YTHDC1 promotes the cytoplasmic export of m6A-modified Rab27A, whereas IGF2BP2 stabilizes Rab27A in the cytoplasm, thereby enhancing osteoclast differentiation and contributing to osteoporosis.
Research Article
* These authors contributed equally
YTHDC1 promotes the cytoplasmic export of m6A-modified Rab27A, whereas IGF2BP2 stabilizes Rab27A in the cytoplasm, thereby enhancing osteoclast differentiation and contributing to osteoporosis.
The development of novel therapies for osteoporosis has attracted increasing attention. Rab27A is upregulated during osteoclast differentiation, and N6-methyladenosine (m6A) modification has emerged as an important epigenetic regulator in orthopedic diseases. Bioinformatic analyses predicted that Rab27A contains multiple m6A modification sites and interacts with several m6A-associated proteins. Knockdown experiments were performed to evaluate the role of Rab27A in osteoclast differentiation and osteoporosis using an ovariectomized (OVX) mouse model. Rab27A depletion attenuated osteoporosis and increased the bone formation percentage from 14.73% to 28.13% (P < 0.05) in OVX mice. Western blotting and quantitative PCR demonstrated that Rab27A knockdown reduced the protein and mRNA expression of the osteoclast markers TRAP, NFATc1, and c-FOS, thereby suppressing osteoclast differentiation of bone marrow-derived macrophages (BMMs) induced by macrophage colony-stimulating factor (M-CSF) and receptor activator of nuclear factor-κB ligand (RANKL). TRAP staining further showed that Rab27A depletion significantly reduced TRAP activity from 24.1% to 12.9% (P < 0.01) following M-CSF and RANKL induction. RNA immunoprecipitation assays confirmed interactions between Rab27A and the m6A reader proteins YTHDC1 and IGF2BP2. Nuclear and cytoplasmic fractionation demonstrated that YTHDC1 facilitates the cytoplasmic export of m6A-modified Rab27A. In addition, q-PCR and western blot analyses showed that knockdown of either YTHDC1 or IGF2BP2 reduced Rab27A expression and decreased the expression of TRAP, NFATc1, and c-FOS, thereby suppressing osteoclast differentiation induced by M-CSF and RANKL. Collectively, these findings indicate that YTHDC1-mediated cytoplasmic export and IGF2BP2-mediated stabilization of m6A-modified Rab27A promote osteoclast differentiation and contribute to bone loss in the OVX mouse model.
Osteoporosis (OP) is a common skeletal disorder characterized by deterioration of bone microarchitecture and reduced bone mineral density, resulting in an increased risk of fractures worldwide1,2,3. Osteoporotic fractures occur most frequently in the forearm, humerus, hip, and spine and are particularly prevalent among older adults. These fractures substantially impair quality of life and impose considerable physical, psychological, and socioeconomic burdens on patients, their families, and healthcare systems3. Consequently, the prevention, management, and treatment of osteoporosis remain major clinical and public health priorities.
A variety of therapeutic strategies have been developed for osteoporosis and can generally be classified into two categories: bone-forming agents and anti-resorptive therapies4,5. Traditional anti-resorptive drugs include bisphosphonates, raloxifene, and strontium ranelate, whereas newer agents include denosumab, odanacatib, and saracatinib. Bone-forming therapies include parathyroid hormone (PTH 1–84), while several additional candidates, such as MK-5442, AMG 785, and BHQ 880, are undergoing clinical development5. Although these treatments can be effective, many are associated with significant adverse effects, limited long-term efficacy, or restrictions on prolonged use4,6,7,8,9. For example, long-term administration of aminobisphosphonates and denosumab may impair normal bone remodeling5. Therefore, identifying safer and more effective therapeutic targets remains an important objective in osteoporosis research.
Rab proteins are key regulators of intracellular vesicle trafficking and cell signaling and participate in diverse biological processes, including viral infection, autophagy, and cytoskeletal organization10. In recent years, increasing attention has been directed toward the roles of Rab family proteins in bone metabolism and osteoporosis. Rab44 has been reported to regulate osteoclast differentiation by modulating intracellular Ca2⁺ signaling and activating nuclear factor of activated T cells 1 (NFATc1) in receptor activator of nuclear factor-κB ligand (RANKL)-treated macrophages11. Osteoclasts are multinucleated cells derived from macrophage lineage precursors and play essential roles in bone resorption and skeletal homeostasis12,13,14,15,16,17,18,19. Therefore, understanding the molecular mechanisms governing osteoclast differentiation is critical for developing novel therapeutic approaches for osteoporosis.
Rab27A is an important member of the Rab GTPase family and is widely expressed in secretory and immune cells. It plays pivotal roles in vesicle transport, exocytosis, and intracellular signaling20,21,22,23,24,25,26,27. Previous studies have demonstrated that Rab27A regulates eosinophil degranulation during airway inflammation and controls vesicular mobilization associated with NADPH oxidase activity in activated macrophages20.23. Notably, accumulating evidence indicates that Rab27A expression is significantly upregulated during osteoclast differentiation. Shimada-Sugawara et al. reported that Rab27A expression increases during the differentiation of bone marrow-derived macrophages (BMMs) into osteoclasts, suggesting a potential role in osteoclastogenesis28. Collectively, these findings suggest that Rab27A may influence osteoclast formation and function by regulating vesicular trafficking and intracellular signaling pathways28,29.
N6-methyladenosine (m6A) is the most abundant internal RNA modification in eukaryotic messenger RNAs and non-coding RNAs and serves as a critical regulator of RNA metabolism and gene expression. As the first identified mRNA modification in mammals, m6A has been implicated in numerous biological processes, including RNA stability, splicing, transport, and translation. Wang et al. demonstrated that m6A modifications, commonly occurring within conserved sequence motifs, are recognized by YTH domain-containing proteins and contribute to the regulation of mRNA stability and metabolism30. Furthermore, m6A modification has been implicated in diverse biological functions, including genome stability, transcriptional regulation, chromatin organization, cancer progression, and immune responses31. Recent studies have also highlighted important roles for m6A signaling in bone-related diseases and osteoporosis32.
Among m6A reader proteins, YTHDC1 functions as a nuclear reader that regulates RNA processing and nuclear export, whereas insulin-like growth factor 2 mRNA-binding protein 2 (IGF2BP2) stabilizes m6A-modified transcripts in the cytoplasm. Chen et al. demonstrated that YTHDC1 promotes the nuclear export of m6A-modified circNSUN2, which subsequently interacts with IGF2BP2 to stabilize HMGA2 mRNA and promote colorectal cancer metastasis33. These findings suggest that coordinated regulation by YTHDC1 and IGF2BP2 may represent a general mechanism controlling the fate of m6A-modified transcripts.
The present study investigated predicted m6A modification sites within Rab27A mRNA and examined its interactions with YTHDC1 and IGF2BP2. YTHDC1 was found to facilitate the nuclear export of m6A-modified Rab27A transcripts, whereas IGF2BP2 interacted with Rab27A in the cytoplasm and enhanced its stability. Through this regulatory mechanism, Rab27A promoted osteoclast differentiation and contributed to the progression of osteoporosis. Collectively, the findings identify a previously unrecognized m6A-dependent regulatory pathway involving YTHDC1, IGF2BP2, and Rab27A in osteoclast differentiation. These results provide new insights into the molecular pathogenesis of osteoporosis and may facilitate the development of novel therapeutic strategies targeting m6A-mediated regulation of Rab27A.
All animal procedures were approved by the Animal Protection and Utilization Committee of the Affiliated Hospital of Southwest Medical University (Approval No. 2024-Ethics-042). All experiments were conducted in accordance with the ARRIVE guidelines, the U.K. Animals (Scientific Procedures) Act 1986 and associated guidelines, EU Directive 2010/63/EU, and the National Institutes of Health Guide for the Care and Use of Laboratory Animals (NIH Publication No. 8023, revised 1978). Mice were randomly assigned to experimental groups, and the allocation sequence was concealed from the investigator. All data acquisition and analyses, including histological evaluation, micro-computed tomography (micro-CT) image analysis, and statistical analyses, were performed by investigators blinded to group allocation. No animals or samples were excluded from the analyses. All reagents, equipment, software, and other resources used in this protocol are listed in the Table of Materials.
1. Construction of the Ovariectomy (OVX) model
Twenty-four female wild-type C57BL/6 mice aged 8 weeks were used to establish an osteoporosis model. Following a 1-week acclimatization period, mice were randomly assigned to either the Sham or OVX group. The OVX model was established by bilateral ovariectomy as previously described34,35. Sham-operated mice underwent surgical exposure of the ovaries without removal.
For intra-femoral gene delivery, lentiviral vectors expressing sh-Rab27A or sh-NC were injected 7 days after OVX surgery as previously reported36,37. Briefly, concentrated lentiviral particles (1 × 106 transducing units/mL) were injected into the femur through the patellar route using a 22-gauge needle under anesthesia. Each mouse received 20 µL of lentiviral suspension. The incision was subsequently sutured, and the animals were monitored throughout recovery.
All animal experiments were performed under specific pathogen-free conditions. Femoral specimens were collected 8 weeks after surgery. At least six mice per group were used for histological analyses and RNA or protein extraction.
2. In-vivo micro-CT imaging
Micro-computed tomography (micro-CT) was performed to evaluate trabecular bone morphology. The right tibia of each mouse was scanned in vivo before OVX surgery at 14 weeks of age. Follow-up scans were performed weekly until 22 weeks of age. At least six mice per group were included in the micro-CT analysis.
Mice were anesthetized with intraperitoneal sodium pentobarbital (50 mg/kg body weight). Adequate anesthesia was confirmed by the absence of the toe-pinch reflex and by continuous monitoring of respiratory rate, and it was maintained throughout the imaging procedure. All euthanasia procedures were conducted in accordance with the approved animal protocol, institutional animal welfare guidelines, and national regulations for laboratory animal euthanasia.
At 24 weeks of age, mice were euthanized by cervical dislocation following deep anesthesia, and both tibiae were harvested for ex vivo scanning using the same imaging protocol. Scanning parameters included a voxel size of 10.4 µm, a voltage of 55 kV, a current of 145 µA, a field of view of 32 mm, 1500/750 samples per projection, and an integration time of 100 ms.
Images were processed using a third-order polynomial beam-hardening correction algorithm calibrated against a 1200 mg HA/cm3 phantom. Bone volume fraction (BV/TV), trabecular thickness (Tb.Th), and trabecular number (Tb.N) were quantified in the distal femoral metaphysis located 1.0 mm proximal to the growth plate.
3. Plasmid transfection
sh-Rab27A and sh-NC plasmids were generated and used for lentivirus production. Lentiviral packaging plasmids and shRNA constructs were co-transfected into HEK293T cells according to the manufacturer's instructions. Viral titers were determined before intra-femoral administration as previously described36. Three independent biological replicates were performed.
4. Hematoxylin and eosin (HE) staining
Femoral specimens were fixed in 4% paraformaldehyde for 24 h, decalcified in 10% EDTA for 4 weeks, cryoprotected in 30% sucrose/PBS, embedded in paraffin, and sectioned at a thickness of 5 µm. Tissue sections were stained with hematoxylin and eosin and examined using a light microscope. At least six mice per group were analyzed.
5. Tartrate-resistant acid phosphatase (TRAP) staining
TRAP staining of femoral sections was performed according to the manufacturer's instructions38. TRAP activity in bone marrow-derived macrophages (BMMs) was evaluated using a TRAP staining assay. Mature osteoclasts were defined as TRAP-positive multinucleated cells containing at least three nuclei. Three independent biological replicates were performed, each with three technical replicates.
6. q-PCR
Total RNA was isolated using TRIzol reagent according to the manufacturer's instructions. Complementary DNA was synthesized using reverse transcriptase and subjected to quantitative real-time PCR using SYBR Green chemistry. Three independent biological replicates were performed, each with three technical replicates.
Primer sequences were as follows:
Rab27A: F, TTCCTGCTTCTGTTCGACCT; R, GGCAGCACTGGTTTCAAAAT
TRAP: F, TGTTGACAGCGGTCCATCTA; R, CCTCCTTCTTAACCCGAAGC
NFATc1: F, GGTGCTGTCTGGCCATAACT; R, GCGGAAAGGTGGTATCTCAA
c-FOS: F, TACTACCATTCCCCAGCCGA; R, GCTGTCACCGTGGGGATAAA
YTHDC1: F, GAAGTGGAAGCTCTGCATCAG; R, TTGATCTTTTCGGACAGCACG
IGF2BP2: F, GACTACCCCGACCAGAACTG; R, GAGGCGGGATGTTCCGAATC
β-actin: F, GGGAAATCGTGCGTGACATTAAG; R, TGTGTTGGCGTACAGGTCTTTG
7. Western blotting
Cells or tissues were lysed using RIPA buffer supplemented with protease inhibitors. Protein concentrations were determined using a Bradford assay. Equal amounts of protein (20 µg) were separated by SDS-PAGE and transferred to polyvinylidene fluoride (PVDF) or nitrocellulose membranes. Membranes were blocked with 5% non-fat milk for 1 h at room temperature and incubated overnight at 4 °C with primary antibodies against TRAP, NFATc1, c-FOS, Rab27A, YTHDC1, IGF2BP2, or β-actin. After washing, membranes were incubated with the appropriate secondary antibodies for 1 h at room temperature. Protein bands were visualized using standard detection procedures. Three independent biological replicates were performed.
8. Cell culture
Bone marrow-derived macrophages (BMMs) were isolated as previously described39. Bone marrow cells harvested from mouse femurs were cultured overnight in α-minimum essential medium supplemented with 10% fetal bovine serum, 30 ng/mL macrophage colony-stimulating factor (M-CSF), and 1% penicillin/streptomycin at 37 °C in a humidified atmosphere containing 5% CO₂. Non-adherent cells were collected and cultured in a stromal cell-free system containing 30 ng/mL M-CSF. After 3 days, adherent cells were harvested as BMMs and further cultured in the presence of 30 ng/mL M-CSF and 50 ng/mL receptor activator of nuclear factor-κB ligand (RANKL) for 72 h to induce osteoclast differentiation.
9. RNA interference (RNAi)
Small interfering RNAs (siRNAs) were synthesized and transfected using a lipid-based transfection reagent according to the manufacturer's instructions. Cells were seeded at a density of 2 × 104 cells per well in six-well plates before transfection. Three independent biological replicates were performed.
Target sequences were as follows:
si-Rab27A: GGACUUAAUCAUCTAAGAGAAUGGAA
si-YTHDC1: GCAAGGAGUGUUAUCUUAATT
si-IGF2BP2: CCGUUAACCAACAAGCCAATT
10. Immunofluorescence
Cells were fixed with 4% paraformaldehyde for 20 min and permeabilized with 0.1% Triton X-100 for 10 min. Following blocking with 5% bovine serum albumin for 30 min, cells were incubated with primary antibodies overnight at 4 °C.
After washing, fluorophore-conjugated secondary antibodies were applied for 30 min at room temperature. Nuclei were counterstained with DAPI, and images were acquired using confocal microscopy. Three independent biological replicates were performed.
11. Nuclear and cytoplasmic separation
Nuclear and cytoplasmic fractions were isolated according to the manufacturer's instructions. Cells were lysed on ice for 10 min and centrifuged at 500 × g for 3 min at 4 °C. The supernatant containing cytoplasmic components was collected, whereas the pellet containing nuclei was washed and processed separately.
12. RNA-binding protein immunoprecipitation (RIP)
RNA immunoprecipitation (RIP) assays were performed according to the manufacturer's instructions. Briefly, cells were lysed on ice for 30 min. After centrifugation, the supernatants were incubated overnight with antibodies and Protein A/G agarose beads. Following washing, immunoprecipitated proteins were analyzed by western blotting, and co-immunoprecipitated RNA was analyzed by quantitative real-time PCR. Three independent biological replicates were performed.
13. Rab27A mRNA stability assay
Total RNA was extracted at the indicated time points following IGF2BP2 knockdown. Reverse transcription and quantitative real-time PCR were subsequently performed. Rab27A mRNA levels were normalized to the corresponding si-NC group at 0 h. Three independent biological replicates were performed.
14. Statistical analysis
All experiments were independently performed using at least three biological replicates. For q-PCR, RNA interference, TRAP staining, western blotting, and other cell-based assays, each biological replicate included three technical replicates unless otherwise specified. Data are presented as the mean ± standard deviation (SD).
Statistical analyses were performed using GraphPad Prism version 9.0 and SPSS software. Comparisons between two groups were conducted using a two-tailed Student's t-test. Comparisons among multiple groups were analyzed using two-way analysis of variance (ANOVA) followed by Tukey's multiple-comparison post hoc test to adjust for multiple comparisons. A P value < 0.05 was considered statistically significant.
Knockdown of Rab27A reduced osteoporosis in vivo.
To investigate the role of Rab27A in osteoporosis, Rab27A knockdown was performed in an ovariectomized (OVX) mouse model established using previously reported methods34,40. The overall study design is summarized in Figure 1. Micro-computed tomography analysis demonstrated that bone mineral density, bone volume fraction (BV/TV), trabecular thickness (Tb.Th), and trabecular number (Tb.N) were significantly reduced in OVX mice compared with Sham controls (Figure 2A). These findings confirmed the successful establishment of the osteoporosis model. Rab27A knockdown significantly restored all measured bone structural parameters, indicating attenuation of OVX-induced bone loss and microarchitectural deterioration (Figure 2A).
Histological examination further supported these findings. Hematoxylin and eosin staining revealed marked trabecular bone loss and disruption of trabecular architecture in OVX mice compared with the Sham group (Figure 2B). In contrast, Rab27A depletion alleviated trabecular deterioration and partially restored bone morphology (Figure 2B). Since Rab27A has been implicated in osteoclast differentiation28, osteoclast activity was evaluated by tartrate-resistant acid phosphatase (TRAP) staining. TRAP activity was markedly elevated in OVX mice relative to Sham controls and was significantly reduced following Rab27A knockdown (Figure 2C).
Expression of osteoclast-associated markers was subsequently examined. Western blot analysis demonstrated that Rab27A, TRAP, NFATc1, and c-FOS protein levels were significantly increased in OVX mice and were reduced following Rab27A depletion (Figure 2D). Consistent results were obtained at the transcriptional level, with quantitative real-time PCR (q-PCR) demonstrating similar expression patterns for Rab27A, TRAP, NFATc1, and c-FOS mRNA expression (Figure 2E).

Figure 1: Schematic overview of the experimental design and proposed regulatory mechanism underlying YTHDC1- and IGF2BP2-mediated regulation of m6A-modified Rab27A during osteoclast differentiation and osteoporosis progression. An ovariectomized (OVX) mouse model and receptor activator of nuclear factor-κB ligand (RANKL)/macrophage colony-stimulating factor (M-CSF)-induced osteoclast differentiation model were used to investigate the role of Rab27A in osteoclastogenesis. Rab27A knockdown, nuclear and cytoplasmic fractionation, and RNA immunoprecipitation assays were performed to evaluate osteoclast differentiation markers (TRAP, NFATc1, and c-FOS), Rab27A expression, and subcellular localization. YTHDC1 facilitated the cytoplasmic export of m6A-modified Rab27A, whereas IGF2BP2 stabilized Rab27A in the cytoplasm. Together, these coordinated regulatory mechanisms promoted osteoclast differentiation and contributed to bone loss in the OVX model. Please click here to view a larger version of this figure.

Figure 2: Knockdown of Rab27A reduced osteoporosis in vivo. (A) Trabecular bone morphometric analysis. Bone mineral density, bone volume fraction (BV/TV), trabecular thickness (Tb.Th), and trabecular number (Tb.N) were quantified. **P < 0.01, ***P < 0.001. (B) Histological assessment of femoral trabecular bone following Rab27A depletion. Hematoxylin and eosin (HE) staining was performed to evaluate structural changes in the distal femur. OVX and OVX + sh-NC groups served as controls. Scale bar = 50 µm. ***P < 0.001. (C) TRAP staining of femoral sections. TRAP activity was evaluated to assess osteoclast activity. OVX and OVX + sh-NC groups served as controls. Scale bar = 50 µm. ***P < 0.001. (D–E) Expression of Rab27A, TRAP, NFATc1, and c-FOS following Rab27A depletion. Protein expression was determined by western blotting (D), and mRNA expression was determined by q-PCR (E). β-actin served as the loading control. **P < 0.01, ***P < 0.001. The Sham group underwent surgical exposure of the ovaries without ovariectomy, whereas the OVX group underwent bilateral ovariectomy. sh-NC, negative control short hairpin RNA. Six mice were included in each experimental group. Data are presented as mean ± SD. Please click here to view a larger version of this figure.
Knockdown of Rab27A suppressed osteoclast differentiation of BMMs induced by M-CSF and RANKL
To further evaluate the role of Rab27A during osteoclastogenesis, bone marrow-derived macrophages (BMMs) were stimulated with macrophage colony-stimulating factor (M-CSF) and receptor activator of nuclear factor-κB ligand (RANKL) to induce osteoclast differentiation28.
Quantitative real-time PCR and western blot analyses demonstrated that M-CSF and RANKL stimulation significantly increased Rab27A mRNA and protein expression, whereas transfection with si-Rab27A effectively reduced Rab27A expression (Figure 3A, B). TRAP staining demonstrated a marked increase in osteoclast activity following M-CSF and RANKL treatment. Rab27A knockdown significantly reduced TRAP activity compared with the induced group (Figure 3C).
Expression of osteoclast differentiation markers was subsequently examined. Quantitative real-time PCR analysis demonstrated that TRAP, NFATc1, and c-FOS mRNA levels were significantly increased following osteoclast induction and were reduced by Rab27A depletion (Figure 3D). Similar results were observed at the protein level by western blotting (Figure 3E).

Figure 3: Knockdown of Rab27A suppressed osteoclast differentiation of bone marrow-derived macrophages (BMMs) induced by M-CSF and RANKL. (A–B) Expression of Rab27A following osteoclast induction. Rab27A mRNA (A) and protein (B) levels were determined by q-PCR and western blotting, respectively. β-actin served as the loading control. ***P < 0.001. (C) TRAP staining of BMM-derived osteoclasts. Increased TRAP activity induced by M-CSF and RANKL was suppressed following Rab27A knockdown. Scale bar = 50 µm. ***P < 0.001. (D–E) Expression of osteoclast differentiation markers following Rab27A depletion. TRAP, NFATc1, and c-FOS mRNA levels were determined by q-PCR (D), and protein levels were determined by western blotting (E). β-actin served as the loading control. **P < 0.01, ***P < 0.001. Control, untreated cells; si-NC, negative control siRNA. Three independent biological replicates were performed. Data are presented as mean ± SD. Please click here to view a larger version of this figure.
Cytoplasmic export of m6A-modified Rab27A was facilitated by YTHDC1
To investigate the potential involvement of m6A modification in Rab27A regulation, bioinformatic analyses were performed. Multiple predicted m6A modification sites were identified within the Rab27A transcript (Figure 4A). In addition, interaction prediction analysis suggested potential associations between Rab27A and the m6A reader proteins YTHDC1 and IGF2BP2 (Figure 4B).
To validate the interaction between YTHDC1 and Rab27A mRNA, RNA immunoprecipitation (RIP) assays were performed. Rab27A mRNA was significantly enriched in complexes immunoprecipitated with anti-YTHDC1 antibody compared with the immunoglobulin G (IgG) control (Figure 4C).
Because YTHDC1 functions as a nuclear m6A reader involved in RNA export41, nuclear and cytoplasmic fractionation assays were performed. YTHDC1 knockdown significantly increased nuclear retention of Rab27A mRNA while reducing its cytoplasmic abundance (Figure 4D).
The effect of YTHDC1 on Rab27A expression was further evaluated. Quantitative real-time PCR analysis demonstrated that YTHDC1 depletion reduced Rab27A mRNA expression (Figure 4E). Consistently, western blot analysis showed decreased Rab27A protein expression following YTHDC1 knockdown (Figure 4F).

Figure 4: Cytoplasmic export of m6A-modified Rab27A was facilitated by YTHDC1. (A) Predicted m6A modification sites within Rab27A identified using the SRAMP prediction tool. (B) Predicted interactions between Rab27A and the m6A reader proteins YTHDC1 and IGF2BP2 identified using StarBase. (C) RNA immunoprecipitation (RIP) assay demonstrating the interaction between YTHDC1 and Rab27A mRNA. **P < 0.01. IgG served as the negative control. Rab27A enrichment was normalized to the percentage input. The YTHDC1 immunoblot band reflects immunoprecipitation efficiency. (D) Nuclear and cytoplasmic fractionation analysis demonstrating increased nuclear retention of Rab27A following YTHDC1 knockdown. **P < 0.01, ***P < 0.001. (E–F) Expression of YTHDC1 and Rab27A following YTHDC1 knockdown. mRNA expression was determined by q-PCR (E), and protein expression was determined by western blotting (F). β-actin served as the loading control. **P < 0.01. si-NC, negative control siRNA. Three independent biological replicates were performed. Data are presented as mean ± SD. Please click here to view a larger version of this figure.
Stabilization of Rab27A through interaction with IGF2BP2
The interaction between IGF2BP2 and Rab27A was investigated using RIP assays. Rab27A mRNA was significantly enriched in complexes immunoprecipitated with anti-IGF2BP2 antibody compared with the IgG control, indicating an association between IGF2BP2 and Rab27A mRNA (Figure 5A).
Immunofluorescence analysis demonstrated co-localization of IGF2BP2 and Rab27A predominantly within the cytoplasm (Figure 5B). To determine the functional effect of IGF2BP2 on Rab27A expression, IGF2BP2 was silenced using siRNA. Quantitative real-time PCR analysis revealed a significant reduction in Rab27A mRNA levels following IGF2BP2 depletion (Figure 5C). Consistent with these findings, western blot analysis showed decreased Rab27A protein expression following IGF2BP2 knockdown (Figure 5D).
The effect of IGF2BP2 on Rab27A mRNA stability was subsequently evaluated. IGF2BP2 depletion significantly shortened the half-life of Rab27A mRNA and reduced transcript stability (Figure 5E).

Figure 5: Stabilization of Rab27A through interaction with IGF2BP2. (A) RNA immunoprecipitation assay demonstrating the association between IGF2BP2 and Rab27A mRNA. IgG served as the negative control. Rab27A enrichment was normalized to the percentage input. ***P < 0.001. (B) Immunofluorescence analysis demonstrating co-localization of Rab27A and IGF2BP2 in the cytoplasm. Nuclei were counterstained with DAPI. Scale bar = 20 µm. (C–D) Downregulation of Rab27A following IGF2BP2 depletion. Rab27A mRNA levels were determined by q-PCR (C), and protein levels were determined by western blotting (D). β-actin served as the loading control. **P < 0.01, ***P < 0.001. (E) Rab27A mRNA stability following IGF2BP2 knockdown. Rab27A mRNA levels were normalized to the corresponding si-NC group at 0 h. **P < 0.01. si-NC, negative control siRNA. Three independent biological replicates were performed. Data are presented as mean ± SD. Please click here to view a larger version of this figure.
Silencing of YTHDC1 or IGF2BP2 suppressed osteoclast differentiation of BMMs induced by M-CSF and RANKL
To further investigate the functional relationship among YTHDC1, IGF2BP2, and Rab27A during osteoclast differentiation, knockdown experiments were performed in BMMs.
M-CSF and RANKL stimulation significantly increased the mRNA expression of Rab27A, YTHDC1, and IGF2BP2 (Figure 6A). Correspondingly, protein expression of these molecules was also elevated following osteoclast induction (Figure 6B). Silencing either YTHDC1 or IGF2BP2 significantly reduced Rab27A expression, whereas knockdown of one regulator did not substantially affect the expression of the other.
TRAP staining demonstrated that depletion of YTHDC1 or IGF2BP2 significantly suppressed osteoclast activity induced by M-CSF and RANKL (Figure 6C). Furthermore, quantitative real-time PCR analysis revealed reduced expression of TRAP, NFATc1, and c-FOS following YTHDC1 or IGF2BP2 knockdown (Figure 6D). Western blot analysis confirmed corresponding reductions at the protein level (Figure 6E).
Collectively, these findings indicate that YTHDC1 and IGF2BP2 promote osteoclast differentiation through regulation of Rab27A expression.

Figure 6: Silencing of YTHDC1 or IGF2BP2 suppressed osteoclast differentiation of BMMs induced by M-CSF and RANKL. (A–B) Expression of Rab27A following YTHDC1 or IGF2BP2 knockdown. Rab27A mRNA (A) and protein (B) levels were determined by q-PCR and western blotting, respectively. β-actin served as the loading control. ***P < 0.001. (C) TRAP staining demonstrating suppression of osteoclast activity following YTHDC1 or IGF2BP2 depletion. Scale bar = 50 µm. **P < 0.01, ***P < 0.001. (D–E) Expression of osteoclast differentiation markers following YTHDC1 or IGF2BP2 depletion. TRAP, NFATc1, and c-FOS mRNA levels were determined by q-PCR (D), and protein levels were determined by western blotting (E). β-actin served as the loading control. *P < 0.05, **P < 0.01, ***P < 0.001. Control, untreated cells; si-NC, negative control siRNA. Three independent biological replicates were performed. Data are presented as mean ± SD. Please click here to view a larger version of this figure.
DATA AVAILABILITY:
The datasets used and/or analyzed during the current study (including western blot data, imaging datasets, quantitative analyses, and source files) during this study have been provided in Supplementary File 1.
Supplementary File 1: The datasets and raw data of this study. Please click here to download this file.
Osteoclast differentiation plays essential roles in bone remodeling, bone resorption, fracture repair, and skeletal homeostasis12˒15˒17˒18˒42˒43. Excessive osteoclast activity is a major contributor to osteoporosis, making the identification of regulatory pathways controlling osteoclast differentiation an important research objective. Several anti-resorptive therapies targeting osteoclast function have demonstrated clinical efficacy6,44,45. For example, denosumab has been associated with reduced fracture incidence and a favorable safety profile6, whereas the cathepsin K inhibitor ONO-5334 has shown beneficial effects on bone mineral density and bone strength in ovariectomized non-human primates44. The present study identified a previously unrecognized m6A-dependent regulatory mechanism involving YTHDC1, Rab27A, and IGF2BP2 that promotes osteoclast differentiation and the progression of osteoporosis. These findings provide new insights into the molecular regulation of osteoclastogenesis and suggest potential therapeutic targets for osteoporosis.
Rab27A has previously been implicated in osteoclast differentiation and bone resorption through regulation of vesicular trafficking and intracellular signaling and may also influence RANKL-induced signaling cascades through endosomal recycling of key receptors28,29. Consistent with these reports, Rab27A expression was markedly increased during osteoclast differentiation, whereas Rab27A depletion suppressed osteoclast differentiation in vitro and alleviated osteoporosis-associated bone loss in vivo. These findings support a critical role for Rab27A in osteoclast biology and further extend previous observations by demonstrating that Rab27A activity is regulated through m6A-dependent mechanisms. Collectively, the findings suggest that m6A-modified Rab27A may regulate these processes at the post-transcriptional level and consequently influence bone-resorptive activity.
Accumulating evidence indicates that m6A modification contributes to the development and progression of bone-related diseases32. Bioinformatic analyses identified multiple putative m6A modification sites within Rab27A mRNA (Figure 4A), and functional studies demonstrated that YTHDC1 and IGF2BP2 regulate Rab27A expression and osteoclast differentiation (Figures 4–6). These findings suggest that m6A modification is an important upstream regulatory mechanism controlling Rab27A function during osteoclastogenesis. Because multiple predicted m6A sites were identified within Rab27A, future studies should determine whether individual sites or combinations of sites are required for Rab27A regulation. Construction of m6A-deficient Rab27A mutants and subsequent rescue experiments would provide direct evidence for the functional importance of m6A modification in this pathway.
Mechanistically, the present study demonstrated that YTHDC1 interacts with Rab27A mRNA and facilitates its nuclear export. Following cytoplasmic translocation, IGF2BP2 directly associates with Rab27A mRNA and enhances transcript stability. Consequently, depletion of either YTHDC1 or IGF2BP2 reduced Rab27A expression and suppressed osteoclast differentiation. These findings support a model in which YTHDC1 and IGF2BP2 cooperate to maintain Rab27A expression by coordinating mRNA transport and stability. This regulatory mechanism expands the current understanding of m6A-mediated regulation of osteoclast differentiation and identifies multiple components of this pathway as potential therapeutic targets.
Several limitations should be acknowledged. First, although Rab27A has been shown to regulate osteoclast differentiation, its potential effects on osteoblast function have not been investigated. Because bone homeostasis depends on the balance between osteoclast-mediated bone resorption and osteoblast-mediated bone formation, future studies should evaluate whether Rab27A also influences osteoblast differentiation or activity. Second, the present study primarily relied on loss-of-function approaches. Complementary overexpression of Rab27A, YTHDC1, and IGF2BP2, together with rescue experiments using m6A-deficient Rab27A mutants, would further strengthen the proposed regulatory model. Third, although several putative m6A sites within Rab27A mRNA were predicted using bioinformatic approaches, the specific sites responsible for regulating Rab27A function remain unidentified and require experimental validation. Finally, additional studies are needed to determine whether other m6A reader proteins, RNA-binding proteins, or signaling pathways participate in Rab27A regulation during osteoclast differentiation.
Immune regulation has emerged as an important component of osteoporosis pathogenesis46,47. Rab27A has established functions in immune-cell secretion, cytotoxic granule release, neutrophil degranulation, and regulation of the tissue microenvironment48,49,50,51,52,53,54,55. Further investigation of the relationship between Rab27A, immune regulation, and bone homeostasis may provide additional insight into the pathogenesis of osteoporosis.
Future investigations should prioritize several key areas. First, systematic mutagenesis of the predicted m6A sites within Rab27A is required to identify the functional binding sites involved in YTHDC1- and IGF2BP2-mediated regulation. Second, overexpression of Rab27A, YTHDC1, and IGF2BP2, together with rescue experiments using m6A-deficient Rab27A mutants, will be essential to establish the direct contribution of the YTHDC1/Rab27A/IGF2BP2 regulatory axis. Third, validation of this pathway in additional osteoporosis models and evaluation of Rab27A function in osteoblasts will be important to further substantiate the present findings.
In conclusion, the present study identified a novel YTHDC1/Rab27A/IGF2BP2 regulatory axis that promotes osteoclast differentiation and the progression of osteoporosis. YTHDC1 facilitated the nuclear export of m6A-modified Rab27A mRNA, whereas IGF2BP2 enhanced Rab27A mRNA stability in the cytoplasm. These coordinated regulatory events increased Rab27A expression and promoted osteoclastogenesis. Collectively, the findings expand the current understanding of m6A-mediated regulation in osteoporosis and provide a foundation for developing therapeutic strategies targeting the YTHDC1/Rab27A/IGF2BP2 pathway.
The authors declare no competing financial interests or conflicts of interest.
This work was financially supported by The Scientific and Technological Strategic Cooperation Project between Pengzhou People’s Hospital and Southwest Medical University (Grant No. 2023PZXNYD01) to Lian Tang.
| Name | Company | Catalog Number | Comments |
|---|---|---|---|
| 4% Paraformaldehyde | Thermo Fisher Scientific | A5818101 | Tissue and cell fixation |
| Alexa Fluor 488 secondary antibody | Thermo Fisher Scientific | A-11001 | Fluorescent secondary antibody for immunofluorescence; RRID: AB_2534069 |
| Alexa Fluor 546 secondary antibody | Thermo Fisher Scientific | A-11035 | Fluorescent secondary antibody for immunofluorescence; RRID: AB_2534093 |
| Bovine serum albumin (BSA) | Merck | A2153 | Blocking reagent |
| Bradford Protein Assay | Merck | B6916 | Protein quantification |
| C57BL/6JSlac mice | Shanghai SLAC Laboratory Animal Co., Ltd. | — | Female, 8 weeks old; RRID: MGI:2159769 |
| c-FOS antibody | Abcam | ab222699 | Primary antibody for western blotting; RRID: AB_2891049 |
| Confocal laser scanning microscope (SP8) | Leica Microsystems | SP8 | Immunofluorescence image acquisition; RRID: SCR_018169 |
| DAPI | Thermo Fisher Scientific | D3571 | Nuclear counterstain for immunofluorescence; RRID: AB_2307445 |
| EDTA | Merck | V900081-500G | Tissue decalcification reagent |
| Eosin | Solarbio | G1100 | Histological cytoplasmic stain |
| Fetal bovine serum (FBS) | Thermo Fisher Scientific | A5669701 | Cell culture supplement |
| GraphPad Prism | GraphPad Software | Version 9.0 | Statistical analysis software; RRID: SCR_002798 |
| Hematoxylin | Cell Signaling Technology | #14166 | Histological nuclear stain |
| IBM SPSS Statistics | IBM | Windows version | Statistical analysis software; RRID: SCR_016479 |
| IGF2BP2 antibody | Proteintech | 11601-1-AP | Primary antibody for western blotting and immunofluorescence; RRID: AB_2122672 |
| Inverted light microscope (DMi8) | Leica Microsystems | DMi8 | Histological image acquisition; RRID: SCR_026672 |
| Lentiviral titer quantification kit | Takara Bio | 631235 | Lentiviral titer determination |
| Lipofectamine 3000 | Thermo Fisher Scientific | L3000015 | Plasmid transfection reagent |
| Lipofectamine RNAiMAX | Thermo Fisher Scientific | 13778150 | siRNA transfection reagent |
| M-CSF | MedChemExpress | HY-P7085 | Osteoclast differentiation factor |
| Micro-computed tomography system | Scanco Medical | VivaCT80 | Bone morphometric analysis |
| M-MLV Reverse Transcriptase | Promega | M1701 | cDNA synthesis |
| NFATc1 antibody | Santa Cruz Biotechnology | sc-7294 | Primary antibody for western blotting; RRID: AB_2152503 |
| PARIS Kit | Thermo Fisher Scientific | AM1556 | Nuclear and cytoplasmic fractionation |
| Penicillin/Streptomycin | Thermo Fisher Scientific | 15140122 | Antibiotic supplement for cell culture |
| Power SYBR Green Master Mix | Thermo Fisher Scientific | 4367659 | Quantitative real-time PCR |
| Protease inhibitor cocktail | Thermo Fisher Scientific | 78429 | Prevention of protein degradation |
| Protein A/G agarose beads | Merck | IP05 | Immunoprecipitation |
| PVDF membrane | Thermo Fisher Scientific | 88520 | Protein transfer membrane for western blotting |
| Rab27A antibody | Abcam | ab55667 | Primary antibody for western blotting and immunofluorescence; RRID: AB_945112 |
| RANKL | MedChemExpress | HY-P7425 | Osteoclast differentiation factor |
| Real-time PCR system | Applied Biosystems | ABI7900HT | Quantitative real-time PCR instrument |
| RIPA buffer | Thermo Fisher Scientific | 78501 | Protein extraction buffer |
| RNA Immunoprecipitation (RIP) Kit | Millipore | RIP-12RXN | RNA immunoprecipitation assay |
| SDS-PAGE reagents | Thermo Fisher Scientific | BT041210BOX | Protein electrophoresis |
| shRNA plasmids | RiboBio | — | Gene silencing by RNA interference |
| Small interfering RNAs (siRNAs) | GenePharma | — | Gene silencing by RNA interference |
| SRAMP | Online resource | — | Prediction of m6A modification sites; RRID: SCR_024500 |
| StarBase (ENCORI) | Online resource | — | RNA interaction prediction database; RRID: SCR_016303 |
| TRAP antibody | Abcam | ab2391 | Primary antibody for western blotting; RRID: AB_303034 |
| TRAP staining kit | Merck | 387A | Detection of osteoclast activity |
| Triton X-100 | Thermo Fisher Scientific | 85111 | Cell permeabilization reagent |
| TRIzol Reagent | Thermo Fisher Scientific | 15596026CN | Total RNA isolation |
| YTHDC1 antibody | Abcam | ab122340 | Primary antibody for western blotting; RRID: AB_11128253 |
| α-MEM | FUJIFILM Wako Pure Chemical Corporation | 139-15651 | Cell culture medium |
| β-Actin antibody | Merck | A5441 | Loading control for western blotting; RRID: AB_476744 |
Request permission to reuse the text or figures of this JoVE article
Request Permission