein and mRNA expression of the osteoclast markers TRAP, NFATc1, and c-FOS, thereby suppressing osteoclast differentiation of bone marrow-derived macrophages (BMMs) induced by macrophage colony-stimulating factor (M-CSF) and receptor activator of nuclear factor-κB ligand (RANKL). TRAP staining further showed that Rab27A depletion significantly reduced TRAP activity from 24.1% to 12.9% (P < 0.01) following M-CSF and RANKL induction. RNA immunoprecipitation assays confirmed interactions between Rab27A and the m6A reader proteins YTHDC1 and IGF2BP2. Nuclear and cytoplasmic fractionation demonstrated that YTHDC1 facilitates the cytoplasmic export of m6A-modified Rab27A. In addition, q-PCR and western blot analyses showed that knockdown of either YTHDC1 or IGF2BP2 reduced Rab27A expression and decreased the expression of TRAP, NFATc1, and c-FOS, thereby suppressing osteoclast differentiation induced by M-CSF and RANKL. Collectively, these findings indicate that YTHDC1-mediated cytoplasmic export and IGF2BP2-mediated stabilization of m6A-modified Rab27A promote osteoclast differentiation and contribute to bone loss in the OVX mouse model.

Introduction

Osteoporosis (OP) is a common skeletal disorder characterized by deterioration of bone microarchitecture and reduced bone mineral density, resulting in an increased risk of fractures worldwide1,2,3. Osteoporotic fractures occur most frequently in the forearm, humerus, hip, and spine and are particularly prevalent among older adults. These fractures substantially impair quality of life and impose considerable physical, psychological, and socioeconomic burdens on patients, their families, and healthcare systems3. Consequently, the prevention, management, and treatment of osteoporosis remain major clinical and public health priorities.

A variety of therapeutic strategies have been developed for osteoporosis and can generally be classified into two categories: bone-forming agents and anti-resorptive therapies4,5. Traditional anti-resorptive drugs include bisphosphonates, raloxifene, and strontium ranelate, whereas newer agents include denosumab, odanacatib, and saracatinib. Bone-forming therapies include parathyroid hormone (PTH 1–84), while several additional candidates, such as MK-5442, AMG 785, and BHQ 880, are undergoing clinical development5. Although these treatments can be effective, many are associated with significant adverse effects, limited long-term efficacy, or restrictions on prolonged use4,6,7,8,9. For example, long-term administration of aminobisphosphonates and denosumab may impair normal bone remodeling5. Therefore, identifying safer and more effective therapeutic targets remains an important objective in osteoporosis research.

Rab proteins are key regulators of intracellular vesicle trafficking and cell signaling and participate in diverse biological processes, including viral infection, autophagy, and cytoskeletal organization10. In recent years, increasing attention has been directed toward the roles of Rab family proteins in bone metabolism and osteoporosis. Rab44 has been reported to regulate osteoclast differentiation by modulating intracellular Ca2⁺ signaling and activating nuclear factor of activated T cells 1 (NFATc1) in receptor activator of nuclear factor-κB ligand (RANKL)-treated macrophages11. Osteoclasts are multinucleated cells derived from macrophage lineage precursors and play essential roles in bone resorption and skeletal homeostasis12,13,14,15,16,17,18,19. Therefore, understanding the molecular mechanisms governing osteoclast differentiation is critical for developing novel therapeutic approaches for osteoporosis.

Rab27A is an important member of the Rab GTPase family and is widely expressed in secretory and immune cells. It plays pivotal roles in vesicle transport, exocytosis, and intracellular signaling20,21,22,23,24,25,26,27. Previous studies have demonstrated that Rab27A regulates eosinophil degranulation during airway inflammation and controls vesicular mobilization associated with NADPH oxidase activity in activated macrophages20.23. Notably, accumulating evidence indicates that Rab27A expression is significantly upregulated during osteoclast differentiation. Shimada-Sugawara et al. reported that Rab27A expression increases during the differentiation of bone marrow-derived macrophages (BMMs) into osteoclasts, suggesting a potential role in osteoclastogenesis28. Collectively, these findings suggest that Rab27A may influence osteoclast formation and function by regulating vesicular trafficking and intracellular signaling pathways28,29.

N6-methyladenosine (m6A) is the most abundant internal RNA modification in eukaryotic messenger RNAs and non-coding RNAs and serves as a critical regulator of RNA metabolism and gene expression. As the first identified mRNA modification in mammals, m6A has been implicated in numerous biological processes, including RNA stability, splicing, transport, and translation. Wang et al. demonstrated that m6A modifications, commonly occurring within conserved sequence motifs, are recognized by YTH domain-containing proteins and contribute to the regulation of mRNA stability and metabolism30. Furthermore, m6A modification has been implicated in diverse biological functions, including genome stability, transcriptional regulation, chromatin organization, cancer progression, and immune responses31. Recent studies have also highlighted important roles for m6A signaling in bone-related diseases and osteoporosis32.

Among m6A reader proteins, YTHDC1 functions as a nuclear reader that regulates RNA processing and nuclear export, whereas insulin-like growth factor 2 mRNA-binding protein 2 (IGF2BP2) stabilizes m6A-modified transcripts in the cytoplasm. Chen et al. demonstrated that YTHDC1 promotes the nuclear export of m6A-modified circNSUN2, which subsequently interacts with IGF2BP2 to stabilize HMGA2 mRNA and promote colorectal cancer metastasis33. These findings suggest that coordinated regulation by YTHDC1 and IGF2BP2 may represent a general mechanism controlling the fate of m6A-modified transcripts.

The present study investigated predicted m6A modification sites within Rab27A mRNA and examined its interactions with YTHDC1 and IGF2BP2. YTHDC1 was found to facilitate the nuclear export of m6A-modified Rab27A transcripts, whereas IGF2BP2 interacted with Rab27A in the cytoplasm and enhanced its stability. Through this regulatory mechanism, Rab27A promoted osteoclast differentiation and contributed to the progression of osteoporosis. Collectively, the findings identify a previously unrecognized m6A-dependent regulatory pathway involving YTHDC1, IGF2BP2, and Rab27A in osteoclast differentiation. These results provide new insights into the molecular pathogenesis of osteoporosis and may facilitate the development of novel therapeutic strategies targeting m6A-mediated regulation of Rab27A.

Access restricted. Please log in or start a trial to view this content.

Protocol

All animal procedures were approved by the Animal Protection and Utilization Committee of the Affiliated Hospital of Southwest Medical University (Approval No. 2024-Ethics-042). All experiments were conducted in accordance with the ARRIVE guidelines, the U.K. Animals (Scientific Procedures) Act 1986 and associated guidelines, EU Directive 2010/63/EU, and the National Institutes of Health Guide for the Care and Use of Laboratory Animals (NIH Publication No. 8023, revised 1978). Mice were randomly assigned to experimental groups, and the allocation sequence was concealed from the investigator. All data acquisition and analyses, including histological evaluation, micro-computed tomography (micro-CT) image analysis, and statistical analyses, were performed by investigators blinded to group allocation. No animals or samples were excluded from the analyses. All reagents, equipment, software, and other resources used in this protocol are listed in the Table of Materials.

1. Construction of the Ovariectomy (OVX) model

Twenty-four female wild-type C57BL/6 mice aged 8 weeks were used to establish an osteoporosis model. Following a 1-week acclimatization period, mice were randomly assigned to either the Sham or OVX group. The OVX model was established by bilateral ovariectomy as previously described34,35. Sham-operated mice underwent surgical exposure of the ovaries without removal.

For intra-femoral gene delivery, lentiviral vectors expressing sh-Rab27A or sh-NC were injected 7 days after OVX surgery as previously reported36,37. Briefly, concentrated lentiviral particles (1 × 106 transducing units/mL) were injected into the femur through the patellar route using a 22-gauge needle under anesthesia. Each mouse received 20 µL of lentiviral suspension. The incision was subsequently sutured, and the animals were monitored throughout recovery.

All animal experiments were performed under specific pathogen-free conditions. Femoral specimens were collected 8 weeks after surgery. At least six mice per group were used for histological analyses and RNA or protein extraction.

2. In-vivo micro-CT imaging

Micro-computed tomography (micro-CT) was performed to evaluate trabecular bone morphology. The right tibia of each mouse was scanned in vivo before OVX surgery at 14 weeks of age. Follow-up scans were performed weekly until 22 weeks of age. At least six mice per group were included in the micro-CT analysis.

Mice were anesthetized with intraperitoneal sodium pentobarbital (50 mg/kg body weight). Adequate anesthesia was confirmed by the absence of the toe-pinch reflex and by continuous monitoring of respiratory rate, and it was maintained throughout the imaging procedure. All euthanasia procedures were conducted in accordance with the approved animal protocol, institutional animal welfare guidelines, and national regulations for laboratory animal euthanasia.

At 24 weeks of age, mice were euthanized by cervical dislocation following deep anesthesia, and both tibiae were harvested for ex vivo scanning using the same imaging protocol. Scanning parameters included a voxel size of 10.4 µm, a voltage of 55 kV, a current of 145 µA, a field of view of 32 mm, 1500/750 samples per projection, and an integration time of 100 ms.

Images were processed using a third-order polynomial beam-hardening correction algorithm calibrated against a 1200 mg HA/cm3 phantom. Bone volume fraction (BV/TV), trabecular thickness (Tb.Th), and trabecular number (Tb.N) were quantified in the distal femoral metaphysis located 1.0 mm proximal to the growth plate.

3. Plasmid transfection

sh-Rab27A and sh-NC plasmids were generated and used for lentivirus production. Lentiviral packaging plasmids and shRNA constructs were co-transfected into HEK293T cells according to the manufacturer's instructions. Viral titers were determined before intra-femoral administration as previously described36. Three independent biological replicates were performed.

4. Hematoxylin and eosin (HE) staining

Femoral specimens were fixed in 4% paraformaldehyde for 24 h, decalcified in 10% EDTA for 4 weeks, cryoprotected in 30% sucrose/PBS, embedded in paraffin, and sectioned at a thickness of 5 µm. Tissue sections were stained with hematoxylin and eosin and examined using a light microscope. At least six mice per group were analyzed.

5. Tartrate-resistant acid phosphatase (TRAP) staining

TRAP staining of femoral sections was performed according to the manufacturer's instructions38. TRAP activity in bone marrow-derived macrophages (BMMs) was evaluated using a TRAP staining assay. Mature osteoclasts were defined as TRAP-positive multinucleated cells containing at least three nuclei. Three independent biological replicates were performed, each with three technical replicates.

6. q-PCR

Total RNA was isolated using TRIzol reagent according to the manufacturer's instructions. Complementary DNA was synthesized using reverse transcriptase and subjected to quantitative real-time PCR using SYBR Green chemistry. Three independent biological replicates were performed, each with three technical replicates.

Primer sequences were as follows:

Rab27A: F, TTCCTGCTTCTGTTCGACCT; R, GGCAGCACTGGTTTCAAAAT

TRAP: F, TGTTGACAGCGGTCCATCTA; R, CCTCCTTCTTAACCCGAAGC

NFATc1: F, GGTGCTGTCTGGCCATAACT; R, GCGGAAAGGTGGTATCTCAA

c-FOS: F, TACTACCATTCCCCAGCCGA; R, GCTGTCACCGTGGGGATAAA

YTHDC1: F, GAAGTGGAAGCTCTGCATCAG; R, TTGATCTTTTCGGACAGCACG

IGF2BP2: F, GACTACCCCGACCAGAACTG; R, GAGGCGGGATGTTCCGAATC

β-actin: F, GGGAAATCGTGCGTGACATTAAG; R, TGTGTTGGCGTACAGGTCTTTG

7. Western blotting

Cells or tissues were lysed using RIPA buffer supplemented with protease inhibitors. Protein concentrations were determined using a Bradford assay. Equal amounts of protein (20 µg) were separated by SDS-PAGE and transferred to polyvinylidene fluoride (PVDF) or nitrocellulose membranes. Membranes were blocked with 5% non-fat milk for 1 h at room temperature and incubated overnight at 4 °C with primary antibodies against TRAP, NFATc1, c-FOS, Rab27A, YTHDC1, IGF2BP2, or β-actin. After washing, membranes were incubated with the appropriate secondary antibodies for 1 h at room temperature. Protein bands were visualized using standard detection procedures. Three independent biological replicates were performed.

8. Cell culture

Bone marrow-derived macrophages (BMMs) were isolated as previously described39. Bone marrow cells harvested from mouse femurs were cultured overnight in α-minimum essential medium supplemented with 10% fetal bovine serum, 30 ng/mL macrophage colony-stimulating factor (M-CSF), and 1% penicillin/streptomycin at 37 °C in a humidified atmosphere containing 5% CO₂. Non-adherent cells were collected and cultured in a stromal cell-free system containing 30 ng/mL M-CSF. After 3 days, adherent cells were harvested as BMMs and further cultured in the presence of 30 ng/mL M-CSF and 50 ng/mL receptor activator of nuclear factor-κB ligand (RANKL) for 72 h to induce osteoclast differentiation.

9. RNA interference (RNAi)

Small interfering RNAs (siRNAs) were synthesized and transfected using a lipid-based transfection reagent according to the manufacturer's instructions. Cells were seeded at a density of 2 × 104 cells per well in six-well plates before transfection. Three independent biological replicates were performed.

Target sequences were as follows:

si-Rab27A: GGACUUAAUCAUCTAAGAGAAUGGAA

si-YTHDC1: GCAAGGAGUGUUAUCUUAATT

si-IGF2BP2: CCGUUAACCAACAAGCCAATT

10. Immunofluorescence

Cells were fixed with 4% paraformaldehyde for 20 min and permeabilized with 0.1% Triton X-100 for 10 min. Following blocking with 5% bovine serum albumin for 30 min, cells were incubated with primary antibodies overnight at 4 °C.

After washing, fluorophore-conjugated secondary antibodies were applied for 30 min at room temperature. Nuclei were counterstained with DAPI, and images were acquired using confocal microscopy. Three independent biological replicates were performed.

11. Nuclear and cytoplasmic separation

Nuclear and cytoplasmic fractions were isolated according to the manufacturer's instructions. Cells were lysed on ice for 10 min and centrifuged at 500 × g for 3 min at 4 °C. The supernatant containing cytoplasmic components was collected, whereas the pellet containing nuclei was washed and processed separately.

12. RNA-binding protein immunoprecipitation (RIP)

RNA immunoprecipitation (RIP) assays were performed according to the manufacturer's instructions. Briefly, cells were lysed on ice for 30 min. After centrifugation, the supernatants were incubated overnight with antibodies and Protein A/G agarose beads. Following washing, immunoprecipitated proteins were analyzed by western blotting, and co-immunoprecipitated RNA was analyzed by quantitative real-time PCR. Three independent biological replicates were performed.

13. Rab27A mRNA stability assay

Total RNA was extracted at the indicated time points following IGF2BP2 knockdown. Reverse transcription and quantitative real-time PCR were subsequently performed. Rab27A mRNA levels were normalized to the corresponding si-NC group at 0 h. Three independent biological replicates were performed.

14. Statistical analysis

All experiments were independently performed using at least three biological replicates. For q-PCR, RNA interference, TRAP staining, western blotting, and other cell-based assays, each biological replicate included three technical replicates unless otherwise specified. Data are presented as the mean ± standard deviation (SD).

Statistical analyses were performed using GraphPad Prism version 9.0 and SPSS software. Comparisons between two groups were conducted using a two-tailed Student's t-test. Comparisons among multiple groups were analyzed using two-way analysis of variance (ANOVA) followed by Tukey's multiple-comparison post hoc test to adjust for multiple comparisons. A P value < 0.05 was considered statistically significant.

Access restricted. Please log in or start a trial to view this content.

Results

Knockdown of Rab27A reduced osteoporosis in vivo.

To investigate the role of Rab27A in osteoporosis, Rab27A knockdown was performed in an ovariectomized (OVX) mouse model established using previously reported methods34,40. The overall study design is summarized in Figure 1. Micro-computed tomography analysis demonstrated that bone mineral density, bone volume fraction (BV/TV), tra...

Access restricted. Please log in or start a trial to view this content.

Discussion

Osteoclast differentiation plays essential roles in bone remodeling, bone resorption, fracture repair, and skeletal homeostasis12˒15˒17˒18˒42˒43. Excessive osteoclast activity is a major contributor to osteoporosis, making the identification of regulatory pathways controlling osteoclast differentiation an important research objective. Several anti-resorpt...

Access restricted. Please log in or start a trial to view this content.

Disclosures

The authors declare no competing financial interests or conflicts of interest.

Acknowledgements

This work was financially supported by The Scientific and Technological Strategic Cooperation Project between Pengzhou People’s Hospital and Southwest Medical University (Grant No. 2023PZXNYD01) to Lian Tang.

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
4% ParaformaldehydeThermo Fisher ScientificA5818101Tissue and cell fixation
Alexa Fluor 488 secondary antibodyThermo Fisher ScientificA-11001Fluorescent secondary antibody for immunofluorescence; RRID: AB_2534069
Alexa Fluor 546 secondary antibodyThermo Fisher ScientificA-11035Fluorescent secondary antibody for immunofluorescence; RRID: AB_2534093
Bovine serum albumin (BSA)MerckA2153Blocking reagent
Bradford Protein AssayMerckB6916Protein quantification
C57BL/6JSlac miceShanghai SLAC Laboratory Animal Co., Ltd.—Female, 8 weeks old; RRID: MGI:2159769
c-FOS antibodyAbcamab222699Primary antibody for western blotting; RRID: AB_2891049
Confocal laser scanning microscope (SP8)Leica MicrosystemsSP8Immunofluorescence image acquisition; RRID: SCR_018169
DAPIThermo Fisher ScientificD3571Nuclear counterstain for immunofluorescence; RRID: AB_2307445
EDTAMerckV900081-500GTissue decalcification reagent
EosinSolarbioG1100Histological cytoplasmic stain
Fetal bovine serum (FBS)Thermo Fisher ScientificA5669701Cell culture supplement
GraphPad PrismGraphPad SoftwareVersion 9.0Statistical analysis software; RRID: SCR_002798
HematoxylinCell Signaling Technology#14166Histological nuclear stain
IBM SPSS StatisticsIBMWindows versionStatistical analysis software; RRID: SCR_016479
IGF2BP2 antibodyProteintech11601-1-APPrimary antibody for western blotting and immunofluorescence; RRID: AB_2122672
Inverted light microscope (DMi8)Leica MicrosystemsDMi8Histological image acquisition; RRID: SCR_026672
Lentiviral titer quantification kitTakara Bio631235Lentiviral titer determination
Lipofectamine 3000Thermo Fisher ScientificL3000015Plasmid transfection reagent
Lipofectamine RNAiMAXThermo Fisher Scientific13778150siRNA transfection reagent
M-CSFMedChemExpressHY-P7085Osteoclast differentiation factor
Micro-computed tomography systemScanco MedicalVivaCT80Bone morphometric analysis
M-MLV Reverse TranscriptasePromegaM1701cDNA synthesis
NFATc1 antibodySanta Cruz Biotechnologysc-7294Primary antibody for western blotting; RRID: AB_2152503
PARIS KitThermo Fisher ScientificAM1556Nuclear and cytoplasmic fractionation
Penicillin/StreptomycinThermo Fisher Scientific15140122Antibiotic supplement for cell culture
Power SYBR Green Master MixThermo Fisher Scientific4367659Quantitative real-time PCR
Protease inhibitor cocktailThermo Fisher Scientific78429Prevention of protein degradation
Protein A/G agarose beadsMerckIP05Immunoprecipitation
PVDF membraneThermo Fisher Scientific88520Protein transfer membrane for western blotting
Rab27A antibodyAbcamab55667Primary antibody for western blotting and immunofluorescence; RRID: AB_945112
RANKLMedChemExpressHY-P7425Osteoclast differentiation factor
Real-time PCR systemApplied BiosystemsABI7900HTQuantitative real-time PCR instrument
RIPA bufferThermo Fisher Scientific78501Protein extraction buffer
RNA Immunoprecipitation (RIP) KitMilliporeRIP-12RXNRNA immunoprecipitation assay
SDS-PAGE reagentsThermo Fisher ScientificBT041210BOXProtein electrophoresis
shRNA plasmidsRiboBio—Gene silencing by RNA interference
Small interfering RNAs (siRNAs)GenePharma—Gene silencing by RNA interference
SRAMPOnline resource—Prediction of m6A modification sites; RRID: SCR_024500
StarBase (ENCORI)Online resource—RNA interaction prediction database; RRID: SCR_016303
TRAP antibodyAbcamab2391Primary antibody for western blotting; RRID: AB_303034
TRAP staining kitMerck387ADetection of osteoclast activity
Triton X-100Thermo Fisher Scientific85111Cell permeabilization reagent
TRIzol ReagentThermo Fisher Scientific15596026CNTotal RNA isolation
YTHDC1 antibodyAbcamab122340Primary antibody for western blotting; RRID: AB_11128253
α-MEMFUJIFILM Wako Pure Chemical Corporation139-15651Cell culture medium
β-Actin antibodyMerckA5441Loading control for western blotting; RRID: AB_476744

References

  1. Kanis JA. Assessment of fracture risk and its application to screening for postmenopausal osteoporosis: synopsis of a WHO report. WHO Study Group. Osteoporos Int. 1994;4(6):368-81.
  2. Leslie WD, Morin SN. Osteoporosis epidemiology 2013: implications for diagnosis, risk assessment, and treatment. Curr Opin Rheumatol. 2014;26(4):440-6.
  3. Chen P, Li Z, Hu Y. Prevalence of osteoporosis in China: a meta-analysis and systematic review. BMC Public Health. 2016;16(1):1039. doi: 10.1186/s12889-016-3712-7.
  4. Sambrook P, Cooper C. Osteoporosis. Lancet. 2006;367(9527):2010-8.
  5. Rachner TD, Khosla S, Hofbauer LC. Osteoporosis: now and the future. Lancet. 2011;377(9773):1276-87.
  6. Bone HG, et al. 10 years of denosumab treatment in postmenopausal women with osteoporosis: results from the phase 3 randomised FREEDOM trial and open-label extension. Lancet Diabetes Endocrinol. 2017;5(7):513-23.
  7. Siris ES, et al. Impact of osteoporosis treatment adherence on fracture rates in North America and Europe. Am J Med. 2009;122(2 Suppl):S3-13.
  8. Cheung EYN, Tan KCB, Cheung CL, Kung AWC. Osteoporosis in East Asia: Current issues in assessment and management. Osteoporos Sarcopenia. 2016;2(3):118-33.
  9. Kohno N, et al. Zoledronic acid significantly reduces skeletal complications compared with placebo in Japanese women with bone metastases from breast cancer: a randomized, placebo-controlled trial. J Clin Oncol. 2005;23(15):3314-21.
  10. Stenmark H. Rab GTPases as coordinators of vesicle traffic. Nat Rev Mol Cell Biol. 2009;10(8):513-25.
  11. Yamaguchi Y, et al. Rab44, a novel large Rab GTPase, negatively regulates osteoclast differentiation by modulating intracellular calcium levels followed by NFATc1 activation. Cell Mol Life Sci. 2018;75(1):33-48.
  12. Xiang Q, et al. Beyond resorption: osteoclasts as drivers of bone formation. Cell Regen. 2024;13(1):22. doi: 10.1186/s13619-024-00205-0.
  13. Teitelbaum SL. Bone resorption by osteoclasts. Science. 2000;289(5484):1504-8.
  14. Suda T, Takahashi N, Martin TJ. Modulation of osteoclast differentiation. Endocr Rev. 1992;13(1):66-80.
  15. Durdan MM, Azaria RD, Weivoda MM. Novel insights into the coupling of osteoclasts and resorption to bone formation. Semin Cell Dev Biol. 2022;123:4-13.
  16. Boyle WJ, Simonet WS, Lacey DL. Osteoclast differentiation and activation. Nature. 2003;423(6937):337-42.
  17. Tosun B, et al. Osteoclasts and Macrophages-Their Role in Bone Marrow Cavity Formation During Mouse Embryonic Development. J Bone Miner Res. 2022;37(9):1761-74.
  18. Xie H, et al. PDGF-BB secreted by preosteoclasts induces angiogenesis during coupling with osteogenesis. Nat Med. 2014;20(11):1270-8.
  19. Hattner R, Epker BN, Frost HM. Suggested sequential mode of control of changes in cell behaviour in adult bone remodelling. Nature. 1965;206(983):489-90.
  20. Kim JD, et al. An essential role for Rab27a GTPase in eosinophil exocytosis. J Leukoc Biol. 2013;94(6):1265-74.
  21. Goishi K, Mizuno K, Nakanishi H, Sasaki T. Involvement of Rab27 in antigen-induced histamine release from rat basophilic leukemia 2H3 cells. Biochem Biophys Res Commun. 2004;324(1):294-301.
  22. Johnson JL, et al. Munc13-4 restricts motility of Rab27a-expressing vesicles to facilitate lipopolysaccharide-induced priming of exocytosis in neutrophils. J Biol Chem. 2011;286(7):5647-56.
  23. Ejlerskov P, et al. NADPH oxidase is internalized by clathrin-coated pits and localizes to a Rab27A/B GTPase-regulated secretory compartment in activated macrophages. J Biol Chem. 2012;287(7):4835-52.
  24. Kariya Y, et al. Rab27a and Rab27b are involved in stimulation-dependent RANKL release from secretory lysosomes in osteoblastic cells. J Bone Miner Res. 2011;26(4):689-703.
  25. Johnson JL, et al. Rab27a and Rab27b regulate neutrophil azurophilic granule exocytosis and NADPH oxidase activity by independent mechanisms. Traffic. 2010;11(4):533-47.
  26. Yokoyama K, et al. Rab27a negatively regulates phagocytosis by prolongation of the actin-coating stage around phagosomes. J Biol Chem. 2011;286(7):5375-82.
  27. Jancic C, et al. Rab27a regulates phagosomal pH and NADPH oxidase recruitment to dendritic cell phagosomes. Nat Cell Biol. 2007;9(4):367-78.
  28. Shimada-Sugawara M, et al. Rab27A regulates transport of cell surface receptors modulating multinucleation and lysosome-related organelles in osteoclasts. Sci Rep. 2015;5:9620. doi: 10.1038/srep09620.
  29. Johnson JL, et al. Vesicular trafficking through cortical actin during exocytosis is regulated by the Rab27a effector JFC1/Slp1 and the RhoA-GTPase-activating protein Gem-interacting protein. Mol Biol Cell. 2012;23(10):1902-16.
  30. Wang X, et al. N6-methyladenosine-dependent regulation of messenger RNA stability. Nature. 2014;505(7481):117-20.
  31. Boulias K, Greer EL. Biological roles of adenine methylation in RNA. Nat Rev Genet. 2023;24(3):143-60.
  32. Wu Y, et al. Mettl3-mediated m(6)A RNA methylation regulates the fate of bone marrow mesenchymal stem cells and osteoporosis. Nat Commun. 2018;9(1):4772. doi: 10.1038/s41467-018-06898-4.
  33. Chen RX, et al. N(6)-methyladenosine modification of circNSUN2 facilitates cytoplasmic export and stabilizes HMGA2 to promote colorectal liver metastasis. Nat Commun. 2019;10(1):4695. doi: 10.1038/s41467-019-12651-2.
  34. Wu X, et al. Caffeic acid 3,4-dihydroxy-phenethyl ester suppresses receptor activator of NF-kappaB ligand-induced osteoclastogenesis and prevents ovariectomy-induced bone loss through inhibition of mitogen-activated protein kinase/activator protein 1 and Ca2+-nuclear factor of activated T-cells cytoplasmic 1 signaling pathways. J Bone Miner Res. 2012;27(6):1298-308.
  35. Luo J, et al. Regulation of bone formation and remodeling by G-protein-coupled receptor 48. Development. 2009;136(16):2747-56.
  36. Jing H, et al. Epigenetic inhibition of Wnt pathway suppresses osteogenic differentiation of BMSCs during osteoporosis. Cell Death Dis. 2018;9(2):176. doi: 10.1038/s41419-017-0231-0.
  37. Yang C, et al. TET2 regulates osteoclastogenesis by modulating autophagy in OVX-induced bone loss. Autophagy. 2022;18(12):2817-29.
  38. Blumer MJ, et al. Role of tartrate-resistant acid phosphatase (TRAP) in long bone development. Mech Dev. 2012;129(5-8):162-76.
  39. Sakai E, et al. Suppression of RANKL-dependent heme oxygenase-1 is required for high mobility group box 1 release and osteoclastogenesis. J Cell Biochem. 2012;113(2):486-98.
  40. Roberts BC, et al. PTH(1-34) treatment and/or mechanical loading have different osteogenic effects on the trabecular and cortical bone in the ovariectomized C57BL/6 mouse. Sci Rep. 2020;10(1):8889. doi: 10.1038/s41598-020-65921-1.
  41. Roundtree IA, et al. YTHDC1 mediates nuclear export of N(6)-methyladenosine methylated mRNAs. Elife. 2017;6. doi: 10.7554/eLife.31311.
  42. Flick LM, et al. Effects of receptor activator of NFkappaB (RANK) signaling blockade on fracture healing. J Orthop Res. 2003;21(4):676-84.
  43. Takeyama K, Chatani M, Takano Y, Kudo A. In-vivo. imaging of the fracture healing in medaka revealed two types of osteoclasts before and after the callus formation by osteoblasts. Dev Biol. 2014;394(2):292-304.
  44. Yamada H, et al. Effects of 16-month treatment with the cathepsin K inhibitor ONO-5334 on bone markers, mineral density, strength and histomorphometry in ovariectomized cynomolgus monkeys. Bone. 2016;86:43-52.
  45. McClung MR, et al. Odanacatib for the treatment of postmenopausal osteoporosis: results of the LOFT multicentre, randomised, double-blind, placebo-controlled trial and LOFT Extension study. Lancet Diabetes Endocrinol. 2019;7(12):899-911.
  46. Tao R, et al. Advances in immune mechanisms and developing immune-targeted therapies for osteoporosis: A systematic review. Pharmacol Res. 2025;218:107835. doi: 10.1016/j.phrs.2025.107835.
  47. Qi Z, Luo J, Xiao Z, Yang D. Functional roles of immune cells in osteoporosis. Front Immunol. 2025;16:1698283. doi: 10.3389/fimmu.2025.1698283.
  48. Krzewski K, Cullinane AR. Evidence for defective Rab GTPase-dependent cargo traffic in immune disorders. Exp Cell Res. 2013;319(15):2360-7.
  49. Adnani L, et al. Immune cell infiltration into brain tumor microenvironment is mediated by Rab27-regulated vascular wall integrity. Sci Adv. 2025;11(21):eadr6940. doi: 10.1126/sciadv.adr6940.
  50. Brauer N, et al. Immunodeficiency with susceptibility to lymphoma with complex genotype affecting energy metabolism (FBP1, ACAD9) and vesicle trafficking (RAB27A). Front Immunol. 2023;14:1151166. doi: 10.3389/fimmu.2023.1151166.
  51. Ramadass M, Catz SD. Molecular mechanisms regulating secretory organelles and endosomes in neutrophils and their implications for inflammation. Immunol Rev. 2016;273(1):249-65.
  52. Menasche G, et al. Mutations in RAB27A cause Griscelli syndrome associated with haemophagocytic syndrome. Nat Genet. 2000;25(2):173-6.
  53. Prashar A, Schnettger L, Bernard EM, Gutierrez MG. Rab GTPases in Immunity and Inflammation. Front Cell Infect Microbiol. 2017;7:435. doi: 10.3389/fcimb.2017.00435.
  54. Stinchcombe JC, et al. Rab27a is required for regulated secretion in cytotoxic T lymphocytes. J Cell Biol. 2001;152(4):825-34.
  55. Catz SD. The role of Rab27a in the regulation of neutrophil function. Cell Microbiol. 2014;16(9):1301-10.

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Tags

Bone Marrow MacrophagesTRAP StainingWestern BlotYTHDC1IGF2BP2
Contact Us
Recommend to Library

Privacy

Terms of Use

Policies

Copyright © 2026 MyJoVE Corporation. All rights reserved.