Plasmid-afledt DNA Strand Displacement Gates til gennemførelsesforordning Chemical Reaction Netværk

Biology
 

Cite this Article

Copy Citation | Download Citations

Chen, Y. J., Rao, S. D., Seelig, G. Plasmid-derived DNA Strand Displacement Gates for Implementing Chemical Reaction Networks. J. Vis. Exp. (105), e53087, doi:10.3791/53087 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Introduction

Forudsigeligheden af Watson-Crick baseparring har tilladt dynamisk DNA nanoteknologi til at fremstå som en programmerbar måde at designe molekylære enheder med dynamiske egenskaber 1,2. Især DNA-streng forskydning - en programmerbar, konkurrencedygtig hybridiseringsreaktion - har vist sig at være en stærk mekanisme til engineering dynamiske DNA-systemer. I en DNA-streng fortrængningsreaktion, et indgående oligonukleotid forskyder en tidligere bundet "output" streng fra en komplementær bindingspartner. Flere sådanne reaktioner kan kædes sammen i multi-trins reaktion kaskader med en høj grad af kontrol over rækkefølgen og timingen af individuelle reaktion trin 3. DNA-streng forskydning kaskader er blevet anvendt til at skabe digitale og analoge molekylære kredsløb 4-7, omstillelig nanostrukturer 8-10, autonome molekylære motorer 11-15, og ikke-kovalente katalytiske forstærkere 13,16-21. Endvidere DNA enheder ved hjælp af reaktioner strengforskydning kan simuleres og designet til forskellige formål ved hjælp af computer-assisteret design software 22-24.

I øjeblikket, kemisk syntetiseret DNA tjener som det vigtigste materiale til DNA nanoteknologi. Men fejl i DNA-syntese-processen, og de resulterende ufuldkommen oligonukleotider, menes at begrænse udførelsen af ​​dynamiske DNA enheder ved at forårsage fejlagtige sidereaktioner. For eksempel "lække" reaktioner kan resultere i frigivelsen af ​​et output oligonukleotid, selv i fravær af en reaktion udløser. Disse virkninger er tydeligst i autokatalytiske reaktion kaskader, hvor selv en minimal mængde oprindelige lækage vil i sidste ende resultere i fuld aktivering af kaskaden 19,20. Omvendt reaktioner ofte ikke nå det forventede niveau for aktivering, fordi nogle komponenter ikke udløser selv i nærværelse af den tilsigtede input 7,25. For at gøre udførelsen af ​​DNA-baseretnanodevices svarende til deres biologiske protein-baserede modstykker, skal reduceres dramatisk sådan fejl modes.

Bakterielle plasmider eller andre biologiske DNA kunne tjene som et relativt billigt kilde til højt rent DNA for nanoteknologi. Store mængder DNA kan genereres ved replikation i bakterier og de iboende korrekturlæsning evner levende systemer sikre renheden af ​​det resulterende DNA. Faktisk har flere nylige papirer anerkendt den potentielle nytte af biologisk DNA til nanoteknologi applikationer 21,26-28. Imidlertid har det fuldt dobbeltstrengede natur plasmid-DNA hidtil forbudt dets anvendelse som et materiale til fremstilling af dynamiske DNA-enheder, som typisk består af flere oligonukleotider og indeholder både dobbeltstrengede og enkeltstrengede domæner. I en nylig papir 29 dette spørgsmål blev behandlet, og en ny DNA-gate arkitektur, der primært består af nicked dobbeltstrenget DNA (ndsDNA) var indføred.

Vigtigt er det, kan systemer af ndsDNA porte være konstrueret, at realisere den dynamik specificeret af nogen formel kemisk reaktion netværk (CRN) 29. ndsDNA porte kan således anvendes i princippet til at skabe dynamiske systemer, der udviser svingninger og kaos, bistabilitet og hukommelse, boolesk logik eller algoritmiske adfærd 30-38. For eksempel, ref. 29 viste en tre-reaktion CRN, der gav en molekylær implementering af en "konsensus" protokol, en type distribueret databehandling algoritme 29,39,40. Dette arbejde først demonstrerede en roman brug for CRN formalisme som en "programmeringssprog" for hurtigt at syntetisere funktionelle molekylære systemer (figur 1A).

Her en detaljeret protokol til udledning ndsDNA porte fra plasmid-DNA forudsat. Først er en gennemgang af sekvensen designprocessen. Derefter følger en forklaring på, hvordan syntetiske oligonukleotider, der indeholderporten sekvenser klones i plasmider og rækkefølge verificeret og forstærkes via bakteriekultur. Dernæst er det vist, hvordan ndsDNA porte kan afledes af plasmider ved enzymatisk behandling (se figur 2). Endelig er en fremgangsmåde til at teste gate adfærd ved at anvende fluorescens kinetik assays skitseret.

Reaktionsmekanisme
Som et eksempel, protokollen fokuserer på den katalytiske kemiske reaktion A + B-> B + C. Arten A, B og C ("signaler", figur 1b) alle svarer til en anden enkeltstrenget DNA-molekyle. Sekvenserne af disse molekyler er helt uafhængige og strengene ikke reagerer med hinanden direkte. Sekvenserne for alle signaler har to forskellige funktionelle domæner, dvs. undersekvenser, der fungerer sammen i reaktioner strengdeplacering: 1) en kort fodfæste domæne (etiketter ta, tb, tc), der bruges til initiering af strengforskydning reaction, og 2) en lang domæne (etiketter a, b, c), der bestemmer signal identitet.

Interaktioner mellem signal strenge medieret af hakker dobbeltstrengede DNA (ndsDNA) gate komplekser (kaldet Deltag AB og gaffel BC) og hjælpematerialer enkelt-strengede arter (<tr r>, <b tr>, <c tb> og <i tc >). Den formelle reaktion A + B-> B + C udføres gennem en række strengforskydning reaktionstrin, hvor hvert reaktionstrin udsætter fodfæste for en efterfølgende reaktion (figur 1B). I dette eksempel signaler A og B er oprindeligt frit i opløsning, mens signalet C er bundet til gaflen gate. Ved slutningen af reaktionen B og C er i opløsning. Mere generelt signaler der er bundet til en port er inaktive, mens signaler, der er frit i opløsning er aktive, det vil sige, de kan deltage i en streng forskydning reaktion somen indgang. Tidsforløbet af reaktionen følges ved hjælp af en fluorescerende reporter-strategien (figur 1C). I tidligere arbejde 29, blev det påvist, at denne reaktion mekanisme ikke kun realiserer den korrekte støkiometri, men også kinetikken for målet reaktion.

Protocol

1. Sequence Design

Bemærk: Sekvens design oversigt: I dette afsnit beskrives strategien for at designe plasmid-afledt DNA porte. Enzym sites placeret på hver ende af portene for at tillade frigivelse af fuldt dobbelt strandede porte efter fordøjelse. Nicking sites anbringes derefter således, at enzymer skaber nicks på toppen streng til at skabe de endelige ndsDNA porte. Endelig er de resterende sekvenser valgt således, at uafhængige domæner er ortogonale på hinanden og udviser ikke sekundær struktur.

  1. Placer Nt.BstNBI huldannelse stedet fire nukleotider væk fra 3'-enden af ​​hver langside domæne (a, b, c, r, og i). Placer Nb.BsrDI huldannelse sted på 5'-enden af hver langside domæne (a, b, c og r. Bemærk, at domænet har jeg ikke nogen Nb.BsrDI hakket stedet). Figur 2C viser den detaljerede sekvens visning af Deltag AB og gaffel BC porte.
  2. Placer PvuII restriktionssted i begge ender af ndsDNA porte, så PvuII spaltning kan frigive portene fra plasmider (se figur 2C).
  3. Design andre utvungne sekvenser ved at følge to principper: (a) elementer bør ikke udviser sekundære strukturer (DNA-strukturer kan forudsiges ved hjælp Nupack 41), og (b) alle domæner bør være ortogonale for at minimere krydstale.
  4. Placer ndsDNA sekvenser i centrum af en port skabelon. Placer 30-40 bp tilfældige spacersekvenser i begge ender af porten skabelon, hver spacer tjener som et unikt bindingssted for følgende Polymerase Chain Reaction (PCR).

2. Kloning af NdsDNA Gates i plasmider

Bemærk: Dette afsnit beskriver Gibson kloning metode til at indsætte 4 eksemplarer af porten i et plasmid rygrad.

  1. Bestil ndsDNA gate skabeloner som dobbelt-strenget genomiske blokke fra en DNA-producent (gate skabelon sekvenser er visti tabel 1; strenge forekommer i ndsDNA porte er vist i tabel 2; domæne niveau sekvenser er vist i tabel 3).
  2. Efter at have modtaget den bestilte DNA, dreje rør indeholdende genomiske blokke på 10,000-14,000 x g i 1 min for at sikre, at alle tørrede DNA er i bunden af ​​røret.
  3. Resuspender tørrede genomiske blokke i DNase-frit vand til opnåelse af en slutkoncentration på 10 ng / pl.
    Bemærk: Alternativt kan DNA resuspenderet under anvendelse 1x Tris ethylendiamintetraeddikesyre (EDTA) buffer (TE buffer: 10 mM Tris og 1 mM EDTA, pH 8,0). Men EDTA er et chelateringsmiddel for divalente kationer og kunne inhibere PCR.
  4. Generer 4 gate fragmenter med forskellige overlappende regioner gennem en standard-PCR med en High-Fidelity DNA-polymerase (se figur 3A). Primersekvenserne er beskrevet i tabel 4 (smeltetemperatur af disse primere er 62 ° C).
  5. Kør en 2% agarosegel ved 140 V i 30 minutter ved stuetemperatur (for en detaljeret agarosegelelektroforese protokollen, se 42) og sender de bånd svarende til hver PCR amplificerede fragment ud af gelen. Så oprense gelskiverne ved hjælp af en gelekstraktionskit (se Materialer) ifølge producentens anvisninger.
  6. Fordøje et højt kopital backbone (se materialer) med Pvull-HF og Pstl-HF ved 37 ° C i 1 time (se tabel 5) ifølge fabrikantens protokol. Pvull-HF og PstI-HF er høje fidelity restriktionsenzymer, som dramatisk reducerer uspecifikke nedskæringer.
  7. Kør en 1,5% agarosegel og skæres det lineariserede rygraden (typisk køre gelen ved 140 V for 30-40 min ved stuetemperatur). Derefter ekstraheres DNA fra gelen udsnit ved hjælp gelekstraktionskit i overensstemmelse med producentens anvisninger.
  8. Udfør Gibson samling 43 med den lineariserede vektor og oprensede PCR-fragmenter (se tabel 6 og figur 3B
  9. Transformer Gibson samling produktet fra trin 2.8 i Escherichia coli (E. coli) og pladen på en lysogeni Broth (LB) agarplade indeholdende ampicillin antibiotika (ved en koncentration på 100 ug / ml). Udfør transformation gennem elektroporation eller en varme chok metode 44,45, og anvende passende E. coli-stamme. Brug f.eks E. coli-stamme JM109 for varmechok transformation, og bruge DH5a elektrokompetente E. coli-celler til elektroporation.
    Bemærk: plasmidskelettet anvendte indeholder et ampicillinresistens kassette. Hvis du bruger et andet udvalg markør, skal du bruge passende antibiotika i stedet for Ampicillin.

3. Bakteriel Kultur Amplification og kvalitetskontrol

Bemærk: Dette afsnit beskriver masseproduktion og isolering af plasmider, der indeholder DNA-porte efter kvalitetskontrol.

  1. Pluk en enkelt kolonifra Ampicillin selektive plade fra trin 2.9 og inkuber en kultur af 3 ml beriget medium indeholdende ampicillin antibiotika (ved en koncentration på 100 ug / ml). Markerer kolonien, således at den kan anvendes i de efterfølgende eksperimentelle trin. Grow kulturen ved 37 ° CO / N med kraftig rystning (200-300 rpm). Typisk inkuberes i 16-24 timer.
  2. Uddrag plasmid-DNA fra bakteriekulturen ved hjælp af en mini-prep kit i overensstemmelse med producentens anvisninger.
  3. Mål det oprensede plasmid-DNA under anvendelse af et spektrofotometer ved at følge producentens instruktioner. Typiske udbytteintervaller fra 50-1,000 ng / pl.
  4. Få det ekstraherede plasmid-DNA sekventeret ved at sende prøven til et DNA-sekventering selskab. Sekvensprimere skal placeres omkring 100 nukleotider opstrøms og nedstrøms for området, der skal sekventeres; sekvenseringsprimeren for plasmidet (se materialer til plasmid) har følgende sekvens: ATTACCGCCTTTGAGTGAGC.
    Ingente: Hvis der er sekvens fejl eller rekombination i det indsatte ndsDNA porte, skal du vælge en anden koloni fra pladen fra trin 2.9. Følg trin 3,1-3,4 at kontrollere, at sekvenserne af de indsatte porte er korrekte.
  5. Efter at have kontrolleret, at sekvenserne er korrekte, vælge den tilsvarende koloni fra Ampicillin selektive plade (fra trin 2.9), og der inkuberes en kultur af 800 ml Terrific Broth (TB) indeholdende ampicillin antibiotika (ved en koncentration på 100 ug / ml). Grow kulturen ved 37 ° C i 16-24 timer med kraftig omrystning (200-300 rpm). TB især er velegnet til højt udbytte plasmid produktion.
    Bemærk: Alternativt kunne LB også anvendes til dyrkning af bakterier, selv om plasmidudbytte kan være et problem.
  6. Oprens DNA under anvendelse af en Maxi-prep kit i overensstemmelse med producentens anvisninger.
  7. Følg trin 3,3-3,4 at kontrollere, om sekvenserne er korrekte. Hvis nogen rekombination indtraf, se følgende note. Ellers gå videre til trin 4. <br /> Bemærk: En mulig problem her er, at flere kopier af indsatte porte i plasmidet kan rekombinere skyldes DNA-reparation. For at løse dette problem ved at bruge et E. coli stamme, der mangler recA-protein (et protein relateret til DNA-reparation), såsom JM109 eller DH5a at omdanne en tidligere sekvensverificeret plasmid (dvs. uden nogen sekvensfejl og rekombination). Så vælge en koloni fra denne plade, og verificere plasmidsekvensen ved at sende prøven til et DNA-sekventering selskab.

4. Enzymatisk Processing

Bemærk: Dette afsnit beskriver fremgangsmåden til at fordøje plasmiderne, således at de er skåret og hakker i de korrekte steder, og klar til at blive anvendt til kinetiske forsøg.

  1. Fordøje oprensede plasmid-DNA fra trin 3.7 med restriktionsenzym PvuII-HF i 1 time ved 37 ° C (se tabel 7). Typisk fordøje plasmidet med 4 enheder af PvuII-HF pr 1 mg plasmid. Høj fidelity restriktionsenzymer anbefales til brug, fordi de dramatisk reducere uspecifikke nedskæringer.
  2. Udfør ethanolpræcipitation på prøven.
    1. Tilsæt 2 ækvivalente rumfang iskold absolut ethanol til prøven.
    2. Inkuber blandingen ved -80 ° C i mindst 1 time (denne blanding kan også sidde ved -80 ° C til O / N).
    3. Der centrifugeres ved 10,000-14,000 xg ved 0 ° C i 30 minutter.
    4. Supernatanten fjernes.
    5. Tilføj 1.000 pi RT 95% ethanol til prøven, og vend 10-15 gange.
    6. Der centrifugeres ved 10,000-14,000 xg ved 4 ° C i 10 minutter.
    7. Fjern supernatanten og lufttørre på bænken i 10-20 min.
    8. Resuspender DNA pellets i et passende volumen af nukleasefrit H2O (typisk 100-200 ml). Tilføjelse mere end 200 pi vil generelt gøre prøven for fortyndet til anvendelse i kinetik eksperimenter.
  3. Mål resuspenderet DNA under anvendelse af et spektrofotometer efter manufacturer instruktioner.
  4. Digest slutte porte med hakket enzym Nb.BsrDI ved 65 ° C i 1 time under anvendelse af 4 enheder enzym pr 1 ug plasmid (se tabel 8); fordøje gaffel porte med hakket enzym Nt.BstNBI ved 55 ° C i 1 time under anvendelse af 8 enheder af enzym pr 1 ug plasmid (se tabel 9).
    Bemærk: Trin 4.2 fjerner enzym digestionspuffer og hjælper koncentrere portene til kinetiske forsøg. Trin 4.2 kan springes til slutte porte fordi både restriktionsenzym PvuII-HF og nicking enzym Nb.BsrDI dele den samme fordøjelse buffer. I trin 4.2.8, er nukleasefrit H2O anvendes i stedet for TE fordi EDTA er et chelateringsmiddel for divalente kationer og kan hæmme restriktionsenzymer, der har brug for disse ioner til at fungere.
    Bemærk: Tilføjelsen af overskydende mængder af enzymer kan føre til høje mængder af indledende kredsløb lækage (figur 4), som er mest sandsynligt forårsaget af over-fordøjelse 46. Dette spørgsmål can løses ved at optimere enzym mængder (se figur 4). Typisk række enzymer er fra 1-10 enheder / ug plasmid 1.

5. Udarbejdelse af enkeltstrengede oligonucleotider

Bemærk: Dette afsnit beskriver protokollen for resuspension og kvantificering af kemisk syntetiseret enkeltstrenget DNA (ssDNA), der skal bruges til signal tråde og ekstra strenge. For streng sekvenser se tabel 10. Bemærk, at følgende protokol er et eksempel på at forberede 10 uM ssDNA. Andre koncentrationer af ssDNA kan fremstilles på lignende måde.

  1. Efter at have modtaget oligoer fra DNA producent, dreje rør indeholdende DNA ved 10,000-14,000 x g i 1 min for at sikre, at alle tørrede DNA er i bunden af ​​røret.
  2. Resuspender DNA under anvendelse 1x Tris ethylendiamintetraeddikesyre (EDTA) buffer (TE buffer: 10 mM Tris og 1 mM EDTA, pH 8,0) for at opnå en slutkoncentration på 100 uM. Foreksempel resuspender 8 nmol af DNA i 80 pi TE-buffer.
  3. Bland 10 pi af DNA ved 100 uM med 90 pi molekylær vand i et mikrocentrifugerør, der skal opnå en slutkoncentration på 10 uM.
  4. Mål den nøjagtige koncentration af DNA-prøven ved hjælp af et spektrofotometer ved at følge producentens instruktioner. Følgende protokol giver et eksempel på, hvordan DNA-koncentration kan måles.
    1. Blank spektrofotometeret med 2 pi molekylær vand.
    2. Mål absorbansen ved 260 nm (A260) af DNA-prøven. Brug følgende ligning til at beregne bestanden koncentration.
      Bemærk: Koncentrationen Prøven er M = En 260 / ekstinktionskoefficient. Ekstinktionskoefficienten kan findes på specifikationen datablad af DNA fabrikanten.

6. Fremstilling af fluorescerende Reporters

Bemærk: Dette afsnit beskriverprotokol for at forberede Reporter C, kan andre fluorescerende reportere samles på samme måde.

  1. Bestille højtydende væskekromatografi (HPLC) oprensede oligonukleotider ROX- <c * TC *> (den øverste streng af Reporter C) og <c> -RQ (den nederste streng af Reporter C) fra DNA fabrikanten (se tabel 10 for sekvenser ).
  2. Efter at have modtaget den syntetiserede oligonukleotider, resuspender og kvantificere prøver som forklaret i trin 5.
  3. Bland reporter øverste og nederste strenge (dvs. ROX- <c * TC *> og <c> -RQ) i 1x Tris-acetat-EDTA (TAE) med 12,5 mM Mg2 + (se tabel 11 for detaljerede opskrift ). Bemærk, at her tilsættes 30% overskydende quencher mærket streng <c> -RQ at samle reporter, som sikrer, at alle fluorofor-mærkede strenge standset selv med ufuldkommen støkiometri.
  4. Anneale reporter C-komplekset ved hjælp af en termisk cycler, afkøling fra 95 ° C til 20 ° C med en hastighed på 1 ° C / min. Prøverne kan opbevares ved 4 ° C.

7. fluorescensmålinger

Bemærk: afsnit beskrives en generel protokol for fluorescens kinetik målinger (se figur 5 for den eksperimentelle procedure), og denne protokol vil blive brugt i trin 8, 9, og 10. Bemærk også, at denne protokol er til brug for en spektrofluorimeter. Alternativt kunne disse forsøg også udføres i en pladelæser selv følsomhed, well-til-brønd variationer og mangel på temperaturregulering i langvarige forsøg kan være et problem.

  1. Indstil temperaturregulator til 25 ° C, og vente på at temperaturen at stabilisere sig. Ved hjælp af en temperaturregulator kan reducere variation i signalet, der kan skyldes temperaturvariation.
  2. Indstil korrekte parametre for kinetik målinger i datafangst software af spektrofluorimeter. Detaljeret eksempel indstillinger er som følger:
    1. Indstil slidsen bredden til 2,73 nm for både excitations- og emissions- monokromatorer.
    2. Indstil integrationstiden til 10 sek for hver 60 sek time-point. Indstil den samlede måletid til 24 timer.
    3. Indstil excitation / emissionsbølgelængder, der passer til de fluoroforer, der anvendes i forsøget. Eksempel bølgelængder er som følger: ROX (588 nm / 608 nm), og TAMRA (559 nm / 583 nm).
  3. Tilføj nucleasefrit H2O og 10x trisacetatelektroforese EDTA buffer indeholdende 125 mM Mg2 + (10 x TAE / Mg2 +) til et syntetisk kvarts celle. Se tabel 12, 13 og 14 for eksempel mængder at bruge.
  4. Tilføj polyT strenge for at opnå en slutkoncentration på ~ 1 um (se tabel 12, 13 og 14 for volumener), og derefter vortex syntetiskekvarts celler til 10-15 sek. Generelt vil pipettespidser ikke-specifikt binder DNA. Tilføjelse høje koncentrationer af polyT tråde kan reducere denne ikke-specifikke binding fejl.
  5. Tilføj journalister og hjælpeudstyr tråde. Se tabel 12, 13 og 14 for eksempel mængder til at bruge. Bemærk, at for reporter kalibrering, er der ikke behov hjælpestoffer strenge.
  6. Tilsæt 10% natriumdodecylsulfat (SDS) for at opnå en slutkoncentration på 0,15% SDS. Bemærk: SDS bruges til at dissociere enzymer fra plasmidet afledt porte da enzymer kan forstyrre reaktionen strengen forskydning (se figur 6). SDS anbefales her i stedet for varme denaturering af enzymer for at undgå dissociation og ukorrekt rekombination af gate tråde, der kan skade kredsløbet funktionen.
  7. [Spring dette trin for reporter kalibrering.]
    1. Tilføj deltage og gaffel porte (se tabel 13 og 14 for volumen)den syntetiske kvartskuvetter og bland opløsningen ved pipettering op og ned i mindst 20 gange (ikke vortex kuvetten, fordi hvirvlende løsninger med SDS kan resultere i bobler, som vil påvirke fluorescens kinetik målinger).
    2. Også, flytte til følgende måletrin snarest muligt, fordi lækage reaktionen indleder umiddelbart efter tilsætning af deltage og gaffel portene til syntetiske kvartskuvetter.
  8. Placer de syntetiske kvarts celler i kammer i et spektrofluorimeter.
  9. Start kinetik måling.
  10. Efter 5 min på måling, tilføj input strenge (se tabel 12, 13 og 14 for volumener) til syntetiske kvartskuvetter og bland reaktionen ved pipettering op og ned i mindst 20 gange. Bemærk, at prøven bør blandes forsigtigt for at undgå bobler. Udfør dette trin, mens datafangst programmet er sat på pause for at undgå at måle signaler udløst af eksternelys.
  11. Optag reaktionskinetikken indtil den når steady state. Reaktionskinetikken vises på computeren.

8. Kalibrer Fluorescerende Journalister

Bemærk: Dette afsnit beskriver den protokol for at gøre kalibreringskurver af fluorescerende reportere. Kalibreringskurver vil blive anvendt til at konvertere vilkårlige fluorescensenheder til signal koncentration molær.

  1. Kalibrere fluorescerende reportere ifølge protokollen beskrevet i trin 7. Brug mængderne af reaktanterne og buffere som opsummeret i tabel 12 standard koncentration i dette eksempel er 50 nM (1x).; journalister er på 3x; input er 1x. For de tilfælde, hvor input <tc c> er på 0,25x, 0,5x, 0,75x, justere lydstyrken for nukleasefrit H2O tilsvarende for at holde det endelige volumen af hver reaktion til at være 600 pi. Et eksempel data er vist i figur 7A.
  2. Lav en kalibreringskurveReporter C ved en lineær tilpasning af de endelige fluorescensværdier mod den oprindelige koncentration af signalet C (Et eksempel kalibreringskurve er vist i figur 7B). Denne Kalibreringskurven kan anvendes til at konvertere vilkårlige fluorescensenheder til dets tilsvarende koncentration signal.

9. Kvantificer Koncentrationen af ​​plasmid-afledt ndsDNA Gates

Bemærk: Hver uafhængigt forarbejdet batch af plasmid-afledt ndsDNA porte resulterer i et andet udbytte af funktionelle porte, og dette afsnit beskriver en protokol til kvantificering af koncentrationen af ​​plasmid-afledt ndsDNA porte.

  1. Kvantificere koncentrationen af plasmid-afledt ndsDNA porte efter protokollen beskrevet i trin 7. Brug de mængder af reagenser som sammenfattet i tabel 13 Bemærk:. Tabel 13 beskriver et eksempel opskrift på gaffel BC kvantificering Deltag. AB og andre porte kan udføres på samme måde, men ved hjælp af forskellige input-strenge, hjælpetjenester tråde og journalister.
  2. Konverter den endelige fluorescens målte værdi i dette eksperiment til en koncentration på signal C under anvendelse af kalibreringskurven fra trin 8.2. Derefter tilbage-beregne ndsDNA gate koncentration. For eksempel en endelig fluorescens værdi for porten kvantificering eksperiment svarende til 25 nM signal C (0,5x) baseret på kalibreringskurven i figur 7B. Da bestanden af Fork BC fortyndes 40 gange i denne reaktion, bestanden koncentrationen af Fork BC porten er 1 uM.

10. Kinetik Målinger til Reaktion A + B-> B + C

Bemærk: Dette afsnit beskriver en protokol til test af DNA realisering af en formel kemisk reaktion ved hjælp af fluorescens-kinetik målinger.

  1. Omdanner kinetik måling ved at følge protokollen beskrevet i trin 7. Brug mængder af reagenser og buffere som opsummeret i Tabel 14.

Representative Results

For en funktionel test blev en DNA-implementering af bimolekylære katalytiske reaktion (dvs. A + B-> B + C) oprettet. Udførelsen af ​​plasmid-afledt porte blev sammenlignet med porte samlet af syntetisk DNA. Katalytiske reaktioner er en god test for gate renhed, fordi en defekt port kan irreversibelt fælde en katalysator, hvilket medfører en uforholdsmæssig stor virkning på mængden af produktet produceret 18,19. Samtidig vil en lille læk reaktion, der resulterer i untriggered frigivelse af den katalytiske signal lineært forstærkes, hvilket fører til en uforholdsmæssig fejlsignal. Eksperimentelle data for plasmid-afledt og syntetiseret porte er vist i figur 8B og 8C henholdsvis. I eksperimenterne er koncentrationen af signalet streng Et fast, mens mængden af den katalytiske signal B er varieret. Signal C anvendes til udlæsning forløbet af reaktionen uden at afbryde den katalytiskecyklus. Katalyse kan observeres i dataene, da reaktionerne nærmer sig deres afslutning selv med mængder katalysator B meget mindre end mængden af A. Da SDS ikke blev sat til eksperimenter udført med den syntetiserede system er reaktionshastighed (som kunne blive påvirket af tilsætning af SDS) ikke sammenlignet, og den analytiske fokus er i stedet på katalytisk omsætning (detaljeret som følger).

Yderligere analyse af den katalytiske omsætning af denne reaktion blev udført. Omsætningen er defineret som den mængde signal C fremstillet for hver katalysator B på et givet tidspunkt. Specifikt blev omsætningen beregnet ud fra eksperimentelle data ved at dividere lækage subtraheret signal C af den oprindelige mængde katalysator B tilsat. For en ideel katalytiske system, bør denne omsætning nummer lineært øges med tiden og være uafhængig af mængden af ​​katalysator, så længe substratet er ikke begrænsende. I et virkeligt system, kan defekte porte deaktivere kat alysts, og omsætningen vil nå en maksimal værdi, selv om ikke alle tilgængelige substrat omdannes til produkt. Den maksimale omsætning værdi angiver, hvor mange substrater (signal A) en katalysator (signal B) kan konvertere før han bliver inaktiveret. Her er det observeret, at det syntetiserede systemet afviger fra den ideelle lineære forøgelse af omsætningen meget tidligere end plasmidet afledt systemet gør, hvilket indikerer beslaglæggelse af katalysatoren gennem en uønsket sidereaktion (figur 8D). Omsætningen sammenligning vises kun for lave koncentrationer på grund ved høje koncentrationer af katalysatorer, vil alle porte udløses og slip signal C. Kredsløbet lækage også sammenlignet, og det iagttages, at forholdet mellem lækage signal ved hjælp plasmid-afledte porte er omkring 8% mindre end, at bruge syntetiserede porte efter 10 timer af reaktion (figur 8E).

iles / ftp_upload / 53087 / 53087fig1.jpg "/>
Figur 1. (A) CRNs tjene som en foreskrivende programmeringssprog. DNA-reaktion netværk kan manipuleres til at tilnærme dynamikken i en formel CRN (B) DNA implementering af et eksempel kemisk instruktion:. A + B-> B + C. DNA-strenge er tegnet som linjer med pile på 3'-enden og * angiver komplementaritet. Alle signal tråde A (<ta a>, grøn), B (<tb b>, orange), og C (<tc c>, rød) er bestod af én fodfæste domæne (mærket som ta, tb, og TC), og én identitet domæne (mærket som a, b og c). Den bimolekylære reaktion A + B-> B + C kræver to multi-strenget komplekser Deltag AB og gaffel BC, og fire ekstra tråde <tr r>, <b tr>, <c tb> og <i tc>. Reaktionen forløber gennem syv trin strengdeplacering, hvor hvert trin startens med fodfæste binding. (C) Reporter strategi. Reaktionen følges ved hjælp af en reporter, i hvilken nederste streng er mærket med en fluorofor (rød prik) og den øverste streng er bundet til en quencher (sort prik). På grund af co-lokalisering af fluoroforen og quencher, er reporter fluorescens quenchet i ubeskadiget reporter. Signalet C kan erstatte den øverste streng af reporteren, hvilket fører til en stigning i fluorescens. (Dette tal er blevet ændret fra Ref. 29) Klik her for at se en større version af dette tal.

Figur 2
Figur 2. (A) NdsDNA porte fremstillet af bakterielt plasmid-DNA. Flere kopier af det dobbeltstrengede ndsDNA gate skabelon klones i et plasmid. De klonede plasmider er den transformeret ind i E. coli-celler og kolonier på pladen er sekvensverificeret. Når sekvensen er bekræftet, plasmid-DNA forstærkes og ekstraheret. Endelig er den dobbeltstrengede plasmid forarbejdes til de ønskede ndsDNA porte ved enzymatisk behandling. (B) Enzymatisk behandling af ndsDNA porte. Restriktionsenzymet PvuII bruges til at frigøre porten fra plasmidet. De frigivne porte behandles yderligere under anvendelse af indsnit enzymer: Nb.BsrDI bruges til at generere nicks for samlingen AB (Panel I); Nt.BstNBI bruges til at generere nicks til Fork BC (Panel II). Begrænsning og indsnit steder er angivet som farvekodede bokse. (C) Sekvens visning af porten skabelon Deltag AB (Panel i) og gaffel BC (Panel ii). PvuII restriktionssted (fremhævet i lilla boks) Det er i begge ender af ndsDNA porte. Den Nb.BsrDI og Nt.BstNBI Indsnit steder er fremhævet med røde og sorte bokse, hhv. Placeringerne af skåret er markeret med pilespidser. Sequence N er ethvert nucleotid. (Dette tal er blevet ændret med tilladelse fra ref. 29) Klik her for at se en større version af dette tal.

Figur 3
Figur 3. (A) PCR af en DNA-gate skabelon. En DNA-gate skabelon indeholder de ndsDNA gate sekvenser i midten (en blå område), og spacer-sekvenserne i begge ender (sorte regioner; disse to endesekvenser er ortogonale). Primere kan binde til spacer sekvenser af porten skabelonen, og generere fire overlappende DNA-fragmenter via PCR (overlappende sekvenser er farvekodede i figuren). (B) Gibson forsamling. De fire DNA-fragmentering amplificeredets samles derefter i et lineariseret plasmid backbone ved Gibson samlingsmetode 43. (Dette tal er blevet ændret med tilladelse fra ref. 29) Klik her for at se en større version af dette tal.

Figur 4
Figur 4. Circuit ydeevne med forskellige enzym beløb. (A) En forenklet gengivelse af porten, reporter, hjælpematerialer tråde, og signal tråde anvendes til de tilsvarende forsøg. (B) Kinetik forsøg med plasmid-afledte Deltag AB behandlet med forskellige enzym mængder . jeg. 10 enheder af PvuII-HF og 45 enheder af Nb.BsrDI pr 1 ug plasmid; ii. 10 enheder af PvuII-HF og 4 enheder Nb.BsrDI pr 1 ug plasmid; iii. 4 enheder PvuII-HF og 4 enheder Nb.BsrDI pr 1 ug plasmid. Alle hjælpestoffer tråde var på 2x (1x = 10nM). Porten komplekset var 1,5x og forsøgene blev udført ved 35 ° C i 1 x TAE / Mg2 +. (Dette tal er blevet ændret med tilladelse fra ref. 29) Klik her for at se en større version af dette tal.

Figur 5
. Figur 5 Flow diagram af kinetik eksperimenter Blå:. Materialer til at føje til kuvette (0,875 ml syntetisk kvarts celle). Henvisning Tabel 14 for specifikke mængder for at tilføje til kinetisk eksperiment af A + B -> B + C. Green: Instruktioner i en spektrofluorimeter (mærket som SPEX). Rød: Blanding instruktioner.53087fig5large.jpg "target =" _ blank "> Klik her for at se en større version af dette tal.

Figur 6
Figur 6. Enzym dissociation og kredsløb adfærd. (A) En forenklet gengivelse af gate, reporter, hjælpematerialer tråde, og signal tråde anvendes til de tilsvarende forsøg. (B) Kinetik eksperimenter af plasmidet-afledte Deltag AB hjælp 80 ° C varme inaktivering (grønne spor), 0,15% natriumdodecylsulfat (SDS) (rød), og en kontrol uden varmeinaktivering eller tilføjelse af SDS (blå). Standarden koncentration var 1x = 10 nM, og alle ekstra tråde og indgang B var på 2x. Porten komplekset var 1,5x og forsøgene blev udført ved 35 ° C i 1 x Tris-acetat-EDTA-buffer indeholdende 12,5 mM Mg2 + (1x TAE / Mg2 + Ref. 29) Klik her for at se en større version af dette tal.

Figur 7
Figur 7. Reporter kalibrering. (A) Reporter C kinetik. Koncentrationen af reporter var på 3x (1x = 50 nM), og den indledende koncentration af signalet C er angivet i figuren. (B) Fluorescens-niveauer af signalet C ved måling slutpunkt (40 min) viser en lineær sammenhæng med startkoncentration på signal C. I en kvantificering eksempel på Fork BC gate (grøn stiplet linje), fluorescens værdien af Fork BC var foranstaltningd som 3 x 10 6 (AU), hvilket svarer til 25 nM (0,5x) baseret på kalibreringskurven. Klik her for at se en større version af dette tal.

Figur 8
Figur 8. Bimolekylære katalytiske reaktionskinetik (A + B-> B + C). (A) En forenklet gengivelse af porten, reporter, hjælpematerialer tråde, og signal tråde anvendt til de tilsvarende eksperimenter. Forsøg blev kørt i 1 x Tris-acetat-EDTA-buffer indeholdende 12,5 mM Mg2 + (1x TAE / Mg2 +). Alle gate komplekser var på 75 nM koncentration (1,5x), og hjælpestoffer strenge var på 100 nM koncentration (2x). Kinetik data for plasmid-afledte porte og data for syntetiserede porte er vist i (B) og (C) (D) Plasmid-afledte porte udviste større omsætning end syntetiseret DNA porte, hvor der blev tilsat små mængder af input. (E) Omfanget af lækage. Søjlediagrammet viser forholdet mellem den endelige lækage til den endelige signal (C B0 = 0 / C B0 = 1) i slutningen punkter (10 timer). (Dette tal er blevet ændret fra Ref. 29) Klik her for at se en større version af dette tal.

Gate Skabeloner Sekvenser Længde (nt)
JoinAB TCTAGTTCGATCAGAGCGTTATTACCAGTAGTCGATTGCTCAGCTGCTACATTGCTTCTACGAGTCATCCTTCCACCATTGCACCTTAGAGTCCGAATCCTACCATTGCTTAACCGAGTCTCACAACCAGCTGTCATTATGGACTTGACACACAGATTACACGGGAAAGTTGC 173
FORKBC TCTAGTTCGATCAGAGCGTTATTACCAGTAGTCGATTGCTCAGCTGCCATCATAAGAGTCACCATACCCACATTGCCACATCGAGTCCCTTTTCCACCATTGCACCTTAGAGTCCGAATCCTACCATTGCTTAACCGAGTCTCACAACCAGCTGTCATTATGGACTTGACACACAGATTACACGGGAAAGTTGC 194

Tabel 1. Sekvenser af ndsDNA gate skabeloner.

Port Strand Længde på nederste streng (nt)
JoinAB JoinAB-Bund, <a tb>, <b tr>, <r tq> 87
ForkBC ForkBC-Bund, <i>, <tc c>, <tb b>, <tr r> 108

Tabel 2. Strands omfatter Deltag AB og gaffel BC. (Denne tabel er blevet ændret fra Ref. 29)

Domæne Sekvens Længde (nt)
ta CTGCTA 6
tb TTCCAC 6
tc TACCCA 6
tr TCCTAC 6
tq AACCAG 6
-en CATTGCTTCTACGAGTCATCC 21
b CATTGCACCTTAGAGTCCGAA 21
c CATTGCCACATCGAGTCCCTT 21
r CATTGCTTAACCGAGTCTCAC 21
jeg CTGCCATCATAAGAGTCACCA 21
jove_content "fo: holde-together.within-side =" altid "fo: holde-med-previous.within-side =". altid "> Tabel 3 Domain niveau sekvenser for gennemførelse af kemiske reaktion A + B -> B + C . (Denne tabel er blevet ændret fra Ref. 29)

Primerstreng Sekvenser Længde (nt)
Forward primer-1 AAGAGAGACCACATGGTCCTTCTTGAGTTTGTAACAG CGTTATTACCAGTAGTCGATTGC 60
Revers primer-1 ACTACTATTTACTAATCCCATTGCGTGTTCTTATT TAATCTGTGTGTCAAGTCCATAATG 60
Forward primer-2 AATAAGAACACGCAATGGGATTAGTAAATAGTAGT CGTTATTACCAGTAGTCGATTGC 58
Revers primer-2 GCGAAACTAGCTTGTGGTGATATTGTCTCGTGTGT TAATCTGTGTGTCAAGTCCATAATG 60
Forward primer-3 ACACACGAGACAATATCACCACAAGCTAGTTTCGC CGTTATTACCAGTAGTCGATTGC 58
Revers primer-3 ACATTGTACGCCTAAATCATCAAGAATAATTGTTG TAATCTGTGTGTCAAGTCCATAATG 60
Forward primer-4 CAACAATTATTCTTGATGATTTAGGCGTACAATGT CGTTATTACCAGTAGTCGATTGC 58
Revers primer-4 GAGCGCAGCGAGTCAGTGAGCGAGGAAGCCTGCAG TAATCTGTGTGTCAAGTCCATAATG 60

Tabel 4. Primersekvenser til PCR af ndsDNA gate skabeloner.

Reagens Volumen for 1x reaktion (pi)
High-copy plasmid backbone (~ 300 ng / pl) 10
PvuII-HF (20.000 enheder / ml) 2
PstI-HF (20.000 enheder / ml) 2
10x Cut Smart buffer 2
H2O 4
Samlet volumen 20 d>

Tabel 5. Protokol for plasmidgrundstrukturen fordøjelse.

Reagens Volumen for 1x reaktion (pi)
DNA-vektor (~ 50 ng / pl) 1
PCR amplificerede fragment-1 (~ 50 ng / pl) 1
PCR amplificerede fragment-2 (~ 50 ng / pl) 1
PCR amplificerede fragment-3 (~ 50 ng / pl) 1
PCR amplificerede fragment-4 (~ 50 ng / pl) 1
2x Gibson Assembly Master Mix 5
Samlet volumen 10
s "fo: holde-med-previous.within-side =" altid "> Tabel 6 Protokol for Gibson forsamling..

Reagens Volumen for 1x reaktion (pi)
Plasmid-DNA (~ 1 pg / pl koncentration) 1.000
PvuII-HF (20.000 enheder / ml) 200
10x Cut Smart buffer 133,3
Samlet volumen 1333,3

Tabel 7. Protokol for ndsDNA porte indsat plasmid fordøje med Restriktionsenzymanalyse PvuII-HF.

Reagens Volumen (pi)
Tilmeld dig porte (~ 5 ug / ul koncentration) 150
Nb.BsrDI (10.000 enheder / ml) 300
10x Cut Smart buffer 50
Samlet volumen 500

Tabel 8. Protokol for slutte porte fordøje med nicking enzym Nb.BsrDI.

Reagens Volumen (pi)
Fork porte (~ 5 ug / ul koncentration) 150
Nt.BstNBI (10.000 enheder / ml) 600
10x NEB buffer 3.1 83.3
Samlet volumen 833,3

Tabel 9 Protokol for gaffel porte fordøje med nicking enzym Nt.BstNBI.

Strand Domæne Sekvens Længde (nt)
JoinAB-Bund tq * r * st * b * tb * a * ta * CTGGTT GTGAGACTCGGTTAAGCAATG GTAGGA TTCGGACTCTAAGGTGCAATG GTGGAA GGATGACTCGTAGAAGCAATG TAGCAG 87
FORKBC-Bund tq * r * st * b * tb * c * tc * i * CTGGTT GTGAGACTCGGTTAAGCAATG GTAGGA TTCGGACTCTAAGGTGCAATG GTGGAA AAGGGACTCGATGTGGCAATG TGGGTA TGGTGACTCTTATGATGGCAG 108
<ta a> CTGCTA CATTGCTTCTACGAGTCATCC 27
<tb b> ta en TTCCAC CATTGCACCTTAGAGTCCGAA 27
<tc c> tb b TACCCA CATTGCCACATCGAGTCCCTT 27
<a tb> tc c CATTGCTTCTACGAGTCATCC TTCCAC 27
<b tr> en tb CATTGCACCTTAGAGTCCGAA TCCTAC 27
<r tq> b tr CATTGCTTAACCGAGTCTCAC AACCAG 27
<i> r tq CTGCCATCATAAGAGTCACCA 21
<tr r> jeg TCCTAC CATTGCTTAACCGAGTCTCAC 27
<i tc> tr r CTGCCATCATAAGAGTCACCA TACCCA 27
<c tr> Jeg tc CATTGCCACATCGAGTCCCTT TCCTAC 27
<c tb> c tr CATTGCCACATCGAGTCCCTT TTCCAC 27
<b tr> c tb CATTGCACCTTAGAGTCCGAA TCCTAC 27
<i tb> b tr CTGCCATCATAAGAGTCACCA TTCCAC 27
<b tb> Jeg tb CATTGCACCTTAGAGTCCGAA TTCCAC 27
<b tc> b tb CATTGCACCTTAGAGTCCGAA TACCCA 27
<c tr> b tc CATTGCCACATCGAGTCCCTT TCCTAC 27
<b tr> c tr CATTGCACCTTAGAGTCCGAA TCCTAC 27
ROX- <c * TC *> b tr / 56-ROXN / AAGGGACTCGATGTGGCAATG TGGGTA 27
<c> -RQ c * tc * CATTGCCACATCGAGTCCCTT / 3IAbRQSp / 21
<TQ * R *> - TAMRA CTGGTT GTGAGACTCGGTTAAGCAATG / 36-TAMTSp / 27
RQ- <r> tq * r * / 5IAbRQ / CATTGCTTAACCGAGTCTCAC 21
r

. Tabel 10 Strand-sekvenser for gennemførelse af kemiske reaktion A + B -.> B + C (. Denne tabel er blevet ændret fra Ref 29)

Reagens Volumen (pi) Slutkoncentration
ROX- <c * tc *> ved 100 uM 10 10 pM (1x)
<c> -RQ ved 100 μM 13 13 pM (1,3x)
10x TAE med 125 mM Mg2 + 10 1x TAE med 12,5 mM Mg2 +
H2O 67 -
Samlet volumen 100 10 pM (1x)

Tabel 11. Protokol til samling Reporter C.

Reagens Volumen (pi) Slutkoncentration
H2O 514 -
10x TAE med 125 mM Mg2 + 60 1x TAE med 12,5 mM Mg2 +
PolyT ved 300 μM 2 1 uM
Reporter C ved 10 uM 9 150 nM (3x)
10% SDS 9 0,15%
<tc c> ved 5 uM 6 50 nM (1x)
Samlet volumen 600 -

Tabel 12. Protokol for kalibrering af Reporter C. De her mængder er til et samlet reaktionsvolumen på 600 pi (svarende til anvendelsen af en 0,875 ml syntetisk kvarts celle), men kan justeres til at arbejde med forskellige størrelse celler.

<td> 600
Reagens Volumen (pi) Afsluttende concentrering
H2O 493 -
10x TAE med 125 mM Mg2 + 60 1x TAE med 12,5 mM Mg2 +
polyT ved 300 uM 2 1 uM
Reporter C ved 10 uM 9 150 nM (3x)
<i TC> 100 uM 3 10x
<c tb> ved 100 uM 3 10x
<b tr> ved 100 uM 3 10x
10% SDS 9 0,15%
Gaffel BC på ~ 1 uM (koncentration ukendt) 15 ~ 0.5x
<r tq> 100 uM 3 10x
Samlet volumen -

Tabel 13. Protokol til kalibrering af Fork BC. De her mængder er til et samlet reaktionsvolumen på 600 pi, men kan justeres til at arbejde med forskellige størrelse celler.

Reagens Volumen (pi) Slutkoncentration
H2O 407,2 -
10x TAE med 125 mM Mg2 + 52,8 12,5 mM Mg2 +
polyT ved 300 uM 2 1 uM
Reporter C ved 10 uM 9 150 nM (3x)
<i TC> ved 10 uM 6 100 nM (2x)
<c tb> 10 uM 6 100 nM (2x)
<b tr> ved 10 uM 6 100 nM (2x)
<tr r> 10 uM 6 100 nM (2x)
10% SDS 9 0,15%
Deltag AB ved 1 uM 45 75 nM (1.5x)
Gaffel BC ved 1 uM 45 75 nM (1.5x)
<ta a> 10 uM 3 50 nM (1x)
<tb b> 10 uM 3 50 nM (1x)
Samlet volumen 600 -

Tabel 14. Protokol for en kemisk reaktion A + B-> B + C. De her mængder er til et samlet reaktionsvolumen på 600 pi, men kan justeres til at arbejde med forskellige størrelse celler.

Syntetiserede porte Plasmid-afledte porte
Beskrivelse Koste Deltag porte Fork porte
SIDE renset lang streng (100 nt; tjente som de nederste dele af en port) ~ 75 $ Beskrivelse </ strong> Koste Beskrivelse Koste
SIDE renset korte streng (~ 30 nt, tjente som øverste strenge af en port) ~ 185 $ Gate skabelon ~ 100 $ Gate skabelon ~ 100 $
Total ~ 260 $ Plasmid ekstraktionskit ~ 26 $ Plasmid ekstraktionskit ~ 26 $
Restriktionsenzym (Pvull-HF) ~ 11 $ Restriktionsenzym (Pvull-HF) ~ 11 $
Hakket enzym (Nt.BsrDI, Deltag gates) ~ 29 $ Hakket enzym (Nt.BstNBI, Fork gates) ~ 62 $
Total ~ 166 $ Total ~ 199 $

fo:.. holde-med-previous.within-side = "altid"> Tabel 15 Omkostninger sammenligning mellem plasmid-afledte porte og syntetiseret porte (. Denne tabel er blevet ændret fra Ref 29)

Syntetiserede porte Plasmid-afledte porte
Forarbejdning Behandlingstid Forarbejdning Behandlingstid
Annealing 1 time Kloning 5 timer
SIDE rensning 2 timer Plasmid ekstraktion 2 timer
Total 3 timer To trin enzymfordøjelse 0,5 timer
Ethanoludfældning
Total 8,5 timer

Tabel 16. Behandlingstid sammenligning mellem plasmid-afledte porte og syntetiske porte. (Denne tabel er blevet ændret fra Ref. 29)

Discussion

Dette papir beskriver en fremgangsmåde til udledning ndsDNA porte fra meget rent plasmid-DNA. Desuden er en protokol præsenteres til karakterisering gate ydelse med et fluorescens kinetik assay. Eksperimentelle data viser, at plasmidet afledt systemet overgår dets syntetiske modstykke selvom det syntetiske systemet er samlet af strenge oprenset under anvendelse af polyacrylamidgelelektroforese (PAGE). Sandsynligt, forbedrede ydeevne plasmid-afledte porte er primært på grund af meget høj renhed af den biologiske DNA. Syntetisk DNA indeholder en række fejl, især deletioner, der resulterer i oligonukleotider med en længde n-1, og sådanne biprodukter bliver typisk ikke fjernet fuldstændigt i PAGE eller højtydende væskekromatografi (HPLC) oprensningsprocedurer. Lignende forbedringer dem rapporteret her blev også observeret i en tidligere undersøgelse af en katalyseret hårnål forstærker, brugt DNA fra biologiske kilder 21.

(se figur 4). For det andet, i disse forsøg, de fleste input og hjælpestoffer strenge blev syntetisk DNA og dermed indeholdt deletioner og mutationer. I princippet kunne alle enkeltstrenget input og hjælpestoffer tråde også opnås fra phagmid DNA gennem en nicking enzym spaltning af præ-kodede M13 virale genom 26. Måske kredsløbet ydeevne kan forbedres yderligere ved hjælp af ssDNA afledt af det bakterielle genom.

Mens fandtes anvendelse af plasmid-afledt porte til at forbedre kredsløbet ydeevne, en analyseaf omkostningerne og sagsbehandlingstider afslørede, at mens produktionen af plasmid-afledte porte er lidt billigere (tabel 15), tager det 2-3 gange længere behandlingstid i forhold til montering og rensning af porte fra kommercielt syntetiserede oligo'er (tabel 16). De primære omkostninger af plasmid-afledt porte er gensyntese og anvendelse af restriktionsenzymer. For 300 pmol af porte (nok til 15 reaktioner ved 30 nM), den anslåede omkostning for Deltag porte er ca $ 170 og $ 200 for Fork porte, omkostningerne forskel er på grund af anvendelsen af ​​forskellige indsnit enzymer. I modsætning hertil kemisk syntese af strengene for de samme gate koster omkring $ 260, herunder en SIDE rensning gebyr. Den primære tid omkostninger for plasmid-afledt porte er i kloning, og som, ligesom DNA-syntese, kan outsourcet til en gensyntese virksomhed. Men når sammensatte plasmid-afledte porte har den fordel, at værten plasmider let kan replikeres enND kan opbevares i form af bakterielle glycerolstamopløsninger. Dette gør det muligt at genbruge portene mange gange.

Fremadrettet kunne den forbedrede ydeevne plasmid-afledte porte muliggøre en langt større vifte af dynamik adfærd end er blevet eksperimentelt demonstreret hidtil med DNA CRNs. For eksempel seneste teoretiske arbejde 47,48 foreslog, at selvorganiserede rumlige mønstre på makroniveau kan realiseres med DNA CRNs gennem en reaktion diffusion mekanisme. Den præsenteres her metode giver en levedygtig vej til at konstruere de underliggende molekylære komponenter til sådanne selvstændige mønstring DNA materialer. Selvom udfordrende, ville udvikle makro-skala morfologier på en programmerbar måde få betydelige konsekvenser på områder lige fra biomaterialer forskning til regenerativ medicin.

Acknowledgements

Figur 1, 2, 3, 4, 6, 8 og tabel 2, 3, 10, 15, 16 er modificeret fra Ref 29. Dette arbejde blev støttet af National Science Foundation (give NSF-CCF 1.117.143 og NSF-CCF 1.162.141 til GS). Y.-JC blev støttet af taiwanske regerings stipendier. SDR blev støttet af National Science Foundation Graduate Research Fellowship Program (GRFP).

Materials

Name Company Catalog Number Comments
Phusion High-Fidelity PCR Master Mix with HF Buffer NEB M0531S
PvuII-HF NEB R3151L
PstI-HF NEB R3140S
Gibson Assembly Master Mix NEB E2611S
Terrific Broth, Modified SIGMA-ALDRICH T0918-250G
QIAprep Spin Miniprep Kit (250) QIAGEN 27106
QIAGEN Hispeed Maxi-prep Kit QIAGEN 12662
Nb.BsrDI NEB R0648L
Nt.BstNBI NEB R0607L
NanoDrop 2000c Thermo Scientific
Double-stranded Genomic Blocks IDT
Horiba Jobin-Yvon Spex Fluorolog-3 Fluorimeter Horiba/Jobin Yvon
Synthetic Quartz Cells  Starna 23-5.45-S0G-5
QIAGEN Gel Extraction Kit QIAGEN 28706
Plasmid Backbones BioBrick E0240-pSB1A2 High copy number plasmid with Ampicillin resistance. Sequence can be found from http://parts.igem.org

DOWNLOAD MATERIALS LIST

References

  1. Zhang, D. Y., Seelig, G. Dynamic DNA nanotechnology using strand-displacement reactions. Nat. Chem. 3, 103-113 (2011).
  2. Krishnan, Y., Simmel, F. C. Nucleic acid based molecular devices. Angew. Chem. Int. Ed. Engl. 50, 3124-3156 (2011).
  3. Zhang, D. Y., Winfree, E. Control of DNA strand displacement kinetics using toehold exchange. J. Am. Chem. Soc. 131, 17303-17314 (2009).
  4. Qian, L., Winfree, E., Bruck, J. Neural network computation with DNA strand displacement cascades. Nature. 475, 368-372 (2011).
  5. Qian, L., Winfree, E. Scaling up digital circuit computation with DNA strand displacement cascades. Science. 332, 1196-1201 (2011).
  6. Zadegan, R. M., Jepsen, M. D., Hildebrandt, L. L., Birkedal, V., Kjems, J. Construction of a fuzzy and boolean logic gates based on DNA. Small. 11, 1811-1817 (2015).
  7. Seelig, G., Soloveichik, D., Zhang, D. Y., Winfree, E. Enzyme-free nucleic acid logic circuits. Science. 314, 1585-1588 (2006).
  8. Zadegan, R. M., et al. Construction of a 4 zeptoliters switchable 3D DNA box origami. ACS Nano. 6, 10050-10053 (2012).
  9. Andersen, E. S., et al. Self-assembly of a nanoscale DNA box with a controllable lid. Nature. 459, 73-76 (2009).
  10. Zhang, D. Y., Hariadi, R. F., Choi, H. M., Winfree, E. Integrating DNA strand-displacement circuitry with DNA tile self-assembly. Nat. Commun. 4, (1965).
  11. Yurke, B., Turberfield, A. J., Mills, A. P., Simmel, F. C., Neumann, J. L. A DNA-fuelled molecular machine made of DNA. Nature. 406, 605-608 (2000).
  12. Green, S. J., Lubrich, D., Turberfield, A. J. DNA hairpins: fuel for autonomous DNA devices. Biophys. J. 91, 2966-2975 (2006).
  13. Venkataraman, S., Dirks, R. M., Rothemund, P. W., Winfree, E., Pierce, N. A. An autonomous polymerization motor powered by DNA hybridization. Nat. Nanotechnol. 2, 490-494 (2007).
  14. Green, S. J., Bath, J., Turberfield, A. J. Coordinated chemomechanical cycles: a mechanism for autonomous molecular motion. Phys. Rev. Lett. 101, 238101 (2008).
  15. Omabegho, T., Sha, R., Seeman, N. C. A bipedal DNA Brownian motor with coordinated legs. Science. 324, 67-71 (2009).
  16. Turberfield, A. J., et al. DNA fuel for free-running nanomachines. Phys. Rev. Lett. 90, 118102 (2003).
  17. Dirks, R. M., Pierce, N. A. Triggered amplification by hybridization chain reaction. Proc. Natl. Acad. Sci. U. S. A. 101, 15275-15278 (2004).
  18. Seelig, G., Yurke, B., Winfree, E. Catalyzed relaxation of a metastable DNA fuel. J. Am. Chem. Soc. 128, 12211-12220 (2006).
  19. Zhang, D. Y., Turberfield, A. J., Yurke, B., Winfree, E. Engineering entropy-driven reactions and networks catalyzed by DNA. Science. 318, 1121-1125 (2007).
  20. Yin, P., Choi, H. M., Calvert, C. R., Pierce, N. A. Programming biomolecular self-assembly pathways. Nature. 451, 318-322 (2008).
  21. Chen, X., Briggs, N., McLain, J. R., Ellington, A. D. Stacking nonenzymatic circuits for high signal gain. Proc. Natl. Acad. Sci. U. S. A. 110, 5386-5391 (2013).
  22. Phillips, A., Cardelli, L. A programming language for composable DNA circuits. J. R. Soc. Interface. 6, Suppl 4. S419-S436 (2009).
  23. Lakin, M. R., Youssef, S., Polo, F., Emmott, S., Phillips, A. Visual DSD: a design and analysis tool for DNA strand displacement systems. Bioinformatics. 27, 3211-3213 (2011).
  24. Lakin, M. R., Youssef, S., Cardelli, L., Phillips, A. Abstractions for DNA circuit design. J. R. Soc. Interface. 9, 470-486 (2012).
  25. Zhang, D. Y., Winfree, E. Robustness and modularity properties of a non-covalent DNA catalytic reaction. Nucleic Acids Res. 38, 4182-4197 (2010).
  26. Ducani, C., Kaul, C., Moche, M., Shih, W. M., Hogberg, B. Enzymatic production of 'monoclonal stoichiometric' single-stranded DNA oligonucleotides. Nat. Methods. 10, 647-652 (2013).
  27. Lin, C., et al. In vivo cloning of artificial DNA nanostructures. Proc. Natl. Acad. Sci. U. S. A. 105, 17626-17631 (2008).
  28. Bhatia, D., et al. Icosahedral DNA nanocapsules by modular assembly. Angew. Chem. Int. Ed. Engl. 48, 4134-4137 (2009).
  29. Chen, Y. J., et al. Programmable chemical controllers made from DNA. Nat. Nanotechnol. 8, 755-762 (2013).
  30. Arkin, A., Ross, J. Computational functions in biochemical reaction networks. Biophys. J. 67, 560-578 (1994).
  31. Érdi, P., Tóth, J. Mathematical models of chemical reactions: theory and applications of deterministic and stochastic models. Manchester University Press. (1989).
  32. Magnasco, M. O. Chemical kinetics is Turing universal. Phys. Rev. Lett. 78, 1190 (1997).
  33. Oishi, K., Klavins, E. Biomolecular implementation of linear I/O systems. IET Syst. Biol. 5, 252-260 (2011).
  34. Senum, P., Riedel, M. Rate-independent constructs for chemical computation. PLoS One. 6, (2011).
  35. Soloveichik, D., Cook, M., Winfree, E., Bruck, J. Computation with finite stochastic chemical reaction networks. Natural Computing. 7, 615-633 (2008).
  36. Soloveichik, D., Seelig, G., Winfree, E. DNA as a universal substrate for chemical kinetics. Proc. Natl. Acad. Sci. U. S. A. 107, 5393-5398 (2010).
  37. Tyson, J. J., Chen, K. C., Novak, B. Sniffers, buzzers, toggles and blinkers: dynamics of regulatory and signaling pathways in the cell. Curr. Opin. Cell. Biol. 15, 221-231 (2003).
  38. Cardelli, L. Two-domain DNA strand displacement. Math. Struct. Comput. Sci. 23, 247-271 (2013).
  39. Angluin, D., Aspnes, J., Eisenstat, D. A simple population protocol for fast robust approximate majority. Distrib. Comput. 21, 87-102 (2008).
  40. Cardelli, L., Csikasz-Nagy, A. The cell cycle switch computes approximate majority. Sci. Rep. 2, 656 (2012).
  41. Zadeh, J. N., et al. NUPACK: Analysis and design of nucleic acid systems. J. Comput. Chem. 32, 170-173 (2011).
  42. Lee, P. Y., Costumbrado, J., Hsu, C. Y., Kim, Y. H. Agarose gel electrophoresis for the separation of DNA fragments. J. Vis. Exp. (2012).
  43. Gibson, D. G., et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat. Methods. 6, 343-345 (2009).
  44. Froger, A., Hall, J. E. Transformation of plasmid DNA into E. coli using the heat shock method. J. Vis. Exp. e253 (2007).
  45. Lessard, J. C. Transformation of E. coli via electroporation. Methods Enzymol. 529, 321-327 (2013).
  46. Nasri, M., Thomas, D. Alteration of the specificity of PvuII restriction endonuclease. Nucleic Acids Res. 15, 7677-7687 (1987).
  47. Dalchau, N., Seelig, G., Phillips, A. Computational design of reaction-diffusion patterns using DNA-based chemical reaction networks. DNA Computing and Molecular Programming. 84-99 (2014).
  48. Scalise, D., Schulman, R. Designing modular reaction-diffusion programs for complex pattern formation. Technology. 2, 55-66 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics