Due metodi per stabilire primarie cellule umane endometriale stromali da isterectomia campioni

* These authors contributed equally
Medicine

Your institution must subscribe to JoVE's Medicine section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Stabilire sistemi di coltura primarie endometriali stromali di cellule da campioni di isterectomia è una tecnica biologica prezioso e un passo fondamentale prima di perseguire una vasta gamma di ricerca mira. Qui, descriviamo due metodi utilizzati per stabilire culture stromali da tessuto endometriale chirurgicamente resecati di pazienti umani.

Cite this Article

Copy Citation | Download Citations

Jividen, K., Movassagh, M. J., Jazaeri, A., Li, H. Two Methods for Establishing Primary Human Endometrial Stromal Cells from Hysterectomy Specimens. J. Vis. Exp. (87), e51513, doi:10.3791/51513 (2014).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Molti sforzi sono stati dedicati ad elaborare sistemi di colture cellulari in vitro. Questi sistemi sono progettati per modellare un vasto numero di processi in vivo. Sistemi di colture cellulari derivanti da campioni endometriali umane non fanno eccezione. Le applicazioni spaziano dai normali processi fisiologici ciclici a patologie endometriali come i tumori ginecologici, malattie infettive, e carenze riproduttive. Qui, mettiamo a disposizione due metodi per stabilire cellule stromali endometriali primarie da campioni di isterectomia endometriale chirurgicamente asportati. Il primo metodo è indicato come "metodo raschiatura" e incorpora raschiatura meccanica usando lame chirurgiche o rasoio mentre il secondo metodo è chiamato "il metodo tripsina." Quest'ultimo metodo utilizza l'attività enzimatica di tripsina per promuovere la separazione di cellule e primaria escrescenza cellulare. Illustriamo metodologia step-by-step per immagini digitali e microscopia. Abbiamo anche provide gli esempi per convalidare le linee di cellule stromali endometriali mediante reazioni quantitative in tempo reale catena della polimerasi (qPCR) e di immunofluorescenza (IF).

Introduction

Il corpus utero umano è costituito da tre strati, il perimetrium (o sierosa), miometrio, e l'endometrio. Distinguere ciascuno di questi livelli è un passo importante per stabilire linee di cellule endometriali. Il perimetrium è strato più esterno dell'utero e composto, cellule sierose sottili. Il miometrio è la spessa, strato intermedio dell'utero e composta da cellule muscolari lisce. L'endometrio è identificato come strato interno dell'utero e comprende popolazioni epiteliali e cellule stromali.

L'endometrio è ulteriormente suddivisa in strato basale il cui stelo popolazione cellulare è ipotizzato di ripopolare il livello functionalis circa ogni 28 giorni 1. Lo strato functionalis dell'endometrio umano subisce significative variazioni biochimiche e morfologiche in risposta agli ormoni circolanti. Questi ormoni sono derivati ​​dalla ghiandola pituitaria e le ovaie.

Ilproduzione coordinata e il rilascio di ormoni risultati in un ciclo riproduttivo. Il ciclo riproduttivo è progettato per preparare l'endometrio per potenziali eventi impianto dell'embrione. Negli esseri umani, il ciclo riproduttivo è conosciuto come "il ciclo mestruale" e suddiviso in tre fasi - proliferativa, secretori, e mestruali. La fase proliferativa comporta la proliferazione del functionalis livello endometriale mentre la fase secretoria è segnato da functionalis maturazione. In particolare, alterazioni extracellulari, secrezioni e differenziazione cellulare segnalano un potenziale impianto. Se l'impianto non si verifica prima della fine della fase secretoria, lo strato functionalis endometriale è sparso durante la fase mestruale. L'importanza delle mestruazioni e gli eventi che attivano lo spargimento dello strato functionalis sono ancora in discussione. Negli esseri umani, è stato posto che le mestruazioni è il risultato di un evento specifico metà secretoria differenziazione fase conosciutacome "decidualizzazione spontanea" 2. In questo manoscritto, forniamo metodologia dettagliata per entrambi i metodi di isolamento delle cellule stromali dell'endometrio, e usiamo una combinazione di immunofluorescenza e immagini digitali per dimostrare l'efficacia di questi approcci. Inoltre, si applica una comunemente usato modello in vitro di decidualizzazione spontaneo per confermare endometriale isolamento delle cellule stromali.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

I campioni isterectomia utilizzati in questo manoscritto sono stati raccolti in concordanza con un protocollo di etica dell'Università IRB approvato numerato IRB-HSR # 14424.

1. Acquisizione di esempio da Fonte clinica

  1. Ottenere governo e orientamenti etici basata sulle istituzioni e la documentazione approvazione prima dell'inizio.
  2. Eseguire tutti i passaggi condizioni sterili.
  3. Preservare il tessuto derivato dal paziente nei media (RPMI o DMEM / Alto glucosio) in un tubo da 50 ml a 4 ° C, se il campione non può essere elaborata nella cultura immediatamente. I campioni possono essere conservati in questo stato per un massimo di 24 ore.
  4. Lavare campione di tessuto tre volte con 1X sterile tampone fosfato (PBS) e scartare la soluzione tra i lavaggi.

2. Preparazione di linee cellulari primarie che utilizzano il metodo raschio

  1. Aggiungere 4-10 ml di terreno di coltura (RPMI o DMEM / Alto glucosio supplementato con 10% siero fetale bovino e 1% penicillina-streptomycin) al tessuto e aggiungere Fungizone (0,25 mg / ml concentrazione finale) per 30 min.
  2. Eliminare i mezzi di crescita.
  3. Lavare il tessuto due volte con PBS 1X.
  4. Collocare il tessuto su una piastra di coltura cellulare 6 centimetri di distinguere tra miometrio e strati di endometrio (vedi figure 2A-2C per una descrizione più dettagliata). Separare l'endometrio.
  5. Usando un bisturi o un rasoio, transezione il tessuto in piccoli pezzi mentre graffi sul piatto di coltura cellulare 6 cm. Questi graffi facilitano il fissaggio delle cellule endometriali primarie emergenti. Rispetto al metodo tripsina, è necessaria più tessuto (vedi Figura 2D per approssimazione).
  6. Delicatamente, aggiungere 2 ml di terreni di crescita per piatto graffiato (frammenti di tessuto saranno visibili e, idealmente, immobilizzato dal moto graffi).
  7. Trasferire la piastra (s) per un incubatore di coltura cellulare designata (37 ° C e 5% CO 2). Designare un luogo per linee cellulari primarie, lontano da OTHer piatti di coltura di cellule. Colture primarie sono più sensibili all'infezione e contaminazione.
  8. Esaminare le cellule al microscopio luce del giorno. Piccole popolazioni di cellule dovrebbero emergere dal giorno due o tre intorno ai tessuti fette (vedere Figura 3B).
  9. Per mantenere le culture, lavare delicatamente con 1X PBS e aggiungere terreni di crescita fresco (2 ml) ogni tre giorni. Quando aumenta la velocità di proliferazione, terreni di crescita supplementare (3-4 ml) possono essere aggiunti alla piastra di coltura 6 cm (s).
    Nota: durante il lavaggio e dei media cambia, pezzi di tessuto saranno probabilmente aspirati. Questo non influenzerà la crescita di cellule aderenti. I pezzi di tessuto devono essere aspirati dal passo successivo (2.10) come nuove colonie difficilmente emergere dopo una settimana.
  10. Quando la piastra 6 CM è circa il 75 - 80% confluenti (vedere Figura 3B), passaggio utilizzando 0,05% tripsina. Cellule primarie non possono essere diversi passaggi a tempo indeterminato - congelamento giù una piastra di cellule appena due o tre piatti sono maintained. Se sono necessari ulteriori passaggi, seguire un protocollo immortalization (rivisto nel Rif. ​​3).

3. Preparazione di linee cellulari primarie che utilizzano il metodo tripsina

  1. Mettere un piccolo pezzo di tessuto endometriale (vedere Figura 2D per una approssimazione) in 2 ml di 0,25% tripsina integrati con kanamicina (0,03 mg / ml concentrazione finale).
  2. Incubare il tessuto a 37 ° C su piattaforma rotante per 30 min.
  3. Brevemente vortice del tessuto.
  4. Centrifugare il campione a 200-400 xg per 2 minuti e scartare il surnatante.
  5. Aggiungi tripsina fresco e kanamicina.
  6. Incubare il tessuto a 37 ° C durante la rotazione per un ora.
  7. Agitare il tessuto per 5-10 sec.
  8. Aggiungere 2 ml di terreni di crescita (supplementato con 10% siero fetale bovino e 1% di penicillina-streptomicina) per disattivare la tripsina.
  9. Centrifugare le cellule a 200-400 xg per 2-3 min.
  10. Eliminare il surnatante e aggiungere 2 ml di crescereth supporti alle cellule pellet.
  11. Piatto su un piatto di coltura cellulare 6 centimetri. Raschiare la piastra come nella Fase 2.5 su Preparazione linee cellulari primarie utilizzando il metodo raschio non è necessaria, ma esalta l'attaccamento e la conseguenza di colture primarie.
  12. Controllo cellule al microscopio luce giornaliera. Le cellule sono solitamente visibili al microscopio ottico dopo 24-48 ore (vedi Figura 3C).
  13. Per mantenere le culture, monitorare le cellule e modificare i media ogni 2-3 giorni, come nel passo 2.9.
  14. Per passare le cellule, usa 0,05% o 0,25% tripsina quando le cellule raggiungono il 75-80% di confluenza (vedi Figura 3C).

4. Risparmio tessuto extra per l'analisi (Snap Congelamento e Formalina Fixation)

  1. Lavare campione due volte con PBS 1X.
  2. Aspirare quanto più liquido possibile.
  3. Per Snap congelamento, collocare campione di tessuto endometriale in una provetta 1,7 centrifuga (vedi figure 2F e 2G). Posizionare il 1.7provetta da centrifuga in azoto liquido per 10 secondi o finché si può notare che il tessuto è congelato giù.
    Nota: Fare attenzione a non toccare direttamente l'azoto liquido durante la preparazione dei campioni. I campioni possono essere conservati a -80 ° C fino ad ulteriore trattamento o l'analisi.
  4. Per la fissazione in formalina, tagliare un piccolo pezzo di tessuto endometriale (vedere Figura 2H), e immergere nel 10% formalina tamponata zinco. Dopo 24 ore, scartare in formalina e aggiungere il 70% di etanolo per i campioni di tessuto fino ad ulteriore trasformazione.

5. Immunofluorescenza (IF)

  1. Fissazione delle cellule
    1. Preparare le cellule su un vetrino cultura o piastra.
    2. Delicatamente, lavare le cellule con PBS 1X.
    3. Aggiungere pre-raffreddata (4 ° C) metanolo e acetone (miscelati in un rapporto 1:1) per 5 min.
    4. Asciugare il vetrino prima di procedere. Diapositiva può essere conservato a 4 ° C per 1-2 settimane se necessario.
  2. Elaborazione IF
    1. Reidratare le cellule con PBS 1X per 10 min. Per il following passaggi 1-6, condurre tutti lavaggi e incubazione su una piattaforma rotante.
    2. Blocco con 1X PBS supplementato con 1% di sieroalbumina bovina (BSA) e 1% specie siero specifico (fonte di anticorpo 2 °) per 30 minuti a temperatura ambiente (RT).
    3. Incubare in anticorpo primario (vedi produttori raccomandazioni per la diluizione di anticorpi). Vedi Materiali per anticorpi specifici. Diluire l'anticorpo primario in tampone di bloccaggio fresco come al punto 5.2.2. Questo incubazione può essere condotta per almeno 2 ore a temperatura ambiente o per una notte a 4 ° C.
    4. Lavare 3 volte con PBS 1X per 5 minuti ciascuno.
    5. Incubare in anticorpo secondario (vedi produttori raccomandazioni per la diluizione di anticorpi). Diluire l'anticorpo secondario in tampone di bloccaggio fresco come al punto 5.2.2. Per evitare fotometabolismo, è importante condurre questo e gradini successivi in ​​assenza di luce.
    6. Lavare 3 volte con PBS 1X per 5 minuti ciascuno.
    7. Thoroughly asciugare le diapositive.
    8. Aggiungi mezzi di montaggio e la soluzione di contrasto DAPI.
    9. Applicare coprioggetto e sigillare i bordi con sigillante (s). I vetrini possono essere conservati a 4 ° C al buio per un massimo di due settimane.

6. RNA Estrazione

  1. Pellet 1 x 10 7 cellule per centrifugazione. Tutti i materiali e reagenti di questo protocollo devono essere RNasi libero.
  2. Lisare le cellule in 1 ml di reagente TRIZOL, e incubare i campioni omogeneizzati per 10 min a temperatura ambiente per completare dissociazione dei complessi nucleoproteici.
  3. Aggiungere 200 ml di cloroformio per 1 ml di TRIZOL. Agitare vigorosamente a mano per 15 secondi e incubare per 2-3 minuti a temperatura ambiente.
  4. Centrifugare alla massima velocità (15.000 xg) per 15 min a 4 ° C. Tre strati comporteranno.
  5. Trasferire la fase acquosa superiore in una nuova provetta. Aggiungere 1 ml di glicogeno per aumentare la resa di RNA; tuttavia, questa fase è necessaria solo quando un piccoloquantità di RNA è anticipato.
  6. Aggiungere 0,5 ml di alcool isopropilico per lo strato acquoso, e invertire i campioni 3-5 volte. Incubare i campioni a temperatura ambiente per 10 min. Per aumentare la resa, i campioni possono essere collocati in -20 ° C o -80 ° C per 30 min.
  7. Centrifugare alla massima velocità per 10 min a 4 ° C.
  8. A questo punto, un piccolo pellet di RNA deve essere visibile. Scartare il surnatante.
  9. Lavare l'RNA di 1 ml di etanolo al 75%.
  10. Centrifugare alla massima velocità per 5 minuti e scartare il surnatante. I campioni possono essere lavati più per liberarsi contaminanti inorganici volta, ma questo passaggio non è necessario.
  11. In breve, asciugare il pellet di RNA fino RNA pellet è asciutto (solitamente richiede 7-10 min).
    Nota: Un passo aggiuntivo può essere utilizzato per diminuire materia inorganica e diminuire il tempo di asciugatura. Dopo aver scartato il supernatante dal etanolo di lavaggio, campioni centrifuga alla massima velocità per un altro minuto e aspirare liquido residuo. Fare attenzione a non aspirare il pellet.
  12. Sciogliere RNA in acqua priva di RNasi, a seconda delle dimensioni del pellet di RNA. Volumi in genere varia 10-50 ml.
  13. Incubare i campioni a 55 ° C per 10 min, e misurare la concentrazione di RNA.
  14. Conservare i campioni a -20 ° C fino ad ulteriore trasformazione.

7. Trascrizione inversa

  1. Portare il campione di RNA (1-3 mg) ad un volume di 9 ml con H 2 O.
  2. RNA calore a 70 ° C per 10 min.
  3. Per generare un master mix AMV, combinare i seguenti reagenti: 5 ml di dNTP (concentrazione di lavoro di 50 pm), 5 microlitri di oligo DNA N6 (concentrazione di lavoro di 80 micron), 5 ml di tampone 5X AMV e 1 ml di AMV . Questa soluzione master mix è progettata per un campione.
  4. Aggiungere 16 microlitri della miscela master al RNA riscaldata. Il volume di reazione finale sarà di 25 microlitri di reazione.
  5. Utilizzare le seguenti condizioni di PCR per la trascrizione inversa: (fase 1) 42 ° C per 90 min, (STAge 2) 95 ° C per 5 min, e (Fase 3) 4 ° C fino ad ulteriore lavorazione.

8. Real Time PCR

  1. Condurre reazioni di PCR utilizzando i primer, temperature di ricottura, numero di cicli e reagenti elencati nella tabella 1.
    Nota: E 'ideale per seguire le istruzioni del produttore quando si utilizzano reagenti PCR (fare riferimento alla società e catalogo numeri in Materials).

9. In vitro decidualizzazione Protocol (Derivato da Rif. ​​4 e 5)

  1. Piatto cellule endometriali.
  2. Crescere ad una confluenza del 75-85%.
  3. Dopo cellule diventano confluenti, lavare una volta con PBS 1X.
  4. Rapidamente, aggiungere contenuti multimediali senza ormoni (fenolo libero RPMI supplementato con 5% di carbone striscia di FBS e 1% di penicillina-streptomicina).
  5. Dopo 24 ore, aggiungere media ormone libero, completata con medrossiprogesterone acetato (MPA) ad una concentrazione finale di 1 mM e 8-bromoadenosine 3 ', 5'-Monofosfato ciclico (cAMP) ad una concentrazione finale di 0,5 mM.
  6. Dopo almeno 48 ore, bloccare la reazione e salvare la piastra (s) per un'ulteriore elaborazione.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Come sottolineato nella sezione Protocollo, assicurarsi di effettuare tutti i metodi sotto il governo, istituzionali e orientamenti etici durante la manipolazione e preparazione di tessuti umani.

Inclusi in questo manoscritto è un esempio del flusso di lavoro generale di "metodo scraping" (Figura 1A) e "il metodo tripsina" (Figura 1B) utilizzato per stabilire colture primarie endometriali. Questi metodi sono descritti in dettaglio nella sezione Protocol (vedere parte 1 -. 3.). Entrambi i metodi di risultati positivi nella crescita di colture primarie endometriali. Il vantaggio di "metodo raschiando" è il tempo di preparazione abbreviato; Tuttavia, il tempo necessario per osservare cellule vitali è solitamente 2 - 4 volte superiore rispetto a "il metodo tripsina."

Purché sono immagini digitali del tessuto umano iniziale ricevuto dai approvvigionamento dei tessuti. Gli strati uterine si distinguono per laruvidezza dello strato, cioè il miometrio è spesso e muscoloso e l'endometrio è sottile e più cedevole. Abbiamo evidenziato la spessa, strato muscolare liscio (miometrio) in bianco e delineato lo strato endometriale di interesse in nero da due differenti campioni di isterectomia (figure 2a e 2b). In Figura 2C, i tessuti sono orientati con il miometrio rivolto verso l'alto mentre l'endometrio è posizionato verso il basso. Il sottile strato perimetrial è stato asportato chirurgicamente e non evidenziata in queste immagini. E 'anche importante notare che la dimensione dello strato endometriale in queste immagini 2-digitale dimensionale è travisato come strato 3-dimensionale reale è molto sottile rispetto al miometrio.

Tagliare la dimensione del tessuto appropriato è importante sia per "il metodo scraping" e "il metodo tripsina." In Figura 2D, calibro sono designati per ciascun metodo sopra il rispettivo campione. Utilizzando uno 0.5x00,5 x0.5 cm pezzo per "il metodo tripsina" [left] è sufficiente per creare una cultura. Il tessuto di partenza rappresentante per "il metodo scraping" [a destra] comprende tutti i livelli uterine. Il prodotto finale per "il metodo raschiatura" è rappresentato nella Figura 2E, e si raccomanda che almeno 1x1x1 cm di tessuto endometriale essere utilizzato per stabilire colture vitali. L'esigenza di questo campione di tessuto molto è uno svantaggio di "metodo scraping".

Tessuto rimanente è spesso usato in molti modi tra cui proteine ​​e RNA analisi. Per garantire la conservazione della qualità dei tessuti, è importante utilizzare un metodo "scatto congelamento" come nella sezione Protocollo (vedi 4.). Questo metodo è illustrato anche nella Figura 2F e 2G Figura. Salvataggio tessuto extra fissazione con formalina è anche una pratica comune di patologi e ricercatori. Tessuto Preparazione per la fissazione in formalina è descritto nel protocollo Figura 2H.

La microscopia ottica è essenziale per monitorare colture primarie endometriale. Singole cellule stromali endometriali devono mostrare la morfologia dei fibroblasti (Figura 3A). "Il metodo scraping" genera tipicamente gruppi di cellule emergenti prime, principalmente lungo bisturi indotta graffi (Figura 3B, Giorno 2). "Il metodo della tripsina" genera sia cluster e modelli di crescita delle cellule disperse (Figura 3C, Giorno 4). Abbiamo incluso diverse immagini rappresentative della placcatura iniziale (giorno 0) al primo passaggio di ciascun metodo (Figura 3B e 3C).

Molti tessuti sono definite dalla loro espressione di marcatori tessuto-specifici come actina della muscolatura liscia (SMA) per muscolatura liscia, cellule staminali CD34 per immunitarie, ecc Mentre sono stati condotti esperimenti di espressione genica e proteine ​​per l'endometrio 6-11, un encellule stromali dometrial marcatore specifico deve ancora essere scoperto. Invece, i ricercatori comunemente valutare endometriale purezza stroma dai marcatori di potenziali contaminanti cella di misura. Ad esempio, i marcatori citocheratinici vengono utilizzati per mostrare le popolazioni epiteliali. Tuttavia, è meno di una preoccupazione, perché stabilire e mantenere epiteli endometriali sono difficili e solitamente selezionato contro (Rif. 12 e Figura 4A). Se i campioni dovessero essere ottenuto durante la gravidanza, positiva espressione di HLA-A,-B,-C dimostra germinali, cellule del trofoblasto 13. D'altra parte, come altri fibroblasti mesenchimali, cellule stromali endometriali esprimono vimentina (CDH1). Dimostriamo con immunofluorescenza, l'espressione di vimentina e l'assenza di citocheratina e E caderina (CDH1) nei nostri stabiliti endometriali cellule stromali (Figura 4B).

Infine, forniamo la prova funzionale della cultura endometriale primaria attraverso un in vitro spontaneo test decidualizzazione. Questo metodo è stato adattato da Rif 4 e 5, e comprende il trattamento di culture con una combinazione di medrossiprogesterone acetato (MPA) e 8 - bromoadenosine 3 ', 5'-monofosfato ciclico (cAMP) (descritto in 9 In vitro decidualizzazione protocollo e modellato. in figura 5A). In presenza di MPA e cAMP, cellule stromali endometriali mostrano profili di espressione genica significativamente alterati (recensiti Rif. ​​14). I marcatori decidualizzazione spontanei frequentemente riportati sono prolattina (PRL) e fattore di crescita insulino-simile Binding Protein 1 (IGFBP1) (recensione in rif 14). La risposta di questi due geni per MPA e cAMP sono forti indicatori sia di decidualizzazione spontaneo e di successo creazione di una cultura stromale endometriale. Dimostriamo questo in figura 5B.


Figura 1. Schematica dei due metodi di isolamento endometriali primari. (A) I passaggi 2,1-2,10 del metodo raschiamento visualizzato in un organigramma. (B) passaggi 3,1-3,14 del metodo tripsina visualizzato in un organigramma. Clicca qui per vedere l'immagine ingrandita.

Figura 2
Figura 2. Elaborazione tessuto uterino. (AC) campioni uterine cliniche dei due pazienti di sesso femminile. A & C sono derivati ​​da paziente 1 e B è derivato da paziente 2. tessuto asportato chirurgicamente uterina (a sinistra) e EVIDENZAstrati d uterini (a destra). (A & B) Il miometrio è cerchiata in bianco e dell'endometrio in nero. (C) Il miometrio è di fronte alla telecamera. (D) rappresentativi campioni di dimensioni dell'endometrio iniziali per entrambi i metodi di isolamento sono indicati. Il metodo tripsina richiede endometrio puro prima aggiunta del tripsina, mentre il metodo raschiando può utilizza l'intera campioni uterine. (E) Esempio del campione endometriale elaborata del metodo raschiatura. (F & G) Immagine del restante tessuto uterino in fase di preparazione per Snap Congelamento. Mostrato è un contenitore di metallo preparata in laboratorio utilizzato per questo metodo. (H) formalina fissazione di campione endometriale. Clicca qui per vedere l'immagine ingrandita.

Figura 3 Figura 3. Immagini di microscopia luce delle culture endometriale primarie. . (A) Immagini rappresentative della colture di cellule stromali endometriali prese a vari poteri e di confluenza (B) Immagini rappresentative del metodo di raschiatura (giorni 0-16) presa dello stesso piatto cultura, alimentato a 10x Nota:. Linee visuali indicano graffi da lama chirurgica (C) Immagini rappresentative del metodo tripsina.. (giorni 0-16) presa dello stesso piatto cultura, alimentato a 10x Clicca qui per vedere l'immagine ingrandita.

Figura 4
Figura 4. Immagini di immunofluorescenza di cellule stromali endometriali. (A) immunofluorescenzadelle culture endometriali primarie isolato tramite il metodo scraping. Immagini dimostrano perdita della citocheratina tra passaggio 2 (P2) e passaggio 5 (P5). Proteine ​​leucemia promielocitica (PML) proteina nucleare e colorazione DAPI sono stati usati come controlli. (B) Le immagini dimostrano colorazione positiva per il marcatore mesenchimale vimentina. Le immagini mostrano anche colorazione negativa per E caderina (CDH1) e Citocheratina. Colorazione per DAPI e proteine ​​leucemia promielocitica (PML) sono stati forniti come controlli. Clicca qui per vedere l'immagine ingrandita.

Figura 5
Figura 5. Decidualizzazione spontaneo di due cellule stromali endometriali primarie. (A) Schema di procedura sperimentale. (B) Upregulation di prolattina (PRL) eFattore di crescita insulino-simile Binding Protein 1 (IGFBP1) l'espressione genica in risposta a MPA e cAMP. I risultati sono stati misurati mediante RT-qPCR, e l'espressione è stata normalizzata a GAPDH. La significatività è stata calcolata utilizzando studenti t-test (P <0.001 *** e P <0.0001 ****). Entrambe le linee cellulari sono state isolate utilizzando il metodo del raschiamento. Clicca qui per vedere l'immagine ingrandita.

Primer Sequenza Ricottura temperatura (° C) Cicli Saggio
La prolattina (PRL) Forward CATATTGCGATCCTGGAATGAGC 60 40 SybrGreen
La prolattina (PRL) Reverse TCCTCAATCTCTACAGCTTTGGA 60 40 SybrGreen
Fattore di crescita insulino-simile proteina di legame 1 (IGFBP1)Avanti TCCTTTGGGACGCCATCAGTAC 60 40 SybrGreen
Fattore di crescita insulino-simile proteina di legame 1 (IGFBP1) Reverse GATGTCTCCTGTGCCTTGGCTA 60 40 SybrGreen
GAPDH Non specificato (vedi lista dei reagenti) 60 40 Taqman

Tabella 1. Condizioni di PCR per i marcatori decidualizzazione.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Altri gruppi hanno descritto e adattato metodologia per la preparazione di colture stromali endometriali, molti dei quali utilizzano collagenasi 4,12,13,15-18. In questo manoscritto, abbiamo fornito metodologia e prove per due metodi di coltura stromale semplificate primarie endometriali, entrambi i quali sono utilizzati dal nostro laboratorio per motivi economici e conveniente disponibilità di tripsina e / o una lama di rasoio.

Quando si confrontano i nostri due metodi, entrambi generano successo colture primarie vitali. Il nostro metodo preferito è il metodo tripsina in quanto vi è in genere un rendimento superiore con un requisito piccola dimensione del campione. Tuttavia, se il tempo di preparazione è limitato, il metodo di raschiatura richiede 30 minuti mentre placcatura cellule utilizzando il metodo tripsina richiede più di un'ora e mezza.

Da segnalare anche che noi dimostriamo questi metodi con i campioni di isterectomia al contrario di biopsie endometriali. Bio endometrialepsies sono prese senza significative intrusioni e tendono a produrre esemplari più piccoli. Ancora, i metodi descritti in questo manoscritto (in particolare il metodo tripsina) dovrebbero produrre colture da biopsie endometriali.

Ci sono numerose applicazioni per le cellule stromali endometriali primarie. Confronto tra culture stromali endometriali da umano rispetto agli altri mammiferi può fornire indizi per le domande che sono state dibattute per secoli sul perché gli esseri umani mestruazioni. Ci sono altri studi di fisiologia inesplorate che richiedono la coltura in vitro. Di particolare interesse sono le scoperte che forniscono intuizioni eventi del ciclo riproduttivo come i risultati che sono collegati eventi molecolari epigenetici agli eventi funzionali del ciclo riproduttivo 19,20, 21, e recensiti Rif. ​​11.

I medici potrebbero trarre grandi vantaggi da studiare la cultura dello stroma endometriale e l'identificazione di biomarkers nei casi di disordini riproduttivi e neoplasie tumorali. Tra il 2006 e il 2010, è stato riferito che 7,4 milioni di donne ei loro partner hanno utilizzato servizi di infertilità negli Stati Uniti 22. Una percentuale significativa di infertilità è dovuta al fallimento di decidualizzazione 23. Inoltre, è solo di recente sta valutando la relazione tra patologie endometriali quali iperplasia e l'endometriosi alla sterilità. La capacità di studiare i tumori ginecologici uterini attraverso la modellazione in vitro è anche preziosa perché, anche se advanced sarcoma endometriale è rara, può essere letale. Stabilendo in colture primarie in vitro, si studia l'impatto degli eventi molecolari associati alle malattie e in grado di generare applicazioni cliniche putativi.

In conclusione, generando rappresentativo ed efficace in modelli in vivo per molte di queste applicazioni è difficile. Questo rende lo sviluppo di unvitro colture endometriali primarie per studiare diverse funzioni in vivo critica. Questi due metodi di isolamento endometriali, "il metodo scraping" e "il metodo tripsina," contribuirà a fornire il punto d'appoggio per la nostra comprensione della fisiologia e patologia endometriale.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Gli autori non hanno nulla da divulgazione.

Acknowledgements

Ringraziamo gli sforzi di collaborazione del Dr. Thao Dang ed i membri del suo laboratorio per l'uso delle loro apparecchiature di imaging e microscopio. Ringraziamo anche il Biorepository e Tissue Research Facility (BTRF) nucleo, Jeff Harper, ei residenti presso l'Università della Virginia per averci fornito con il tessuto uterino. Ringraziamo Karol Szlachta per l'aiuto con schematica panoramica.

Materials

Name Company Catalog Number Comments
0.25 Trypsin or 0.05% Trypsin  Hyclone SH3023602 or SH30004202
1.7 micro Centrifuge Tube   Genesee Scientific 22-272A
1 µl, 20 µl, 200 ml and 1,000 µl Pipette   Genesee Scientific 24-401,24-402, 24-412, 24-430
15 ml Conical Tube  Hyclone 339650
50 ml Conical Tube  Hyclone 339652
6 cm Cell Culture Dish  Thermo scientific 12-556-002
8 well Chambers  Thermo Scientific AB-4162
Acetate  Fisher scientific C4-100
AMV RT Enzyme/Buffer  Bio Labs M077L
Bovine Serum Albumin (BSA)  Fisher Scientific BP-1605-100
Buffered Zinc Formalin  Thermo 59201ZF
Charcoal strip FBS  Fisher NC9019735
Chloroform  Fisher Scientific BP1145-1
Cover slip  Fisher Brand 12-544D
Cyclic AMP (cAMP)  Sigma B7880
DMEM/High Glucose  Hyclone SH30243FS
dNTP  Bioline BIO-39025
Donkey Anti Goat -TRITC  Santa Cruz SC-3855
Donkey Serum  Jackson’s lab 017-000-002
E Cadherin Antibody   Epitomics 1702-1
Ethanol  Fisher Scientific BP2818-1
Fetal Bovine Serum (FBS)  Fisher Scientific 03-600-511
Fungizone Amphotericin B  Gibco 15290-018
GAPDH Probe  Life Technologies HS99999905
Glycogen  5Prime 2301440
Goat Anti Mouse - FITC  Jackson’s Lab 115-096-003
Isopropanol  Fisher Scientific BP2618-1
Kanamycin   Fisher Scientific BP906-5
Medroxyprogesterone acetate (MPA)  Sigma M1629
MeOH (Methanol)  Fisher Scientific A4-08-1
Mounting Media (w/DAPI)  Vector Labratories H-1500
N6 DNA Oligos  Invitrogen
Number 15 Scraper   BD 371615
Pan Cytokeratin  Mouse mAB  Cell Signaling 4545
PBS (phosphate buffered saline)  Fisher Scientific BP-399-4
Penicillin-Streptomycin Glutamine Solution 100X   Hyclone SV30082.01
PML Anti Goat Anti body  Santa Cruz SC-9862
Primer(s)  Eurofins
RPMI  Hyclone SH30027FS
RPMI (Phenol free)  Gibco 11835
Sybr Green   Thermo Scientific AB-4162
Taqman  Thermo AB-4138
Trizol  Life Technologies 15596018
Vimentin Antibody  Epitomics 4211-1

DOWNLOAD MATERIALS LIST

References

  1. Heller, D. in The endometrium: a clinicopathologic approach. Heller, D. 56-75 (1994).
  2. Emera, D., Romero, R., Wagner, G. The evolution of menstruation: a new model for genetic assimilation: explaining molecular origins of maternal responses to fetal invasiveness. Bioessays. 34, 26-35 (2011).
  3. Gudjonsson, T., Villadsen, R., Ronnov-Jessen, L., Petersen, O. W. Immortalization protocols used in cell culture models of human breast morphogenesis. Cell Mol Life Sci. 61, 2523-2534 (2004).
  4. Brosens, J. J., Hayashi, N., White, J. O. Progesterone receptor regulates decidual prolactin expression in differentiating human endometrial stromal cells. Endocrinology. 140, 4809-4820 (1999).
  5. Jones, M. C., et al. Regulation of the SUMO pathway sensitizes differentiating human endometrial stromal cells to progesterone. Proc Natl Acad Sci U S A. 103, 16272-16277 (2006).
  6. Salamonsen, L. A., et al. Proteomics of the human endometrium and uterine fluid: a pathway to biomarker discovery. Fertil Steril. 99, 1086-1092 (2013).
  7. Haouzi, D., Dechaud, H., Assou, S., De Vos, J., Hamamah, S. Insights into human endometrial receptivity from transcriptomic and proteomic data. Reprod Biomed Online. 24, 23-34 (2012).
  8. Chen, J. I., et al. Proteomic characterization of midproliferative and midsecretory human endometrium. J Proteome Res. 8, 2032-2044 (2009).
  9. Talbi, S., et al. Molecular phenotyping of human endometrium distinguishes menstrual cycle phases and underlying biological processes in normo-ovulatory women. Endocrinology. 147, 1097-1121 (2006).
  10. Punyadeera, C., et al. Oestrogen-modulated gene expression in the human endometrium. Cell Mol Life Sci. 62, 239-250 (2005).
  11. Ponnampalam, A. P., Weston, G. C., Susil, B., Rogers, P. A. Molecular profiling of human endometrium during the menstrual cycle. Aust N Z J Obstet Gynaecol. 46, 154-158 (2006).
  12. Zhang, L., Rees, M. C., Bicknell, R. The isolation and long-term culture of normal human endometrial epithelium and stroma. Expression of mRNAs for angiogenic polypeptides basally and on oestrogen and progesterone challenges. J Cell Sci. 108, (1), 323-331 (1995).
  13. Richards, R. G., Brar, A. K., Frank, G. R., Hartman, S. M., Jikihara, H. Fibroblast cells from term human decidua closely resemble endometrial stromal cells: induction of prolactin and insulin-like growth factor binding protein-1 expression). Biol Reprod. 52, 609-615 (1995).
  14. Gellersen, B., Brosens, J. Cyclic AMP and progesterone receptor cross-talk in human endometrium: a decidualizing affair. J Endocrinol. 178, 357-372 (2003).
  15. Marsh, M. M., Hampton, A. L., Riley, S. C., Findlay, J. K., Salamonsen, L. A. Production and characterization of endothelin released by human endometrial epithelial cells in culture. J Clin Endocrinol Metab. 79, 1625-1631 (1994).
  16. Siegfried, J. M., Nelson, K. G., Martin, J. L., Kaufman, D. G. Histochemical identification of cultured cells from human endometrium. In Vitro. 20, 25-32 (1984).
  17. Rawdanowicz, T. J., Hampton, A. L., Nagase, H., Woolley, D. E., Salamonsen, L. A. Matrix metalloproteinase production by cultured human endometrial stromal cells: identification of interstitial collagenase, gelatinase-A, gelatinase-B, and stromelysin-1 and their differential regulation by interleukin-1 alpha and tumor necrosis factor-alpha. J Clin Endocrinol Metab. 79, 530-536 (1994).
  18. Dimitriadis, E., Robb, L., Salamonsen, L. A. Interleukin 11 advances progesterone-induced decidualization of human endometrial stromal cells. Mol Hum Reprod. 8, 636-643 (2002).
  19. Sakai, N., et al. Involvement of histone acetylation in ovarian steroid-induced decidualization of human endometrial stromal cells. J Biol Chem. 278, 16675-16682 (2003).
  20. Logan, P. C., Ponnampalam, A. P., Steiner, M., Mitchell, M. D. Effect of cyclic AMP and estrogen/progesterone on the transcription of DNA methyltransferases during the decidualization of human endometrial stromal cells. Mol Hum Reprod. 19, 302-312 (2013).
  21. Tamura, I., et al. Induction of IGFBP-1 expression by cAMP is associated with histone acetylation status of the promoter region in human endometrial stromal cells. Endocrinology. 153, 5612-5621 (2012).
  22. American Society for Reproductive Medicine: Quick facts about infertility. Available from: http://www.asrm.org/detail.aspx?id=2322 (2013).
  23. Salker, M., et al. Natural selection of human embryos: impaired decidualization of endometrium disables embryo-maternal interactions and causes recurrent pregnancy loss. PLoS One. 5, (2010).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics