CRISPR/Cas9-Mediated HKDC1 Depletion to Assess Ferroptosis and Lenvatinib Responses in Hepatocellular Carcinoma

Summary

This protocol combines CRISPR/Cas9-mediated HKDC1 depletion with cell viability, pharmacological rescue, apoptosis, glutathione, and malondialdehyde assays to examine regulated cell-death responses in hepatocellular carcinoma.

Abstract

Hexokinase domain-containing protein 1 (HKDC1) has been implicated in hepatocellular carcinoma (HCC) progression, but its relationship to regulated cell death remains incompletely defined. This article presents an in vitro workflow that combines public cohort analysis, paired clinical tissues, CRISPR/Cas9-mediated HKDC1 depletion, cell growth assays, lenvatinib treatment, pharmacological rescue, and biochemical measurements of glutathione (GSH) and malondialdehyde (MDA). HKDC1 expression was higher in HCC than in non-tumor liver tissue and was associated with poorer overall and disease-free survival in public datasets. HKDC1 depletion reduced growth and colony formation in Hep3B and SNU449 cells. HKDC1 depletion also increased the response to lenvatinib and ML-162. Independent targeting with sg-HKDC1-2 reproduced the ML-162-associated viability phenotype, and ferrostatin-1 restored viability after ML-162 exposure in SNU449 cells. These results support an association between HKDC1 depletion and increased susceptibility to regulated cell-death stress in HCC cells. Because direct lipid-reactive oxygen species, GPX4/SLC7A11 activity, glucose flux, and in vivo efficacy were not measured, the downstream mechanism and therapeutic relevance require further validation.

Introduction

Hepatocellular carcinoma (HCC) is a major cause of cancer mortality worldwide, with a particularly high burden in Asia^1,2,3,4. Many patients present with advanced disease and require systemic therapy^5,6,7,8. Lenvatinib is a first-line option for unresectable HCC, but primary and acquired resistance limit durable benefit^9,10,11. Identifying tumor-cell survival factors may therefore reveal strategies for improving treatment response. Ferroptosis is an iron-dependent form of regulated cell death driven by phospholipid peroxidation when antioxidant defenses are insufficient^{12,13,14,15,16}. The cystine/GSH/GPX4 system is a central ferroptosis-protection pathway^13,16,17. In HCC, ferroptosis intersects with tumor metabolism, oxidative stress, and treatment resistance, making ferroptosis sensitivity relevant to the response to targeted therapies^18,19,20,21. However, GSH depletion and MDA accumulation are indirect biochemical readouts and do not, by themselves, establish a specific GPX4-dependent mechanism.

HKDC1 is an atypical hexokinase with low but measurable glucose-phosphorylating activity^22,23,24. Experimental studies have shown that HKDC1 expression can alter cellular hexokinase activity, hepatic glucose handling, mitochondrial metabolism, and adaptation to glucose availability^25,26,27,28. Increased HKDC1 expression has been associated with HCC proliferation, aggressive behavior, stemness, immune evasion, and poor prognosis^{25,29,30,31,32,33}. Whether HKDC1 modifies ferroptotic stress or the response to Lenvatinib has not been established. Published mechanistic studies nevertheless identify plausible points of convergence. Under hypoxia, HKDC1 binds GSK3β and stabilizes β-catenin to promote HCC stemness³¹, whereas acquired lenvatinib resistance has also been linked to GSK3β-regulated Wnt/β-catenin signaling and HIF-1α-driven stemness^34,35. HKDC1 also supports mitochondrial function and glucose-flux reprogramming²⁵. These overlapping stress-adaptation programs provide a biological rationale for testing whether HKDC1 influences lenvatinib response, but they do not establish a direct interaction between HKDC1 and lenvatinib.

The present study used CRISPR/Cas9-mediated HKDC1 depletion to examine cell growth, ML-162-associated viability loss, pharmacological rescue, GSH and MDA, and lenvatinib-associated apoptosis in HCC cell lines. Patient-cohort differential expression and pathway analyses were used to generate correlational context; they were not treated as transcriptional readouts of HKDC1 depletion (Figure 1).

Protocol

Ethics
The use of six paired HCC and adjacent non-tumor tissue specimens was approved by the Ethics Committee of The First Affiliated Hospital of Shandong First Medical University (approval no. S067). Written informed consent was obtained from all participants. No vertebrate animals were used in this study.

Bioinformatics analysis
Transcriptomic and clinical data for The Cancer Genome Atlas Liver Hepatocellular Carcinoma (TCGA-LIHC) cohort were collected from the National Cancer Institute Genomic Data Commons. This data was analyzed for overall survival (OS) and disease-free survival (DFS) with the Kaplan-Meier Plotter HCC dataset using the platform's automatically selected best HKDC1 expression cutoff and log-rank tests. For TCGA-LIHC clinicopathological, immune, differential-expression, and enrichment analyses, the authors divided the 374 tumors at the median into HKDC1-high and HKDC1-low groups (n = 187 per group). Differential-expression analysis using DESeq2 with adjusted p < 0.05 and |log2 fold change| > 1 was performed. Entrez Gene identifiers were mapped to official human gene symbols using the Bioconductor human annotation package org.Hs.eg.db. Functional annotation and gene set enrichment analysis were subsequently performed using clusterProfiler and the MSigDB canonical-pathway collection. Then, the immune-cell infiltration using single-sample gene set enrichment analysis implemented in GSVA and a published 24-cell marker set³⁶ was assessed, and the results were visualized using ggplot2. These cohort analyses were treated as associations rather than direct consequences of experimental HKDC1 depletion.

Clinical tissue collection
The authors collected six paired HCC and adjacent non-tumor tissue specimens under the ethics approval described above. They processed paired samples in parallel for immunohistochemistry and protein extraction, recorded the pathological diagnosis, and preserved the tumor-adjacent pairing during analysis.

Immunohistochemistry
Formalin-fixed, paraffin-embedded sections (4 µm) were prepared. The sections were deparaffinized and rehydrated, followed by heat-induced antigen retrieval in EDTA buffer (pH 9.0) by boiling for 20 min, blocking of endogenous peroxidase with 3% hydrogen peroxide, and blocking of nonspecific binding with 5% bovine serum albumin. The sections were incubated with anti-HKDC1 antibody diluted 1:100 overnight at 4 °C, followed by the appropriate horseradish-peroxidase-conjugated secondary reagent for 30 min at room temperature. Staining was developed with 3,3'-diaminobenzidine, and the sections were counterstained with hematoxylin. For digital quantification, identically sized tissue regions from the six paired main-field images were analyzed using a fixed H-DAB optical-density color-deconvolution workflow. Inset images and non-tissue annotations were excluded. DAB-positive pixels were defined using a DAB optical-density threshold of 0.30 together with fixed chromatic filters (saturation > 0.08, green > 1.03 × blue, and red > 1.10 × blue). DAB-positive area was used as the primary IHC outcome, and mean DAB optical density was used as a secondary intensity outcome. The same region-selection rule and thresholds were applied to all 12 images.

Cell culture
HepG2, Hep3B, PLC-PRF-5, Huh-7, JHH-7, SNU182, SNU387, SNU475, and SNU449 cells were used for HKDC1-expression screening. Hep3B and SNU449 cells were used for functional experiments and were maintained in minimum essential medium supplemented with 10% fetal bovine serum and 1% penicillin-streptomycin at 37 °C in a humidified atmosphere containing 5% CO2.

CRISPR/Cas9-mediated HKDC1 depletion
Hep3B or SNU449 cells (5 × 10⁵ per well) were seeded in six-well plates. A non-targeting CRISPR/Cas9 control construct (sg-HKDC1-nc; sequence 5'-GCACTCACATCGCTACATCA-3') or an HKDC1-targeting construct was introduced using 5 µg plasmid, 1.5 µL Lipofectamine 3000, and 2 µL P3000 reagent per well. The targeting sequences were sg-HKDC1-1, 5'-AATGTTTGCGGTCCACTTGA-3', and sg-HKDC1-2, 5'-CGGAGAGCCGCATGTGATAC-3'. The cells were incubated for 48 h before HKDC1 depletion was validated by Western blotting, and functional assays were initiated.

Cell proliferation and colony formation
For the cell counting kit-8 assay, 5 × 10³ cells per well were seeded into a 96-well plate, with three technical replicates per condition and time point. At 24, 48, 72, and 96 h, 10 µL of reagent was added, the cells were incubated for 3 h at 37 °C, and absorbance was measured at 450 nm. For colony formation, 150 cells per well were seeded in 24-well plates, the medium was replaced every 2 days, and the cells were cultured for 14 days. Colonies were fixed with methanol for 15 min, stained with crystal violet for 20 min, imaged using identical settings, and counted with a prespecified threshold. Three independent biological experiments were performed per group; each cell line was analyzed separately, and counts were reported as mean ± standard deviation.

Lenvatinib-associated viability loss and apoptosis
Control and HKDC1-depleted Hep3B and SNU449 cells were treated with dimethyl sulfoxide vehicle or lenvatinib for 24 h. For the concentration-response viability assay, lenvatinib at concentrations of 0, 5, 10, 15, 25, and 50 µM was used. For the representative Annexin V/propidium iodide assay, vehicle, 20 µM, and 40 µM lenvatinib were used. Both adherent and detached cells were collected, washed with phosphate-buffered saline, and resuspended in binding buffer. Samples were stained with Annexin V-FITC and propidium iodide for 10 min at room temperature in the dark. Samples were acquired by flow cytometry using the same compensation and quadrant gates across conditions, and the combined early- and late-apoptotic fractions were reported.

ML-162 sensitivity and pharmacological rescue
For the ML-162 concentration-response experiment, Hep3B cells were treated with 0, 2.5, 5, 10, 15, or 20 µM ML-162, and SNU449 cells were treated with 0, 0.5, 1, 2.5, 5, or 10 µM ML-162; viability was measured using the Cell Counting Kit-8 assay. For rescue experiments, sg-HKDC1-nc, sg-HKDC1-1, and sg-HKDC1-2 cells were exposed to vehicle, ML-162 alone, ML-162 plus ferrostatin-1, or ML-162 plus Z-VAD-FMK, and cell viability was measured.

GSH and MDA measurements
Control and HKDC1-depleted Hep3B and SNU449 cells were treated with vehicle or ML-162. Reduced GSH was measured using the colorimetric kit listed in the Table of Materials. Clarified lysate was mixed with the kit working reagent and incubated for 5 min at room temperature; absorbance was measured at 405 nm, and GSH was calculated from a standard curve. For the MDA assay, cells were lysed, and the lysate was clarified by centrifugation for 10 min. The supernatant was mixed with 600 µL thiobarbituric acid reagent and incubated at 95 °C for 60 min. Aliquots (200 µL) of each reaction were transferred to a 96-well plate in technical triplicate; absorbance was measured at 532 nm, and MDA was calculated from the standard curve and normalized to protein concentration. Three independent biological experiments were performed for each assay.

Western blotting and densitometry
Cells were lysed in radioimmunoprecipitation-assay buffer for 20 min, and lysates were clarified for 15 min at 4 °C using a Heraeus l50i refrigerated centrifuge fitted with rotor 75003436 (maximum radius, 7.9 cm) at approximately 12,718 × g. Protein concentration was measured; one volume of 5× loading buffer was mixed with four volumes of protein sample, samples were heated at 95 °C for 5 min, and 15 µg was loaded per lane. Proteins were separated at 80 V for 30 min, followed by 120 V for 60 min, and transferred to a 0.45 µm polyvinylidene fluoride membrane. Membranes were blocked in 5% non-fat milk for 2 h, washed three times with Tris-buffered saline containing Tween 20, and incubated overnight at 4 °C with anti-HKDC1, anti-BAX, or anti-GAPDH antibody diluted 1:1,000. The membranes were incubated with the host-appropriate horseradish-peroxidase-conjugated secondary antibody diluted 1:5,000 for 1 h at room temperature, developed by enhanced chemiluminescence, and imaged within the linear exposure range. Band intensity was quantified after local background subtraction, and HKDC1 or BAX was normalized to GAPDH within the same lane.

Statistical analysis
Statistical analyses were performed using GraphPad Prism. Quantitative data were presented as mean ± standard deviation unless otherwise stated. For GSH and MDA, control and sg-HKDC1-1 were compared within each vehicle or ML-162 condition using multiple two-sided unpaired t tests with the two-stage Benjamini-Krieger-Yekutieli false-discovery-rate procedure (Q = 1%). Colony counts were analyzed separately for each cell line by ordinary one-way analysis of variance followed by Sidak's multiple-comparisons test for the prespecified sg-HKDC1-1 versus sg-HKDC1-nc and sg-HKDC1-2 versus sg-HKDC1-nc comparisons. ML-162 concentration-response experiments were analyzed by ordinary two-way analysis of variance. For rescue experiments, genotype effects within each treatment condition were analyzed by ordinary one-way analysis of variance followed by Sidak's multiple-comparisons test; rescue conditions relative to ML-162 alone were evaluated by ordinary one-way analysis of variance followed by Dunnett's test. Paired tumor and adjacent non-tumor DAB-positive area fractions and mean DAB optical-density values were compared using two-sided Wilcoxon signed-rank tests. Exact p values were reported where available, and p < 0.05 was considered statistically significant.

Results

Bioinformatics analysis
Paired analysis of 50 matched HCC and adjacent non-tumor liver samples showed significantly higher HKDC1 transcript expression in tumors. The paired profiles revealed a broad tumor-associated upward shift, with most tumors expressing higher levels of HKDC1 than their matched adjacent tissues (Figure 2A). These findings demonstrate recurrent transcriptional upregulation of HKDC1 in HCC.

Discussion

The protocol integrates public-cohort analysis with genetic depletion, pharmacological rescue, flow cytometry, and biochemical readouts to investigate HKDC1-associated cell survival in HCC. HKDC1 was elevated in HCC and associated with poorer survival, while depletion reduced growth and colony formation in two cell-line models. These observations extend previous work connecting HKDC1 to HCC progression, mitochondrial function, stemness, and immune evasion^25,

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
96-well plates	Corning Incorporated	3599	CCK-8 assay
Annexin V-FITC/PI apoptosis detection kit	Dojindo Laboratories Co., Ltd.	AD10	Flow-cytometric apoptosis assay
Anti-BAX antibody	Proteintech Group, Inc.	50599-2-Ig	Western blotting
Anti-GAPDH antibody	Proteintech Group, Inc.	60004-1-Ig	Loading control
Anti-HKDC1 antibody	Proteintech Group, Inc.	25874-1-AP	Western blotting/IHC
BCA protein assay kit	Yeasen Biotechnology (Shanghai) Co., Ltd.	20201ES76	Protein concentration normalization
BD FACSAria Fusion flow cytometer	Becton, Dickinson and Company	656700	Flow-cytometric analysis
CCK-8 kit	Vazyme Biotech Co., Ltd.	A311-01	Cell proliferation/viability assay
ChemiDoc MP imaging system	Bio-Rad Laboratories	12003154	Chemiluminescence imaging
clusterProfiler	Bioconductor	version 4.4.4	Functional annotation and gene set enrichment analysis
CRISPR Scrambled sgRNA All-in-One Lentiviral Vector (with spCas9)	Applied Biological Materials Inc. (abm)	K010; sgRNA sequence: GCACTCACATCGCTACATCA	Negative-control CRISPR/Cas9 plasmid transfection
Crystal violet staining solution	MedChemExpress LLC	HY-DY2001	Stain for colony-formation assays
DESeq2	Bioconductor	version 1.36.0	Differential-expression analysis
Ferrostatin-1 (Fer-1)	MedChemExpress LLC	HY-100579	Ferroptosis rescue
Fetal bovine serum	Shanghai BasalMedia Technologies Co., Ltd.	S615JY	Cell culture supplement
ggplot2	The R Foundation / CRAN	version 3.3.6	Data visualization
GraphPad Prism	GraphPad Software, LLC	version 10.6.0	Statistical analysis and graphing
GSH assay kit	Nanjing Jiancheng Bioengineering Institute	A006-2-1	Intracellular glutathione detection
GSVA	Bioconductor	version 1.46.0	Single-sample gene set enrichment analysis for immune-cell infiltration
Hep3B	Suzhou Haixing Biosciences Co., Ltd.	TCH-C195	Functional experiments
HepG2	Suzhou Haixing Biosciences Co., Ltd.	TCH-C196	HCC cell-line expression screening
Heraeus L50i refrigerated centrifuge	Thermo Fisher Scientific Inc.	Heraeus L50i; rotor 75003436	Sample centrifugation; rotor 75003436
HKDC1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human), Target 1	Applied Biological Materials Inc. (abm)	CL097; sgRNA sequence: AATGTTTGCGGTCCACTTGA	HKDC1 depletion
HKDC1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human), Target 2	Applied Biological Materials Inc. (abm)	CL097; sgRNA sequence: CGGAGAGCCGCATGTGATAC	HKDC1 depletion
HRP-conjugated goat anti-rabbit IgG and goat anti-mouse IgG	Proteintech Group	SA00001-2; SA00001-1	Western blot secondary antibodies
Huh-7	Suzhou Haixing Biosciences Co., Ltd.	TCH-C217	HCC cell-line expression screening
Human hepatocellular carcinoma and adjacent non-tumor specimens	The First Affiliated Hospital of Shandong First Medical University (Shandong Provincial Qianfoshan Hospital)	6 paired specimens; ethics approval S067	Six paired, de-identified surgical specimens; written informed consent obtained
Immobilon-P PVDF membrane, 0.45 um	Merck Millipore	IPVH00010	Western blot protein transfer
JHH-7	Suzhou Haixing Biosciences Co., Ltd.	TCH-C460	HCC cell-line expression screening
Kaplan-Meier Plotter hepatocellular carcinoma dataset	Kaplan-Meier Plotter	https://kmplot.com/analysis/	Overall-survival analysis using the platform's automatically selected best expression cut-off
Lenvatinib	MedChemExpress LLC	HY-10981	Apoptosis-related cell death assay
Lipofectamine 3000 transfection reagent	Thermo Fisher Scientific Inc.	L3000015	Plasmid transfection; 1.5 uL Lipofectamine 3000 and 2 uL P3000 per well of a six-well plate for 5 ug plasmid
MDA assay kit	Nanjing Jiancheng Bioengineering Institute	A003-4-1	Malondialdehyde/lipid peroxidation detection
MEM medium	Shanghai BasalMedia Technologies Co., Ltd.	L550KJ	Cell culture medium
Methanol	Sigma-Aldrich/Merck	179337	Fixative for colony-formation assays
ML-162	MedChemExpress LLC	HY-100002	Ferroptosis induction/rescue assay
MSigDB curated canonical pathway collection	Molecular Signatures Database	c2.cp.all.v2022.1.Hs.symbols.gmt	Canonical-pathway gene set
Multiskan FC microplate photometer	Thermo Fisher Scientific Inc.	51119000	Absorbance measurement
OpenAI Codex	OpenAI	GPT-5; accessed August 2026	Code-based layout assistance for Figure 1 graphical abstract only; no primary data generation, data analysis, or experimental-image modification.
org.Hs.eg.db	Bioconductor	version 3.10.0	Entrez identifier conversion
Penicillin-streptomycin	Shanghai BasalMedia Technologies Co., Ltd.	S110JV	Cell culture supplement
PLC-PRF-5	Suzhou Haixing Biosciences Co., Ltd.	TCH-C298	HCC cell-line expression screening
RIPA lysis buffer	Yeasen Biotechnology (Shanghai) Co., Ltd.	20101ES60	Western blotting
RSL3	MedChemExpress LLC	HY-100218A	Ferroptosis induction
SNU182	Suzhou Haixing Biosciences Co., Ltd.	TCH-C398	HCC cell-line expression screening
SNU387	Shanghai Stembio Co., Ltd.	STM-CL-5322	HCC cell-line expression screening
SNU449	Suzhou Haixing Biosciences Co., Ltd.	TCH-C500	Functional experiments
SNU475	Shanghai Stembio Co., Ltd.	STM-CL-5451	HCC cell-line expression screening
TCGA-LIHC	National Cancer Institute Genomic Data Commons	TCGA-LIHC	Transcriptomic and clinical analysis
Xiantao Academic Online Analysis Platform	Xiantao Academic	Web-based implementation	Web-based bioinformatics analysis
Z-VAD-FMK	MedChemExpress LLC	HY-16658B	Pan-caspase inhibition control