A subscription to JoVE is required to view this content. Sign in or start your free trial.

Research Article

LncRNA SLC12A9-AS1 Drives Malignant Progression in Colorectal Cancer by Regulating miR-139-3p

35 views

⸱

DOI:

10.3791/72546

⸱

August 21st, 2026

 ,  ,  ,  , 
1Department of Colorectal Anal Surgery, Hubei Clinical Research Center for Precision Prevention and Treatment of Gastrointestinal Cancer in Elderly People, Affiliated the Second People's Hospital, China Three Gorges University, The Second People's Hospital of Yichang

In This Article

Summary

This study investigated the function and regulatory mechanism of SLC12A9-AS1 in colorectal cancer cells. SLC12A9-AS1 knockdown suppressed malignant cellular phenotypes partly through miR-139-3p regulation, providing new experimental evidence for understanding colorectal cancer pathogenesis.

Abstract

This study investigated the function of long noncoding RNA SLC12A9-AS1 in colorectal cancer (CRC) cells and its potential regulatory mechanism. Reverse transcription–quantitative polymerase chain reaction (RT-qPCR) was used to measure SLC12A9-AS1 and miR-139-3p expression in CRC cell lines. Cell viability was assessed using the Cell Counting Kit-8 (CCK-8) assay, whereas migration and invasion were evaluated using permeable cell culture insert assays. The interaction between SLC12A9-AS1 and miR-139-3p was examined using dual-luciferase reporter (DLR) and RNA immunoprecipitation (RIP) assays. SLC12A9-AS1 was significantly upregulated, whereas miR-139-3p was downregulated, in CRC cells. Silencing SLC12A9-AS1 markedly reduced cell viability, migration, invasion, and epithelial–mesenchymal transition (EMT). The DLR and RIP assays supported an interaction between SLC12A9-AS1 and miR-139-3p. In addition, inhibition of miR-139-3p reversed the suppressive effects of SLC12A9-AS1 knockdown on malignant cellular phenotypes. Collectively, these findings indicate that SLC12A9-AS1 is abnormally overexpressed in CRC cells and that its knockdown attenuates malignant phenotypes, at least in part through regulation of miR-139-3p. These results provide new in vitro experimental evidence for understanding the molecular mechanisms involved in CRC pathogenesis.

Introduction

Colorectal cancer (CRC) is a highly prevalent malignancy1,2. Approximately 90% of CRC cases are adenocarcinomas originating from glandular epithelial cells in the colon or rectum3. CRC contributes substantially to the global cancer burden, ranking among the leading causes of cancer-related death and accounting for 9.2% of all cancer deaths worldwide4,5. Although considerable progress has been made in CRC treatment, including advances in surgical techniques, chemotherapy regimens, and targeted therapies, patient prognosis remains poor6,7. Therefore, identifying new therapeutic targets remains an important research priority.

Long noncoding RNAs (lncRNAs) are regulatory molecules longer than 200 nucleotides8. Although they do not encode proteins, they are involved in the development and progression of several malignancies, including CRC9,10,11. For example, STEAP3-AS1 regulates histone lactylation through chromatin remodeling and contributes to CRC progression12. SLC12A9-AS1 is an lncRNA whose functions remain incompletely understood. Previous studies have reported its abnormal expression in CRC tissues13. In addition, SLC12A9-AS1 may be coexpressed with genes included in a CRC bacterial response-associated prognostic model and may be associated with overall survival in patients with CRC14. Although database analyses, including analyses of The Cancer Genome Atlas cohort, suggest that SLC12A9-AS1 may be associated with CRC, its biological function and mechanism of action in CRC have not been experimentally characterized.

Abnormal microRNA (miRNA) expression is also closely associated with tumorigenesis15. In CRC, miR-139-3p expression has been associated with clinical stage and distant metastasis16 and may serve as a diagnostic biomarker17. In CRC cells, miR-139-3p also exerts tumor-suppressive effects by regulating downstream functional genes18. Bioinformatic predictions indicate potential binding sites between SLC12A9-AS1 and miR-139-3p. Because lncRNAs can participate in tumor progression by acting as miRNA sponges19, SLC12A9-AS1 may regulate CRC-related phenotypes through interaction with miR-139-3p. However, no experimental studies have directly validated an interaction between SLC12A9-AS1 and miRNAs, including miR-139-3p. Thus, the regulatory relationship between SLC12A9-AS1 and miR-139-3p in CRC remains unclear.

Based on this background, the present study tested the hypothesis that SLC12A9-AS1 regulates malignant phenotypes in CRC cells through miR-139-3p. The study aimed to characterize the biological function of SLC12A9-AS1 in CRC cells and determine its regulatory relationship with miR-139-3p.

Access restricted. Please log in or start a trial to view this content.

Protocol

This study used established human cell lines and publicly available database-derived data. No human participants, identifiable human data, vertebrate animals, or primary human or animal tissues were involved; therefore, institutional review board or animal care and use committee approval was not required. The reagents and the equipment used are listed in the Table of Materials.

1. Database analysis
Expression data for SLC12A9-AS1 and miR-139-3p in colorectal cancer (CRC) and normal tissues were obtained from the ENCORI and UALCAN databases. The LncBook 2.0 database was used to predict potential binding sites between SLC12A9-AS1 and miR-139-3p.

2. Cell culture
The HCT116 (RRID: CVCL_0291), HT-29 (RRID: CVCL_A8EZ), SW620 (RRID: CVCL_0547), SW480 (RRID: CVCL_0546), LoVo (RRID: CVCL_0399), and NCM460 (RRID: CVCL_0460) cell lines were used in this study. All cell lines were authenticated by short tandem repeat analysis and routinely tested for mycoplasma contamination using a commercial mycoplasma detection kit. Only mycoplasma-free cells were used in the experiments. NCM460 cells were cultured in Dulbecco’s modified Eagle medium, whereas the other cell lines were maintained in RPMI-1640 medium. All media were supplemented with 10% fetal bovine serum.

3. Cell transfection
Short hairpin RNAs, including sh-NC, sh-SLC12A9-AS1#1, and sh-SLC12A9-AS1#2, as well as miR-139-3p inhibitors and their corresponding negative controls, were obtained from a commercial supplier. Following the manufacturer’s instructions, the oligonucleotides and short hairpin RNA constructs were transfected into HT-29 and LoVo cells using a lipid-based transfection reagent. The final concentrations were 50 nM for the short hairpin RNA constructs and 100 nM for the miR-139-3p inhibitors. A total of 10 μL of transfection reagent was used. Cells were harvested 48 h after transfection.

4. Reverse transcription–quantitative polymerase chain reaction
Total cellular RNA was isolated using a phenol- and guanidinium-based RNA extraction reagent according to the manufacturer’s instructions. The isolated RNA was used to synthesize complementary DNA using a commercial reverse transcription kit. Reverse transcription–quantitative polymerase chain reaction (RT-qPCR) was performed using a SYBR Green-based quantitative PCR master mix or a commercial miRNA quantitative RT-PCR kit. GAPDH was used as the internal control for SLC12A9-AS1, E-cadherin, and N-cadherin, whereas U6 was used as the internal control for miR-139-3p.

The RT-qPCR cycling conditions were as follows: 95 °C for 5 s, followed by 40 cycles of 95 °C for 10 s and 60 °C for 30 s. Relative RNA expression was calculated using the 2−ΔΔCt method. The primer sequences are listed in Table 1.

TargetForward primer (5′–3′)Reverse primer (5′–3′)
SLC12A9-AS1AGATGGCGGCGACTATGATGGGACGCAACCGCAGAAAAAG
miR-139-3pTCACAGAGGTTGTCCCGGCTATGGTTGTTCACGACTCCTTCAC
E-cadherinATTTTTCCCTCGACACCCGATTCCCAGGCGTAGACCAAGA
N-cadherinAGCCAACCTTAACTGAGGAGTGGCAAGTTGATTGGAGGGATG
GAPDHCAGGAGGCATTGCTGATGATGAAGGCTGGGGCTCATTT
U6CTCGCTTCGGCAGCACAAACGCTTCACGAATTTGCGT

Table 1: Primer sequences used for RT-qPCR. The table lists the forward and reverse primer sequences used to measure the expression of SLC12A9-AS1, miR-139-3p, E-cadherin, N-cadherin, GAPDH, and U6.

5. Cell viability assay
Cell viability in HT-29 and LoVo cells under the different transfection conditions was assessed using a tetrazolium-based colorimetric assay. Cells were seeded in 96-well plates at a density of 5 × 103 cells per well. At 0, 24, 48, and 72 h after transfection, the cell viability reagent was added according to the manufacturer’s instructions. Absorbance at 450 nm was measured using a microplate reader.

6. Permeable cell culture insert migration and invasion assays
The migratory and invasive abilities of CRC cells were assessed using cell culture insert chambers. For the invasion assay, the chambers were precoated with a basement membrane matrix. CRC cells were resuspended in serum-free medium at a density of 5 × 104 cells per 100 μL and added to the upper chamber. A total of 600 μL of complete culture medium was added to the lower chamber.

After 24 h of incubation, nonmigrated or noninvaded cells remaining on the membrane's upper surface were gently removed. Cells attached to the lower surface of the membrane were fixed with methanol for 15 min and stained with 0.1% crystal violet solution for 20 min. The membranes were then rinsed thoroughly with phosphate-buffered saline to remove excess stain. The migrated or invaded cells were counted using image-analysis software.

7. Dual-luciferase reporter assay
The potential interaction site between SLC12A9-AS1 and miR-139-3p was identified using the LncBook 2.0 database. Based on this prediction, wild-type and mutant reporter vectors, designated SLC12A9-AS1-WT and SLC12A9-AS1-MUT, respectively, were constructed. The reporter plasmids were co-transfected with miR-139-3p mimics, miR-139-3p inhibitors, or the corresponding negative controls into cells. Luciferase activity was measured using a commercial dual-luciferase reporter assay. Firefly luciferase activity in each sample was normalized to Renilla luciferase activity.

8. RNA immunoprecipitation assay
Cell lysates containing 1 × 107 HT-29 or LoVo cells were incubated at 4 °C for 8 h with protein A/G agarose beads preconjugated with an anti-Ago2 antibody or a normal IgG control antibody. RNA immunoprecipitation was performed using a commercial assay kit according to the manufacturer’s instructions. The levels of coprecipitated RNA were measured by RT-qPCR.

9. Statistical analysis
Data were analyzed using statistical and graphing software. Comparisons between two groups were performed using Student’s t-test. Comparisons among multiple groups were performed using analysis of variance followed by Bonferroni correction. A value of P < 0.05 was considered statistically significant.

Access restricted. Please log in or start a trial to view this content.

Results

SLC12A9-AS1 is upregulated in CRC tissues and cell lines
Expression data from the ENCORI (Figure 1A) and UALCAN (Figure 1B) databases showed that SLC12A9-AS1 was significantly upregulated in CRC tissues. To assess its cellular expression, SLC12A9-AS1 was measured in multiple CRC cell lines. Compared with NCM460 cells, SLC12A9-AS1 expression was significantly increased in multiple CRC cell lines (P < 0.05, Figure 1C

Access restricted. Please log in or start a trial to view this content.

Discussion

CRC ranks among the three most common malignancies worldwide in terms of both incidence and mortality20. Because early-stage symptoms are often nonspecific, many patients are diagnosed at an advanced stage21,22. Even after surgical resection, the 5-year overall survival rate remains unfavorable23,24. Therefore, further investigation of the molecular mechanisms underlying CRC progression remains important....

Access restricted. Please log in or start a trial to view this content.

Disclosures

The authors declare that they have no conflicts of interest.

Acknowledgements

The authors received no external funding for this work. No additional acknowledgments apply.

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
HCT116 cellsInstitute of Biochemistry and Cell Biology, the Chinese Academy of SciencesSCSP-5076
HT-29 cellsInstitute of Biochemistry and Cell Biology, the Chinese Academy of SciencesSCSP-5032
SW620 cellsInstitute of Biochemistry and Cell Biology, the Chinese Academy of SciencesSCSP-5234
SW480 cellsInstitute of Biochemistry and Cell Biology, the Chinese Academy of SciencesSCSP-5033
LoVo cellsInstitute of Biochemistry and Cell Biology, the Chinese Academy of SciencesSCSP-514
NCM460 cellsProcell Life Science CL-0749
DMEM mediumGibco11965-092
RPMI-1640 mediumThermo Fisher Scientific11875093
FBSGibco10099141
Lipofectamine 3000Thermo Fisher ScientificL3000001
TRIzol ApplygenR1030
High Capacity cDNA Reverse Transcription KitThermo Fisher Scientific4368814
SYBR Premix Ex Taq kitTakaraRR420
miDETECT A Track miRNA qRT-PCR Starter KitRiboBioC10712
CCK-8 reagent BeyotimeC0039
Matrigel BD Biosciences356230
dual-Luciferase reporter gene assay kitBeyotimeRG027
EZ-Magna RIP Kit Millipore17-701
Transwell Permeable Supports Corning3422
Anti-Ago2 antibodyMillipore03-110
Normal mouse IgGMillipore12-371
Microplate Reader BioTekELx800
SPSSIBMVersion 20.0
GraphPad PrismGraphPad SoftwareVersion 8.0
ImageJNIHversion 1.34
ENCORIOnline databasehttps://rnasysu.com/encori/index.php
UALCANOnline databasehttp://ualcan.path.uab.edu/
LncBook 2.0Online databasehttps://bigd.big.ac.cn/lncbook/index

References

  1. Li J et al. Patient outcomes after non-curative endoscopic submucosal dissection for early colorectal cancer: a single-center, retrospective cohort study. Transl Cancer Res. 2021;10(12):5123-5132.
  2. Dekker E et al. Colorectal cancer. Lancet. 2019;394(10207):1467-1480.
  3. Keum N, Giovannucci E. Global burden of colorectal cancer: emerging trends, risk factors and prevention strategies. Nat Rev Gastroenterol Hepatol. 2019;16(12):713-732.
  4. Li J et al. Genetic and biological hallmarks of colorectal cancer. Genes Dev. 2021;35(11–12):787-820.
  5. Feng Y et al. Optimized Mouse Model to Induce Colitis-Associated Colon Cancer using Azoxymethane and Dextran Sulfate Sodium for Tumor Immunology and Therapy Studies. J Vis Exp. 2025;(221). doi: 10.3791/68351.
  6. Chang WL et al. Parecoxib and 5-Fluorouracil Synergistically Inhibit EMT and Subsequent Metastasis in Colorectal Cancer by Targeting PI3K/Akt/NF-κB Signaling. Biomedicines. 2024;12(7). doi: 10.3390/biomedicines12071526.
  7. Burki TK. Risk prediction equations for survival in colorectal cancer. Lancet Oncol. 2017;18(8):e437.
  8. Oh M, Lee BL, Somarowthu S. Decoding the lncRNA World: Comprehensive Approaches to lncRNA Structure and Interactome Studies. Cells. 2026;15(2). doi: 10.3390/cells15020105.
  9. Gao X et al. LINC01485 contributes to colorectal cancer progression by targeting miR-383-5p/KRT80 axis. Environ Toxicol. 2024;39(1):398-408.
  10. Boyapati HPN et al. Cracking the Code of Colorectal Cancer Screening: An Overview With a Focus on Current and Emerging Screening Methods. Cureus. 2025;17(5):e84724.
  11. Xu X, Lin L. Regulation of Epithelial-Mesenchymal Transition in Ovarian Cancer by LncRNA MALAT1 via SNAI2 and MiR-200c-3p. J Vis Exp. 2025;(222). doi: 10.3791/68653.
  12. Lv J et al. The LncRNA STEAP3-AS1 promotes liver metastasis in colorectal cancer by regulating histone lactylation through chromatin remodelling. J Exp Clin Cancer Res. 2025;44(1):205.
  13. Gong T et al. SNHG25 promotes colorectal cancer metastasis by regulating MMP2. Aging (Albany NY). 2023;15(19):10105-10116.
  14. Huang W et al. Identification of long noncoding RNAs biomarkers for diagnosis and prognosis in patients with colon adenocarcinoma. J Cell Biochem. 2019;120(3):4121-4131.
  15. Song C et al. MicroRNA-325-3p contributes to colorectal carcinoma by targeting cytokeratin 18. Oncol Lett. 2021;21(4):248.
  16. Chen WC et al. microRNA expression pattern and its alteration following celecoxib intervention in human colorectal cancer. Exp Ther Med. 2012;3(6):1039-1048.
  17. Liu W et al. Plasma Exosomal miRNA-139-3p is a Novel Biomarker of Colorectal Cancer. J Cancer. 2020;11(16):4899-4906.
  18. Yasudome R et al. Molecular Pathogenesis of Colorectal Cancer: Impact of Oncogenic Targets Regulated by Tumor Suppressive miR-139-3p. Int J Mol Sci. 2022;23(19). doi: 10.3390/ijms231911616.
  19. Yuan D, Zhu Y. Knockdown of LINC01224 Suppresses Colon Cancer Progression by Sponging miR-485-5p to Downregulate MCL1. Cancer Manag Res. 2021;13:7803-7812.
  20. Siegel RL, Miller KD, Fuchs HE, Jemal A. Cancer Statistics, 2021. CA Cancer J Clin. 2021;71(1):7-33.
  21. Chang L et al. Total saponins from Rhizoma Panacis Majoris inhibit proliferation, induce cell cycle arrest and apoptosis and influence MAPK signalling pathways on the colorectal cancer cell. Mol Med Rep. 2021;24(2). doi: 10.3892/mmr.2021.12181.
  22. Chen K et al. The epigenetic downregulation of LncGHRLOS mediated by RNA m6A methylase ZCCHC4 promotes colorectal cancer tumorigenesis. J Exp Clin Cancer Res. 2024;43(1):44.
  23. Xu Y et al. Anti-Warburg effect of rosmarinic acid via miR-155 in colorectal carcinoma cells. Eur J Cancer Prev. 2016;25(6):481-489.
  24. Lan YZ et al. Small nucleolar RNA and its potential role in the oncogenesis and development of colorectal cancer. World J Gastroenterol. 2024;30(2):115-127.
  25. Chen C, Liu Y, Han P, Cui B. Research Progress of Preoperative FPR, FAR or AFR in Patients with Colorectal Cancer. Cancer Manag Res. 2021;13:1791-1801.
  26. Laowittawat C et al. The cyclic peptide mallotumide A inhibits colon and breast cancer cell growth and motility by targeting cellular respiration and lipogenesis. Sci Rep. 2025;15(1):40774.
  27. Wang L, Jiang F, Xia X, Zhang B. LncRNA FAL1 promotes carcinogenesis by regulation of miR-637/NUPR1 pathway in colorectal cancer. Int J Biochem Cell Biol. 2019;106:46-56.
  28. Guo S et al. lncRNA HCG11 Promotes Colorectal Cancer Cell Malignant Behaviors via Sponging miR-26b-5p. J Immunol Res. 2023;2023:9011232.
  29. Meng M, Sang L, Wang X. S100 Calcium Binding Protein A11 (S100A11) Promotes The Proliferation, Migration And Invasion Of Cervical Cancer Cells, And Activates Wnt/β-Catenin Signaling. Onco Targets Ther. 2019;12:8675-8685.
  30. Wang Z et al. TNF-α augments CXCL10/CXCR3 axis activity to induce Epithelial-Mesenchymal Transition in colon cancer cell. Int J Biol Sci. 2021;17(11):2683-2702.
  31. O'Brien SJ et al. Long non-coding RNA (lncRNA) and epithelial-mesenchymal transition (EMT) in colorectal cancer: a systematic review. Cancer Biol Ther. 2020;21(9):769–781.
  32. Chen Q et al. LncRNA GAS6-AS1 facilitates tumorigenesis and metastasis of colorectal cancer by regulating TRIM14 through miR-370-3p/miR-1296-5p and FUS. J Transl Med. 2022;20(1):356.
  33. Zhao M, Dai R. HIST3H2A is a potential biomarker for pancreatic cancer: A study based on TCGA data. Medicine (Baltimore). 2021;100(46):e27598.
  34. Ke H, Wu S, Zhang Y, Zhang G. miR-139-3p/Kinesin family member 18B axis suppresses malignant progression of gastric cancer. Bioengineered. 2022;13(2):4528-4536.
  35. Zhang W et al. miR‑139‑3p suppresses the invasion and migration properties of breast cancer cells by targeting RAB1A. Oncol Rep. 2019;42(5):1699-1708.
  36. Huang P, Xi J, Liu S. MiR-139-3p induces cell apoptosis and inhibits metastasis of cervical cancer by targeting NOB1. Biomed Pharmacother. 2016;83:850-856.
  37. Wu X et al. Enterotoxigenic Bacteroides fragilis (ETBF) Enhances Colorectal Cancer Cell Proliferation and Metastasis Through HDAC3/miR-139-3p Pathway. Biochem Genet. 2024;62(5):3904-3919.
  38. Lin M et al. MicroRNA expression profiles in human colorectal cancers with liver metastases. Oncol Rep. 2011;25(3):739-747.
  39. Ghofrani-Shahpar M et al. Cancer-associated fibroblasts drive colorectal cancer cell progression through exosomal miR-20a-5p-mediated targeting of PTEN and stimulating interleukin-6 production. BMC Cancer. 2024;24(1):400.
  40. Li S et al. Analyses of the Competing Endogenous RNA Network in Rats with Middle Cerebral Artery Occlusion Based on lncRNA, miRNA, and mRNA Expression. J Vis Exp. 2025;(224). doi: 10.3791/68876.
  41. Pei FL, Cao MZ, Li YF. Circ_0000218 plays a carcinogenic role in colorectal cancer progression by regulating miR-139-3p/RAB1A axis. J Biochem. 2020;167(1):55-65.

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Explore More Articles

Long Noncoding RNART-qPCRCell ViabilityCell MigrationCell InvasionEpithelial Mesenchymal TransitionDual Luciferase Reporter
Contact Us
Recommend to Library

Privacy

Terms of Use

Policies

Copyright © 2026 MyJoVE Corporation. All rights reserved.