Metodi per la pelle Ferimento e saggi per risposte ferita

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations

Xu, S., Chisholm, A. D. Methods for Skin Wounding and Assays for Wound Responses in C. elegans. J. Vis. Exp. (94), e51959, doi:10.3791/51959 (2014).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Il C. elegans epidermide e cuticola formano uno strato di pelle ma sofisticato semplice che può riparare i danni localizzati derivanti da ferire. Studi di risposte ferita e riparazione di questo modello hanno illuminato la nostra comprensione del citoscheletro e risposte genomiche per danni ai tessuti. I due metodi più comunemente usati per la ferita C. elegans pelle adulta sono punture con aghi microiniezione e irraggiamento laser locale. Ago ferendo localmente interrompe la cuticola, epidermide, e matrice extracellulare associati, e può anche danneggiare i tessuti interni. Risultati irradiazione laser a danni più localizzato. Ferimento innesca una serie di reazioni prontamente analizzati, tra cui elevata epidermica Ca 2+ (secondi minuti), la formazione e la chiusura di un anello-actina contenenti presso il sito della ferita (1-2 ore), elevata la trascrizione di geni peptidi antimicrobici (2-24 hr), e formazione di cicatrici. In sostanza tutti gli animali adulti wild type sopravvivono ferimento, dovecome mutanti difettose nella riparazione delle ferite o altre risposte mostrano ridotta sopravvivenza. Vengono presentati i protocolli dettagliati per ago e il ferimento laser, e saggi per la quantificazione e la visualizzazione delle risposte della ferita e dei processi di riparazione (dinamica Ca, dinamiche actina, induzione peptide antimicrobico, e la sopravvivenza).

Introduction

Pelle ferita meccanismi di guarigione sono di interesse biologico di base e rilevanti per la salute umana. La guarigione delle ferite nei vertebrati e mammiferi comprende una complessa serie di risposte coordinate di diversi tessuti e di segnalazione 1. Molti semplici organismi modello genetico sono anche in grado di guarire le ferite della pelle 2. È quindi interessante analizzare modelli geneticamente trattabili di riparazione delle ferite della pelle. Noi e altri abbiamo iniziato a utilizzare Caenorhabditis elegans come nuovo modello per la pelle ferita guarigione 3,4. L'obiettivo di questo protocollo è quello di consentire una più ampia serie di ricercatori da utilizzare C. elegans come strumento per indagare i meccanismi molecolari e cellulari della epidermica guarigione delle ferite.

Il C. pelle elegans comprende l'epidermide (noto anche come ipoderma) e la cuticola extracellulare 5. L'epidermide adulto è formato da un piccolo numero di sincizi multinucleate, di cui il più grande è il sincizio known come hyp7. L'epidermide è un epitelio semplice che secerne cuticola sulla sua superficie apicale. La pelle può difendere attivamente contro gli agenti patogeni-pelle penetrante e riparare piccole ferite 4. Riparazione della ferita del C. pelle elegans è robusto, come quasi tutti i tipi di animali selvatici sopravvivono possono sopravvivere piccole punture provocate da aghi, o danni alla pelle locale causati da irraggiamento laser. C. elegans pelle ferimento innesca una serie di reazioni, tra cui una risposta epidermica innata immunitaria, la chiusura della ferita, e la formazione di cicatrici 4. L'epidermide adulti è post-mitotico, e la guarigione delle ferite comporta risposte cellulari locali in contrasto con la proliferazione epidermica o la migrazione delle cellule. Abbiamo dimostrato che il ferimento pelle innesca un grande e costante aumento in epidermica Ca 2+, che richiede il canale di membrana TRPM GTL-2 e interni di Ca 2+ negozi 3. Il segnale è richiesto epidermica Ca 2+ per la formazione e la chiusura di anelli F-actina al wound sito. Ferimento induce anche le risposte immunitarie innate che attivano la trascrizione di AMP, come la PNL-29. La trascrizione ferimento indotto di AMP è dipendente da un TIR-1 / PMK-1 p38 MAP chinasi cascade agire autonomamente nell'epidermide 4. Difetti in entrambi la segnalazione via Ca 2+ o nella risposta immunitaria innata porterà alla sopravvivenza inferiore post-ferimento. La struttura relativamente semplice del C. elegans epidermide, la sua trattabilità genetica e vantaggi per imaging in vivo ne fanno un sistema eccellente per studiare i molteplici aspetti di riparazione delle ferite.

Qui vi presentiamo i protocolli per i due metodi comuni di ferimento: ferimento ago e ferimento laser. Ferimento dell'ago non richiede attrezzature specializzate (diverso estrattore ago), e con esperienza può essere eseguita su centinaia di vermi al giorno. Ferimento ago viene eseguita su animali in crescita su piastre di agar. Al contrario, ferimento laser viene eseguita su anesanimali thetized montati su agar pad sotto un coprioggetto, ed è adatto per l'imaging dal vivo delle risposte cellulari al danno.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

I seguenti protocolli descrivono la procedura dettagliata per C. pelle elegans ferendo e per saggiare le risposte ferite.

1. Ago Ferimento 3,4

  1. Crescere vermi unstarved sani sullo standard NGM (terreno di crescita nematode) piatti con E. batteri coli OP50 come cibo, mantenute in un incubatore a 20 °.
    NOTA: I metodi per piastre di agar NGM e la coltivazione di routine di C. elegans può essere trovato alla www.wormbook.org 6.
  2. Scegli 25 L4 vermi stadio ad un appena seminato piatto 1 giorno prima ferendo e cultura a 20 ° CO / N.
  3. Prima di ferimento, tirare aghi da capillari con un estrattore ago. Gli aghi utilizzati in ferimento sono identici a quelli utilizzati per microiniezione di C. elegans.
  4. Assicurarsi che tutti i vermi sono al giovane stadio adulto. Posizionare la piastra di vermi su ghiaccio per circa 30 min. Raffreddamento induce gli animali ad essere lenta, facilitando ago ferimento.
  5. Rimuovere la piastra di agar dal ghiaccio di uno stereomicroscopio dissezione. Utilizzando un pick verme, spostare 25 vermi nel centro della piastra di agar.
  6. Posizionare l'ago in un puntale 100 microlitri di tenere più facilmente l'ago. Perforare la parte anteriore o posteriore del corpo della vite senza fine con l'ago, evitando gonade. In generale, tentare di ferire tra posteriore e anteriore della faringe gonadi, o tra gonade posteriore e il retto. Riutilizzo aghi molte volte, fino a quando non si rompono.
    NOTA: Assicurarsi che le ferite sono brevi, punture dolci che forare la cuticola e la pelle, penetrando ~ 5-10 micron nell'animale. L'ago deve entrare nel animal di circa un angolo retto rispetto alla pelle. Le ferite non devono causare danni evidenti agli organi interni, o rottura immediata del corpo. Osservare una piccola quantità di citoplasma trasudano per alcuni secondi dopo la ferita; Tuttavia, se i contenuti cellulari fuoriuscire per un periodo prolungato gli animali non sopravviverà. Per l'imaging ottimale, ferita la syncytium laterale epidermico (hyp7) o la cucitura laterale.
    NOTA: Questo procedimento comprende l'uso di un ago di vetro.
  7. Consentire worm di recuperare a RT poi cultura a 20 ° C. Giudicare il successo di ago ferita da un certo numero di saggi descritti di seguito. Superiore al 95% del tipo di animali selvatici a sopravvivere 24 ore dopo l'ago ferito nella fase adulta giovane. L'effetto di ferire in larve o anziani non è ancora stato ampiamente analizzato.

2. Laser Ferimento 3

Utilizzare irraggiamento laser a femtosecondi (800 nm) per eseguire ferite più precise.

  1. Preparare agar pannunci su un vetrino con il fuso 2% agar 7. Assicurarsi che le pastiglie sono simili ai pad agar utilizzati per l'imaging in tempo reale di C. elegans.
  2. Trasferire 10 giovani vermi adulti sul pad agarosio con vite senza fine ritiro, e aggiungere una goccia 2 ml di soluzione di 12 Levamisolo mm. Coprire gli animali e il liquido con un vetrino. Attendere 1-2 minuti per il worm per paralizzare.
  3. Posizionare il vetrino su un microscopio confocale spinning disk. Spostare lo stadio per trovare i vermi e concentrarsi sulle anteriore o posteriore sinciziale epidermide laterali con un obiettivo 100X (NA 1,4-1,46).
  4. Impostare la potenza del laser a femtosecondi a 140 mW (misurata prima l'obiettivo). Utilizzare il laser a femtosecondi ad una frequenza di ripetizione di 80 MHz.
    NOTA: due impulsi di 200 msec ciascuno (separati da 20 msec) sono sufficienti per il ferimento nelle nostre mani.
  5. Concentrarsi sulla superficie apicale della cellula epidermica e ferita l'epidermide. Osservare interruzione locale del citoplasma (bubbling), o sbiancamento locale of qualsiasi marcatore fluorescente usato.
    NOTA: Seguire le opportune procedure di sicurezza del laser quando si utilizza il laser a femtosecondi. Linea o punto di scansione con laser a femtosecondi, come quelli di due microscopi fotoni devono fornire potenza sufficiente per ferimento laser.
    NOTA: Anche se non abbiamo esperienza diretta di utilizzo di altri laser, in linea di principio ferimento dovrebbe essere possibile mediante laser UV convenzionali (come usato in C. elegans ablazioni cellulari). Facoltativamente, utilizzare un FRAP modulo (FRAP) sul disco rotante confocale per ferire l'epidermide (N. Pujol, comunicazione personale).

3. Visualizzazione di Epidermal Ca 2+ Risposte ad Ferimento

  1. Utilizzare transgenico C. elegans ceppi che esprimono Ca 2+ sensori (come quelli della serie GCaMP) nell'epidermide, sotto il controllo del promotore specifico epidermica adulto col-19 (Figura 1A; transgeni sono elencati NOTA: Abbiamo usato tdTomato come controllo interno per l'espressione del transgene come epidermica tdTomato fluorescenza è relativamente stabile e non interferisce con le immagini GCaMP.
  2. Sia ago e laser ferendone grilletto Ca 2+ elevazione nell'epidermide. Tuttavia, poiché l'ago ferimento non può essere facilmente eseguita su un disco confocale filatura, ferimento laser è preferibile per l'analisi quantitativa del Ca 2+ risposta (Figura 1).
  3. Acquisire le immagini lasso di tempo in modalità di acquisizione multidimensionale (intervallo di 2 secondi con 114 msec esposizione laser eccitazione) utilizzando un confocale spinning disk con obiettivo 100X (NA 1,4-1,46) e appositi set di filtri (filtri GFP lavorerà per GCaMP3).
    NOTA: Acquisire immagini time-lapse ogni 30 sec per circa 2 ore per esaminare il Ca 2+ respOnse a ferendone più di un corso di tempo più lungo.
  4. Utilizzando il software di analisi di immagine misurare la fluorescenza media GCaMP in dieci regioni equivalenti di interesse (ROI), cinque delle quali sono centrate sul citoplasma delle cellule epidermiche e cinque in background.
  5. Ottenere fluorescenza basale (F 0) calcolando la media di fluorescenza in 5 ROI nell'epidermide poi sottraendo la media di 5 ROI in background prima della ferita. Esprimere la variazione di fluorescenza Af come il rapporto di variazione rispetto alla linea di base [(F t -F 0) / F 0].

4. Visualizzazione di Dynamics F-actina dopo aver ferito

  1. NOTA: In risposta a spillo ferite, osservare un anello di actina nel sito della ferita che chiude progressivamente intorno alla ferita. Questa sezione protocollo saggi avvolti chiusura misurando il diametro dell'anello actina.
  2. Generare vermi transgenici che esprimono un indicatore F-actina come il moesina actina dominio Drosophila legame fusoGFP, espresse sotto il controllo di un promotore specifico epidermica come col-19 (Figura 2A) (transgene juIs352).
    NOTA: Abbiamo ottenuto risultati simili utilizzando altre vincolante marcatori dominio come Lifeact o F-tractin (risultati non pubblicati) actina.
  3. Eseguire ago ferendo on P col-19- GFP-moesina vermi transgenici. Dopo ago ferimento, osservare un anello di GFP-moesin intorno al sito della ferita da ~ 5 min. L'anello actina diventa più piccolo diametro e alla fine chiude 2-3 ore dopo il ferimento in animali wild type (Figura 2a).
  4. Preparare un tampone agar 2% su un vetrino e trasferire 10 vermi sul pad in 2 soluzione ul 12 Levamisolo mm. Immagine gli anelli GFP-moesina 1 ora dopo il ferimento usando la microscopia confocale convenzionali.
    NOTA: Utilizzare la microscopia confocale di acquisire z-stack (13 x 0,5 micron) di anelli di actina 1 ora dopo il ferimento.
  5. Misurare il diametro degli anelli actina dopo il ferimento. Per quantificare epidermica GFP-moesin, prima fare una proiezione di massima intensità del z-stack e quindi disegnare 4 scansioni di linea (a 45 ° tra loro) oltre l'anello GFP-moesin. Diametro dell'anello è definito come il picco medio della distanza di picco dei quattro scansioni linea (Figura 2B). Per gli anelli che sono già chiuse, il diametro è definito come 0 micron.
    NOTA: F-actina anelli sono convenientemente misurate 1 ora dopo il ferimento in quanto questo è a circa metà strada attraverso il processo di chiusura della ferita nel tipo selvatico. Anelli F-actina possono essere misurate in più punti di tempo per ricavare un corso a tempo di chiusura della ferita. Tempo lapse film di chiusura della ferita possono essere acquisiti tramite worm levamisolo-immobilizzato e spinning disk microscopia confocale.

5. Assay induzione di epidermico antimicrobici Peptidi

NOTA: Ferimento innesca anche le risposte immunitarie innate in C. pelle elegans. Trascrizione di geni che codificano peptidi antimicrobici (AMP) è induced nell'epidermide. NLP-29 (proteina neuropeptide-like) AMP è fortemente indotta da ferendo 4. Per saggiare quanto l'epidermide controlla l'espressione AMP dopo ferimento, usare i giornalisti transgenici o real-time PCR per rilevare i singoli livelli di trascrizione AMP.

  1. Transgenici test giornalista per la risposta immunitaria innata ferendo 4.
  2. Eseguire ago ferimento (come nel protocollo 1) su animali adulti che esprimono il reporter transgenico frIs7, che contiene P nlp-29- GFP e P col-12- DsRed come controllo interno. Osservare gli animali adulti illesi rosso scuro o arancione in un filtro passaggio lungo GFP.
    NOTA: Ferita wild-type vermi indurre P nlp-29-GFP espressione, ma non influirà P col-12 -dsRed, con conseguente vermi che appaiono di colore arancione, giallo o verde sotto GFP passaggio lungo l'illuminazione. La perdita della funzione dei geni nel pathway p38 MAPK, come PMK-1 o NSY-1 sarà bloccare nlp-29-GFPinduzione dopo ferendo 4. GFP P nlp-29- è espressa ad alti livelli in stadi larvali
  3. Effettuare test di induzione AMP in giovani animali adulti. Assicurarsi che gli animali di controllo illesi hanno bassi livelli di GFP.
    NOTA: P nlp-29- espressione GFP è anche indotta da stress osmotico 8, e può essere sensibile ad altri stress ambientali.
  4. 6 ore dopo il ferimento, segnare il numero di worm che hanno P nlp-29-GFP induzione (Figura 3) 9 con una fluorescenza dissezione portata con GFP filtro passa lungo.
    NOTA: A 1 ora post-ferimento P nlp-29- GFP è visibilmente indotto, raggiungendo un picco di circa 6 ore post-ferimento e poi rimanendo elevata fino a 24 ore dopo il ferimento. Quantificare l'espressione del 4,9 punteggio visivo. In alternativa, quantificare i livelli di espressione con una fluorescenza attivato verme sorter 4. Per il sorter verme, almeno 50 animali hanno bisogno di essere feriti.
  5. Real-time PCR per quantitating livelli di trascrizione dei singoli geni AMP. Livelli di trascrizione del dosaggio di diversi geni: nlp-29, nlp-30, cnc-1, e cnc-5.
  6. Eseguire ago ferendo on wild-type o vermi mutanti (vedi protocollo 1)
  7. Raccogliere 50 vermi feriti e 50 illesi vermi nei momenti desiderati (ad esempio, 3, 6, 24 ore) post-ferimento.
  8. Estratto di RNA utilizzando un kit commerciale seguendo le istruzioni del produttore.
  9. Eseguire la trascrizione inversa per ottenere totale cDNA 20 microlitri utilizzando un kit trascrittasi inversa commerciale.
  10. Per RT-PCR, utilizzare 0,2 microlitri cDNA (1/40) di ciascun campione in combinazione con un supermix verde con fluoresceina e 0,2 mM primers. Per confrontare la qualità RNA, utilizzare ama-1 o SNB-1 RT-PCR come riferimento; confrontare il livello di espressione relativa AMP normalizzando di controllo interno (AMA-1 o SNB-1), o confrontare induzione volte post-ferimento (induzione AMP in worms feriti / worm illesi) di normaalizing di controllo interno.
    NOTA: cnc-1 e cnc-5 sono caenacin famiglia peptidi antimicrobici la cui trascrizione è attivata da ferendone 10. In genere, l'ago ferimento induce l'espressione (~ 500 volte per cnc-1) per un corso tempo di 4 ore 10. Primers utilizzati nel lavoro pubblicato sono elencati nella Tabella 2.

6. Tenore di sopravvivenza dopo aver ferito

  1. NOTA: Ferimento attiva almeno due vie di segnalazione indipendenti nell'epidermide: Ca 2+ ferita dipendente riparazione percorso e l'innata percorso risposta immunitaria. Entrambi i percorsi sono necessari per la piena sopravvivenza del ferimento sterile. Per verificare se un mutante o un trattamento RNAi colpisce la guarigione della ferita, misurare la sopravvivenza a 24-48 ore dopo il ferimento. Facoltativamente, utilizzare test di durata della vita convenzionale per determinare l'effetto di ferire sulla longevità 4,9.
  2. Eseguire ago ferendo il giovane adulto (L4 + 24 ore) vermi (50 vermi, ripetere sevevolte RAL) seguenti sopra protocollo 1. Mantenere un numero equivalente di vermi illesi come controlli.
  3. Controllare la sopravvivenza ogni 24 ore (trasferimento vermi feriti ad una nuova piastra di agar ogni 24 ore). Osservare ~ 50% di sopravvivenza 24 ore dopo il ferimento in mutanti che sono difettosi nella riparazione delle ferite, come GTL-2 o tir-1, quando normalizzata per animali di controllo illesi. La morte è definito come una mancanza di risposta locomotoria toccare con vite senza fine ritiro.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Laser o ago ferimento attiveranno elevazione rapida e sostenuta in epidermiche livelli di Ca, come visualizzato con sensori Ca quali GCaMPs (Figura 1). L'elevazione Ca avviene in pochi secondi, e rimane elevata per decine di minuti. Needle ferendo riproducibile provoca la formazione di anelli F-actina in siti ferita (Figura 2); queste appaiono in pochi minuti, e gradualmente vicino oltre 1-2 ore dopo il ferimento. Anelli actina sono meno spesso si formano dopo più preciso ferimento laser. Sia ago e laser ferimento indurre espressione di epidermiche peptidi antimicrobici (Amp), come nlp-29, rilevate con i giornalisti trascrizionali (Figura 3). Induzione AMP è evidente entro 2-4 ore dopo il ferimento e dura circa 24 ore. Ferimento Ago del tipo selvatico non dovrebbe incidere in modo significativo la redditività (misurata a 24 ore dopo il ferimento) o durata.

Figura 1
Figura 1. ferimento laser innesca una Ca 2+ risposta nel C. epidermide elegans. (A) Epidermal GCaMP3 fluorescenza (P-19 col -GCaMP3 (juIs319)) livelli dopo femtosecondo ferimento laser. Vista laterale di epidermide in antero-corpo; x, ferita laser; N, epidermica nucleo. Spinning immagini confocale disco, codice intensità. UW: illeso, W:. Feriti (B) Quantificazione del GCaMP3 Af / F 0 a 20, 40, e 60 micron dal sito della ferita; traccia rappresentante. Cliccate qui per vedere una versione più grande di questa figura.

Figura 2
Figura 2. Ago ferimento innesca polimerizzazione intorno sito della ferita. (A) col-19- GFP-moesin (juIs352). Scala: 10 micron. UW: illeso, W:.. Feriti (B) Quantificazione del diametro dell'anello actina dalla scansione di linea, 4 linee scansioni per animale (linee tratteggiate rosse a pannello (A), WT) Clicca qui per vedere una versione più grande di questa figura.

Figura 3
Figura 3. Epidermal ferimento attiva la risposta immunitaria innata. Immagini rappresentative (WT illeso, ferito WT + 3 hr) di P NLP-29-GFP (frIs7) induzione dopo ago ferimento. Scala:. 200 micron Cliccate qui per visualizzare ungrande versione di questa figura.

Reporter Transgene Fluorescenza Allele
Calcio PCOL-19-GCaMP3; PCOL-19-tdTomato GFP / tdTomato juIs319 X
Actin PCOL-19-GFP :: moesina GFP juIs352 I
nlp-29 Pnlp-29-GFP / PCOL-12-DsRed GFP / DsRed frIs7 IV

Tabella 1. transgeni utilizzati nei test di risposta ferita. Questa tabella elenca transgeni disponibili presso il Caenorhabditis Genetics Center (http://www.cbs.umn.edu/research/resources/cgc) cromosomicamente integrato.

Sigla del gene Sequenza
nlp-29 F: cttctcgcctgcttcatggc
R: gtccgtatccaccatatcctcc
nlp-30 F: TTCTTCTCGCCTGCTTCATGG
R: CATAACCTCTACCATATCCACCG
cnc-1 F: gccattgtcgccatttcctc
R: cctccatacattggatatcctc
cnc-5 F: CTTCTTCTAGCAATGCTCGCTC
R: GTATCCTCCACCATACCCTCC
ama-1 F: ACTCAGATGACACTCAACAC
R: GAATACAGTCAACGACGGAG
SNB-1 F: tccagcagacacaagctcagg
R: gagacaacttctgatcacgctc

Tabella 2. Primer utilizzati per RT-PCR dei trascritti AMP. Concentrazione di lavoro è di 0,2 micron. SNB-1 funge da controllo interno.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

I metodi qui presentati per ago e ferimento laser offrono approcci complementari di valutazione della capacità dell'epitelio epidermica per riparare i danni. Ferimento laser è relativamente localizzato e (a seconda della configurazione laser) può essere limitato l'epidermide, mentre ferimento ago sconvolge l'epidermide, cuticola, e probabilmente membrane basali interni. Ago ferimento può assomigliare più accuratamente le ferite inflitte da agenti patogeni o danni meccanici in ambiente naturale. Come regola, ago ferimento richiede più pratica per ottenere precisi ferite che sono compatibili con la sopravvivenza degli animali. Le risposte cellulari di aghi e laser visualizzazione ferimento molte somiglianze. Tuttavia va osservato che la formazione di anelli actina non è riproducibile osservata dopo femtosecondi ferimento laser.

Una limitazione di puntura è che non è una ferita precisa: l'ago danneggia anche tessuti interni cui contributi a vite senza finesopravvivenza non sono stati indagati. Una eventuale modifica di questo protocollo sarebbe di combinare il sistema di microiniezione basato microfluidica-11 e reporter fluorescenti per eseguire più precisa ferimento fisico.

L'ago e laser metodi ferimento qui descritti sono semplici ma abbastanza alta intensità di manodopera, e nella migliore delle medie velocità, il che rende difficile l'utilizzo di approcci genomici o biochimici per la caratterizzazione della risposta ferita. Cuticola penetrante agenti patogeni come funghi o protozoi 12,13 possono essere consegnati ai più grandi popolazioni di animali, e possono scatenare reazioni che si sovrappongono con la risposta al ferimento, ma di introdurre ulteriori complessità di risposte specifiche patogeni. Altri lavori saranno tenuti a verificare se altri metodi abiotici quali bombardamento balistico 14 o array di strutture penetranti micromeccanici 15 possono essere adattati per ferimento larga scala.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
Agarose Denville Scientific CA3510-8
Plastic Petri plate Tritech Research T3308 60 mm
Levamisole Sigma L9756 12 mM
Borosilicate glass capillary World Precision Instruments 1B100F-4
Needle puller Sutter Instrument  P-2000
Worm pick (platinum wire) Tritech Research PT-9010
M9 solution Home-made 3 g KH2PO4, 6 g Na2HPO4, 5 g NaCl, 1 ml 1 M MgSO4, H2O to 1 liter. Sterilize by autoclaving
Trizol Invitrogen 15596026 Use 500 ml for 50 worms
iQ SYBR Green Bio-Rad 1708882
SuperScript III Invitrogen 18080-051
PCR machine Bio-Rad C1000/CFX96
96-well PCR tubes Bio-Rad MLL9601
Image analysis software Molecular Devices Metamorph

DOWNLOAD MATERIALS LIST

References

  1. Gurtner, G. C., Werner, S., Barrandon, Y., Longaker, M. T. Wound repair and regeneration. Nature. 453, 314-321 (2008).
  2. Sonnemann, K. J., Bement, W. M. Wound repair: toward understanding and integration of single-cell and multicellular wound responses. Annu Rev Cell Dev Biol. 27, 237-263 (2011).
  3. Xu, S., Chisholm, A. D. A Gαq-Ca2+ signaling pathway promotes actin-mediated epidermal wound closure in C. elegans. Curr Biol. 21, 1960-1967 (2011).
  4. Pujol, N., et al. Distinct innate immune responses to infection and wounding in the C. elegans epidermis. Curr Biol. 18, 481-489 (2008).
  5. Chisholm, A. D., Xu, S. The Caenorhabditis elegans epidermis as a model skin. II: differentiation and physiological roles. Wiley Interdiscip Rev Dev Biol. 1, 879-902 (2012).
  6. Stiernagle, T. Maintenance of C. elegans. WormBook : the online review of C. elegans biology. 1-11 Forthcoming.
  7. Bargmann, C. I., Avery, L. Laser killing of cells in Caenorhabditis elegans. Methods in cell biology. 48, 225-250 Forthcoming.
  8. Pujol, N., et al. Anti-fungal innate immunity in C. elegans is enhanced by evolutionary diversification of antimicrobial peptides. PLoS Pathog. 4, (2008).
  9. Tong, A., et al. Negative regulation of Caenorhabditis elegans epidermal damage responses by death-associated protein kinase. Proc Natl Acad Sci U S A. 106, 1457-1461 (2009).
  10. Zugasti, O., Ewbank, J. J. Neuroimmune regulation of antimicrobial peptide expression by a noncanonical TGF-beta signaling pathway in Caenorhabditis elegans epidermis. Nat Immunol. 10, 249-256 (2009).
  11. Zhao, X., et al. Microfluidic chip-based C. elegans microinjection system for investigating cell-cell communication in vivo. Biosensor., & Bioelectronics. 50, 28-34 (2013).
  12. Jansson, H. B. Adhesion of Conidia of Drechmeria coniospora to Caenorhabditis elegans Wild Type and Mutants. J Nematol. 26, 430-435 (1994).
  13. Hodgkin, J., Kuwabara, P. E., Corneliussen, B. A novel bacterial pathogen, Microbacterium nematophilum, induces morphological change in the nematode C. elegans. Curr Biol. 10, 1615-1618 (2000).
  14. Hochbaum, D., Ferguson, A. A., Fisher, A. L. Generation of transgenic C. elegans by biolistic transformation. J Vis Exp. (42), (2010).
  15. Hashmi, S., et al. Genetic transformation of nematodes using arrays of micromechanical piercing structures. BioTechniques. 19, 766-770 (1995).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics