Laboratoriemetoder som används för att upprätthålla och differentiera biotyper av * These authors contributed equally

Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Detta manuskript beskriver lämpliga Vibrio cholerae underhållstekniker utöver en rad biokemiska analyser, som tillsammans används för snabb och tillförlitlig differentiering mellan kliniska och miljömässiga V. Kolerae biotyper i en laboratorieinställning.

Cite this Article

Copy Citation | Download Citations

Brumfield, K. D., Carignan, B. M., Ray, J. N., Jumpre, P. E., Son, M. S. Laboratory Techniques Used to Maintain and Differentiate Biotypes of Vibrio cholerae Clinical and Environmental Isolates. J. Vis. Exp. (123), e55760, doi:10.3791/55760 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Den vattenlevande Gram-negativa bakterien Vibrio cholerae är det etiologiska medlet av den smittsamma gastrointestinala sjukdomscholera. På grund av den globala förekomsten och svårighetsgraden av denna sjukdom, V. Kolerae har studerats omfattande i både miljö- och laboratorieinställningar, vilket kräver korrekt underhåll och odlingsteknik. Klassisk och El Tor är två huvudbiotyper som komponerar V. Kolerae O1-serogruppen, vilka uppvisar unika genotypiska och fenotypiska egenskaper som ger tillförlitliga mekanismer för biotypkarakterisering och kräver distinkta virulensinducerande odlingsbetingelser. Oavsett biotypen av orsaksspänningen för någon given infektion eller utbrott, inbegriper standardbehandlingen av sjukdomen rehydreringsterapi kompletterad med en antibiotikabehandling. Biotypklassificering kan emellertid vara nödvändig för laboratorieundersökningar och kan ha större effekter på det biomedicinska området.I början av 2000 identifierades kliniska isolat som uppvisade genotypiska och fenotypiska egenskaper från både klassiska och El Tor-biotyper. De nyligen identifierade hybriderna, benämnda El Tor-varianter, har orsakat biotypidentifiering av klinisk och miljöisolat att bli mer komplex än tidigare traditionella analysanalyser för enkel analys. Förutom att beskriva V. Cholerae generella underhålls- och odlingsmetoder beskriver detta manus en serie genspecifika (ctxB- och tcpA) PCR-baserade genetiska skärmar och fenotypiska analyser (polymyxin B-resistens, citratmetabolism, proteolytisk aktivitet, hemolytisk aktivitet, motilitet och glukosmetabolism via Voges- Proskauer-analys) kollektivt används för att karakterisera och / eller skilja mellan klassiska och El Tor-biotyper. Tillsammans ger dessa analyser ett effektivt systematiskt tillvägagångssätt som kan användas som ett alternativ eller till kostsamma arbetskrävande experiment i karaktärenTion av V. Kolerae kliniska (och miljö) isolat.

Introduction

Kolera är en sjukdom i den distala tunntarmen som orsakas av konsumtion av förorenad mat eller vatten innehållande den vattenlevande Gram-negativa bakterien Vibrio cholerae . Symptom på kolera inkluderar kräkningar och okontrollerbar vattnig diarré, vilket leder till svår uttorkning, vilket om det inte behandlas ordentligt kommer att leda till döden. V. Kolerae kan delas in i över 200 serogrupper baserat på strukturen hos cellyt-lipopolysackarid-O-antigenen. Dock har endast 2 serogrupper, O1 och O139, visat epidemi eller pandemisk potential 1 , 2 . Dessutom har serogrupp O139 huvudsakligen isolerats till Sydostasien 3 , 4 , medan serogrupp O1 distribueras över hela världen. Dessutom kan O1 serogruppen uppdelas i 2 huvudbiotyper: klassisk och El Tor. Den klassiska biotypen var ansvarig för de första 6 kolera pandemiernaS mellan 1817 och 1923. Den pågående sjunde pandemin är ett resultat av El Tor-biotypen, som globalt förskjutit den klassiska biotypen i miljön 5 , 6 , 7 . På senare tid har stammar uppstått som innehåller särdrag hos både klassiska och El Tor-biotyper 8 , 9 , 10 , 11 , 12 , 13 , 14 , 15 , 16 , 17 och har sedan kallats El Tor-varianter 13 , 17 . Vissa El Tor-varianter har visat förhöjda virulensfunktioner med snabbare och svårare sjukdomsprogression än vad som tidigare observerats och betonarBehovet av ett mer omfattande tillvägagångssätt för agentidentifiering och förebyggande och behandling av sjukdomar 8 , 9 , 18 . Medan biotypidentifiering inte diktat omedelbart behandlingen kan ytterligare framsteg inom vaccinutveckling och framtida terapeutiska medel dra nytta av biotypsskillnad.

Den första serien av protokoll som anges här gör det möjligt för utredare att behålla V. Koleraestammar i en laboratorieinställning. Konsistens och efterföljande analys kräver lagerberedning och tillväxt av isolat, som inte är biotypberoende. För att optimalt inducera virulensgenuttryck krävs dock oberoende biotypspecifika odlingsmetoder 19 . Dessutom beskrivs förberedelser för olika genetiska och biokemiska analyser i detta manuskript.

Kollatoxin (CT) och toxinkombinationenGulerad pilus (TCP) är två huvudsakliga virulensfaktorer som styrs av master regulator ToxT i båda biotyperna hos V. Kolerae O1 serogrupp 20 . CT är ett bifasit toxin bestående av fem CtxB Subenheter som omger en enda CtxA-subenhet och är ansvarig för den snabba elektrolytförlusten associerad med kolera. TCP är en typ IV pilus kodad av tcp operon ( tcpABQCRDSTEF ), och är involverad i fastsättning och kolonisering av den distala tunntarmen. TcpA är den första genen av tcp operon som kodar för de individuella pilinunderenheterna som är nödvändiga för byggandet av pilus 8 . Gensekvensen för ctxA är helt konserverad mellan klassiska och El Tor-biotyper, medan ctxB och tcpA skiljer sig över de två biotyper men konserveras inom varje biotyp 8 . CtxB är helt konserverad mellan biotyper utom vid två basposiTion (115 och 203). I El Tor-biotypen ligger tymin vid baspositionerna 115 och 203, medan den klassiska biotypen innehåller cytosin vid dessa baser. TcpA är helt konserverad inom varje biotyp, men skiljer sig ändå vid flera baser mellan biotyper. Dessa genetiska skillnader tjänar som primära biotypidentifieringsmarkörer och efter sekvensering av polymeraskedjereaktionsprodukt (PCR) amplifieringsprodukten innefattande dessa ställen kan isolationssekvenser jämföras med vildtyp (WT) klassisk O395 eller WT El Tor N16961 för att bestämma biotypbakgrunden Av CT respektive TCP i ett givet V. cholerae- isolat.

Många protokoll har utvecklats för att karakterisera fenotypiska skillnader mellan de klassiska och El Tor biotyperna 21 , 22 , 23 . Polymyxin B är ett peptidantibiotikum som äventyrar det yttre cellmembranets integritet i gramnegativa bacTeria och polymyxin B-resistans kan visualiseras genom polymyxin B-resistansanalysen 21 . Citrat är ett primärt substrat av Krebs cykel, och förmågan att metabolisera citrat som en enda kolkälla kan bestämmas med användning av citratmetabolismassayen 22 . HapR kodar för en global regulator och huvudkorumavkänningsregulatorn i V. cholerae, HapR, som binder till olika promotorregioner och reglerar gen- och operonuttryck 24 . Vissa patogena stammar av V. cholerae har en naturligt förekommande ramskiftmutation i hapR- genen som har orsakat denna täthetsberoende reglering av virulensgenuttryck att gå vilse 24 , 25 . Genom att mäta HapR-reglerad proteasaktivitet med användning av mjölkagarmedium kan forskaren identifiera huruvida ett visst isolat innehåller en funktionell HapR 23 . DeHemolysanalys tester för en stam förmåga att utsöndra hemolytiska enzymer som lyser röda blodkroppar; Graden av hemolys kan visualiseras på blodagarplattor 23 . Motilitet är ofta associerad med virulens i V. cholerae och kan analyseras med användning av motilitetsagarplattor 23 . Voges-Proskauer-analysen testar för en stam förmåga att fermentera glukos som en enda kolkälla och producera biprodukten acetoin 21 . Med framväxten av El Tor-varianter är det svårt att förutsäga resultaten av någon given fenotypisk analys utan omfattande genotypisk screening och före avdrag av biotypbakgrunden för V. Kolerae- isolat, rekommenderas att utföra denna samling av analyser 23 och jämföra resultaten med referensstammar som i tabell 2 .

Här har vi avancerat en serie protokoll som kollektivt använder sig avoremNtioned genotypiska och fenotypiska analyser för ett mer omfattande tillvägagångssätt för att karakterisera V. Kolerae biotyper. Vidare har vi beskrivit de genotypiska och fenotypiska skillnaderna av kända V. Cholerae El Tor-varianter (MQ1795 och BAA-2163), jämfört med vanligen använda biotypreferensstammar (WT klassisk O395, WT El Tor C6706 och WT El Tor N16961; Tabell 1 ). Framväxten av El Tor-varianter har presenterat utmaningar för tillförlitligheten av tidigare använda enkla analysbiotypkaraktäriseringsprotokoll; Emellertid kommer detta multipla analysidentifieringssystem att möjliggöra en mer tillförlitlig karakterisering av kliniska och miljömässiga V. Koleraeisoler .

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Obs! Tidsåtgärder för varje analys måste göras eftersom enskilda mediepreparationer kräver olika tider. Till exempel bör solid agarplattmedium tillåtas tillräckligt kallt och torrt (1-2 dagar). Ytterligare tidsöverväganden ( dvs. ensam koloni och ökning av övernattningstiden) anges under varje protokoll och finns i tabell 2 .

1. Framställning av media

  1. 1x fosfatbuffrad saltlösning (PBS)
    1. Väg 4,0 g NaCl, 0,1 g KCl, 0,72 g Na2HP04 och 0,12 g KH2P04. Kombinera beståndsdelarna i en 1 L Erlenmeyer-kolv, justera volymen till 500 ml med avjoniserat vatten, justera pH till 7.2 med en pH-mätare och tillsätt HCl droppvis till lösningen och autoklavera eller filtrera sterilisera med ett 0,22 μm filter. 1x PBS kan förvaras vid rumstemperatur på obestämd tid.
      VARNING: HCl är en koncentrerad syra och bör hanteras enligtTill institutionella, lokala, statliga och federala bestämmelser. För lämpliga hanteringsanvisningar, se säkerhetsdatabladet från tillverkaren.
  2. Luria-Bertani (LB) buljong
    1. Väg 5,0 g trypton, 2,5 g jästextrakt och 2,5 g NaCl. Kombinera beståndsdelarna i en 1 liter flaska, justera volymen till 500 ml med avjoniserat vatten, autoklavera och förvara vid rumstemperatur i upp till 6 månader. För klassiska biotypvirulens inducerande förhållanden, justera pH till 6,5 med användning av HCl före autoklavering.
  3. AKI-medium innehållande 0,03% (vikt / volym) NaHCO3
    1. För komponent 1 (AKI-medium): väga 7,5 g pepton, 2,0 g jästextrakt och 2,5 g NaCl. Kombinera beståndsdelarna i en 1 L-flaska, justera volymen till 450 ml med avjoniserat vatten och autoklav. AKI-medium kan förvaras vid rumstemperatur i upp till 6 månader.
    2. För komponent 2 (NaHCO3): väga 1,5 g NaHCO3 och justera volymenTill 50 ml med avjoniserat vatten i en steril vesikel. Filtrera sterilisera NaHCO3 med ett 0,22 μm filter. NaHCO 3 måste beredas omedelbart före användning.
    3. Kombinera aseptiskt de två komponenterna som skapar ett 1:10 förhållande genom att filtrera komponent 2 i komponent 1 före användning.
  4. Luria-Bertani (LB) agarplattor
    1. Väg 5,0 g trypton, 2,5 g jästextrakt, 2,5 g NaCl och 7,5 g agar. Kombinera beståndsdelarna i en 1 L Erlenmeyer-kolv, justera volymen till 500 ml med avjoniserat vatten, autoklavera och förbered i standardformat 100 mm x 15 mm sterila petriskålar. Pläterade medier kan förvaras inslagna i plast i upp till 6 månader, upptill upptill vid 4 ° C.
  5. LB-agarplattor kompletterade med polymyxin B
    1. För komponent 1 (LB agar): väga 5,0 g trypton, 2,5 g jästextrakt, 2,5 g NaCl och 7,5 g agar. Kombinera beståndsdelarna i en 1 L Erlenmeyer-kolv, justera volymen till 500 ml wiDejoniserat vatten och autoklav.
    2. För komponent 2 (polymyxin B): Polymyxin B löses upp i avjoniserat vatten i ett sterilt 2 ml mikrocentrifugrör till en koncentration av 50 000 IE / μl och filtersteriliseras med ett 0,22 μm filter.
    3. När komponent 1 är sval vid beröring, men inte ännu stelnat, tillsätt aseptiskt 500 μl av komponent 2 till komponent 1, vilket skapar en slutlig koncentration av 50 IE / μl och blandas noggrant. Förbered i standardformat 100 mm x 15 mm sterila petriskålar genom att hälla blandat agarmedium i petriskålarna. Pläterade medier kan förvaras inslagna i plast i upp till 3 månader, upptill upptill vid 4 ° C.
  6. Minimal Citrat Medium Agar Plates
    1. För komponent 1 (agar med bromtymolblått): väga 7,5 g agar och 0,02 g bromtymolblått. Kombinera beståndsdelarna i en 1 L Erlenmeyer-kolv, justera volymen till 450 ml med avjoniserat vatten och autoklavera blandningen.
    2. För komponent 2 (10x VBMM): väga 1.0 g MgSO4 7H2O, 10,0 g citronsyraH20, 50,0 g vattenfri K 2 HPO 4 och 17,5 g NaNH 4 HPO 4 4H 2 O. Kombinera beståndsdelarna i en 1 L Erlenmeyer-kolv, justera volymen till 500 ml Med avjoniserat vatten och autoklaver eller filtersterilisera med ett 0,22 μm filter. 10x VBMM kan förvaras vid rumstemperatur upp till 6 månader.
    3. Tillsätt 50 ml av komponent 2 till komponent 1 och förbered i standardformat 100 mm x 15 mm sterila petriskålar genom att hälla blandat agarmedium i petriskålarna. Pläterade medier kan förvaras inslagna i plast i upp till 6 månader, upptill upptill vid 4 ° C.
  7. Mjölkagarplattor
    1. För komponent 1 (mjölk): väga 8,0 g snabbfettfri torrmjölk i en 1 L Erlenmeyer-kolv, justera volymen till 200 ml med avjoniserat vatten och autoklav.
    2. För komponent 2 (agar med hjärthjärta infusion): väga 3,68 g hjärthjärta infusion och 6,0 g agar. Kombinera konStituenter i en 500 ml Erlenmeyer-kolv, justera volymen till 200 ml med avjoniserat vatten och autoklav.
    3. Kombinera de två komponenterna genom att hälla komponent 2 i komponent 1, efter autoklavering och blanda noggrant. Förbered i 150 mm x 15 mm sterila petriskålar. Mjölkplattor kan lagras i upp till en vecka i plast, locket nedåt vid 4 ° C. Förbered i 150 mm x 15 mm sterila petriskålar genom att hälla blandat agarmedium i petriskålarna.
  8. Motilitetsagarplattor
    1. För komponent 1 (LB agar): väga 5,0 g trypton, 2,5 g jästextrakt, 2,5 g NaCl och 2,0 g agar. Kombinera beståndsdelarna i en 1 L Erlenmeyer-kolv, justera volymen till 500 ml med avjoniserat vatten och autoklav.
    2. För komponent 2 (1% (vikt / volym) trifenyltetrazoliumklorid; TTC): väga 0,25 g TTC. Justera volymen till 25 ml med avjoniserat vatten i en steril vesikel och filtersterilisera med ett 0,22 μm filter. Förvaras i upp till 6 månader vid rumstemperatur inslagetI folie för att minimera ljusexponering.
    3. Tillsätt 2,5 ml 1% (vikt / volym) steril TTC till autoklaverat medium.
    4. Häll media så tjock som möjligt (≥50 ml / platta) i stora 150 mm x 15 mm sterila petriskålar. Pläterade medier kan förvaras inslagna i plast i upp till en vecka, upptill upptill vid 4 ° C. Förbered i 150 mm x 15 mm sterila petriskålar genom att hälla blandat agarmedium i petriskålarna.
  9. Voges-Proskauer (VP)
    1. För komponent 1 (Methyl Red-Voges-Proskauer buljong, MR-VP): väga 1,7 g MR-VP-medium i en 500 ml Erlenmeyer-kolv, justera volymen till 100 mL med avjoniserat vatten och autoklav. Steril MR-VP buljong kan förvaras vid rumstemperatur i upp till 6 månader.
    2. För komponent 2 (5% (vikt / volym) alfa (a) naftol): väga 1,0 g a-naftol i en steril vesikel och justera volymen till 20 ml med 95% etanol. A-naftol kan förvaras vid rumstemperatur i upp till 1 vecka insvept i folie för att minimera ljus exposure.
    3. För komponent 3 (40% (vikt / volym) kaliumhydroxid; KOH): väga 20,0 g KOH i en steril vesikel, justera volymen till 50 ml med sterilt avjoniserat vatten. KOH kan förvaras i upp till 6 månader vid rumstemperatur i ett plastkärl.

2. Underhåll och tillväxt av V. Koleraestammar

  1. Förberedelse och användning av fria lagerkulturer
    1. Pellet 1,8 ml flytande över natten odling i 2 minuter genom centrifugering (≥8 600 xg) i ett sterilt 2 ml mikrocentrifugrör, avlägsna supernatanten och suspendera cellpelleten i 900 | il ny LB-buljong genom pipettering.
    2. Tillsätt 900 μL steril 60% (volym / volym) glycerol till kulturen och blanda genom vortexering.
    3. Överför blandningen till ett sterilt 2 ml kryogent rör och förvara obestämt vid -80 ° C.
    4. För att använda, ta bort en liten mängd fryst lager med en steril inokuleringsslinga och streak för enkla kolonier på LB agAr plattor. Återvänd genast fryst lager till -80 ° C efter användning för att förhindra att kulturer töms helt. Inkubera plattorna locket nedåt i 12 till 16 timmar vid 37 ° C.
  2. Tillväxt av nattkulturer i flytande medium
    1. Streak för enskilda kolonier (enligt avsnitt 2.1.4) från fryst lager på LB agarplattor. Inkubera plattorna locket nedåt i 12 till 16 timmar vid 37 ° C.
    2. Inokulera 4 ml flytande LB-buljong i ett sterilt 10 ml odlingsrör med en enda koloni genom att röra ytan av den enda kolonin med en steril applikatorpinne och överföra kolonin i den flytande buljongen.
    3. Inkubera med luftning i en shaker-inkubator vid 225 rpm under 12 till 16 timmar vid 37 ° C.
  3. Tillväxtkurva
    1. Förbered över natten odling i flytande LB-buljong som tidigare angivits i protokoll 2.2.
    2. Gör en 1: 100-spädning av övernattningskulturen genom att överföra 250 | il av över natten odling till 25 ml färsk LB-buljong i en steril 250 ml Erlenmeyer-kolv.
    3. Mät den optiska densiteten hos vätskekulturerna vid 600 nm (OD 600 ) varje timme som börjar vid tidpunkten för ympningen (T 0 ).
    4. Inkubera en 1: 100-spädning av över natten odling med luftning i en shaker-inkubator vid 225 rpm i upp till 30 h vid 37 ° C eller tills odling når maximal densitet.
    5. Gradera OD 600 vs Time och använd linjär regression för att bestämma ungefärlig fördubblingstid för varje stam.
  4. El Tor Biotype Virulence Inducerande Villkor
    1. Streak för enskilda kolonier från fryst lager på LB agarplattor. Inkubera plattorna locket nedåt, i 12 till 16 h vid 37 ° C.
    2. Inokulera 10 ml AKI-medium innehållande 0,03% (vikt / volym) NaHCO3 med en enda koloni.
    3. Inkubera odling utan luftning vid 37 ° C under 3,5 timmar.
    4. Avlägsna 7 ml odling och inkubera återstående 3 ml kultusRe med luftning i en shaker-inkubator vid 225 rpm under ytterligare 4 timmar.
  5. Inducerande tillstånd för klassisk biotypvirulens
    1. Streak för enskilda kolonier från fryst lager på LB agarplattor. Inkubera plattorna locket nedåt i 12 till 16 timmar vid 37 ° C.
    2. Inokulera 4 ml flytande LB-buljong (pH 6,5) med en enda koloni.
    3. Inkubera med luftning i en shaker-inkubator vid 225 rpm under 12 till 16 h vid 30 ° C.
  6. Tvätta cellpellet i 1x PBS
    1. Pellets 1,8 ml nattkultur under 2 minuter genom centrifugering (> 8 600 xg) i ett sterilt 2 ml mikrocentrifugrör och avlägsna supernatanten med användning av en pipett. Re-suspendera cellpelleten i 1,8 ml 1x PBS genom pipettering.
    2. Upprepa tvättproceduren tre gånger följt av en slutlig resuspendering i 1,8 ml 1x PBS.

3. Karaktäriserande V. Koleraebiotyper

  1. PCR-baserade genetiska skärmar som använder ctxB och tcpA
    1. Utforma en uppsättning primers, som annealerar ungefär 50-70 bp uppströms och nedströms om de translationella start- och stoppställena för ctxB respektive tcpA.
    2. Förbered över natten odling i flytande LB-buljong som tidigare angivits i protokoll 2.2.
    3. Isolera kromosomalt DNA med användning av ett kommersiellt tillgängligt kit konstruerat för gramnegativa bakterier. Renat kromosomalt DNA kan lagras obestämt vid -20 ° C. Kromosomal DNA-isolering med användning av kommersiellt tillgängliga kits tar i allmänhet ca 4 timmar.
    4. Använd en mikrovolym spektrofotometer för att säkerställa att det kromosomala DNA-provet är av hög kvalitet (A 260/280 > 1.8).
    5. För varje kromosomalt DNA-isolat, beredda polymeraskedjereaktion (er) (PCR) på is i sterila 200 μl PCR-rör (er) och amplifiera områden av ctxB och tcpA med användning av standard PCR-komponenter: Taq- polymeras och buFfer (eller ekvivalenter), dNTP-lösning och framåt / bakåt-primers. Använd standard PCR parametrar (~ 3 h). Använd till exempel följande protokoll:
      1. Initial denaturering vid 95 ° C under 120 s.
      2. Denaturera vid 95 ° C under 60 s.
      3. Anneal-primrar vid 60 ° C i 45 s.
      4. Förläng vid 72 ° C under 90 s.
      5. Upprepa steg 3.1.5.2 till 3.1.5.4 i 34 cykler.
      6. Slutlig förlängning 72 ° C för 600 s.
      7. Oändlig håll vid 4 ° C.
    6. Färga 5 μl av respektive PCR-produkt (er) med användning av en standard 6 x DNA-geladdningsfärg och belasta ungefär 10 | il av 1 kb stege och 10 | il PCR-produkt på en 1% agarosgel i 1x Tris-Borat EDTA (TBE) buffert.
    7. Kör gelelektrofores vid 130 V tills färgämnet når slutet, men inte av, av gelén (ca 90 min). Konstant övervakning rekommenderas eftersom spänning och körtider kan variera beroende på utrustningen.
    8. Vid kontroll avFramgångsrik PCR-amplifiering vid den förväntade storleken, renar återstående 45 | il PCR-produkt (er) med användning av ett kommersiellt tillgängligt DNA-ren och koncentratorkit.
    9. Sequence-rengjord PCR-produkt (er) med samma primers som används för PCR-amplifiering och förbereda enligt lokala riktlinjer för sekvenseringsfacilitet.
    10. Jämför FASTA-formatet för gensekvenser från varje isolat till den publicerade sekvensen som finns tillgänglig på NCBIs webbplats (http://www.ncbi.nlm.nih.gov/gene/) genom att söka följande anslutningsnummer i sökrutan.
    11. CtxB : (klassisk) region mellan VC0395_A1059 till VC0395_A1060 (El Tor) VC_1456
    12. TcpA : (klassisk) VC0395_A0353 (El Tor) VC_0828
  2. Fenotypiska analyser för biotypklassificering via spotting
    1. Förbered över natten odling i flytande LB-buljong som tidigare angivits i protokoll 2.2.
    2. Tvätta cellpelleten (arna) enligt specifikationen i protokoll 2.6.
    3. Använd en pipett tillPlacera 1 μl tvättad kultur på respektive medium. För medelstora urval och inkubationsspecifikationer, se Tabell 2.
  3. Motilitetsanalys
    1. Förbered över natten odling (er) i flytande LB-buljong som tidigare angivet i protokoll 2.2.
    2. Tvätta cellpelleten (arna) enligt specifikationen i protokoll 2.6.
    3. Inokulera motilitetsagarplattor genom att införa inokuleringssticka i den tvättade flytande odlingen och "sticka" vertikalt i mediet. Mellan varje inokulering steriliserar du trådstickan med en Bunsen-brännare, och när du stickar agar, se till att det inokulerande steget inte böjer, eftersom detta kan ändra resultatet.
    4. Inkubera plattor locket upp i 14-24 timmar vid 37 ° C. Efter 14 timmar, övervaka motilitetsplattorna noga för att förhindra överväxt av kulturer.
  4. Voges-Proskauer (VP) -analys
    1. Förbered över natten odling (er) i flytande LB-buljong som tidigare angivet i protokoll 2.2.
    2. Inokulera 4Ml metylröd Voges-Proskauer eller MR-VP-buljong genom pipettering av 10 jil av tidigare framställd odling över natten i 4 ml MR-VP-buljong i ett sterilt odlingsrör och inkubera med luftning i en skakningsinkubator vid 225 rpm i 12-16 H vid 37 ° C.
    3. Tillsätt 150 μL 5% (vikt / volym) a-naftol och 50 | il 40% (vikt / volym) KOH till 1 ml alikvoter av MR-VP över natten odling i sterila odlingsrör.
    4. Kortvarigt virvel och låt stå vid rumstemperatur i upp till 4 timmar tills färgförändring utvecklas.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

För korrekt underhåll och användning av någon bakteriestam rekommenderas det att fördubbla tiden för den eller de aktuella stammen. Häri varierar växlingshastigheterna hos vanligen använda V. Koleraestammar demonstrerades genom en tillväxtkurva och ungefärliga fördubblingstider beräknades med användning av linjär regression. WT El Tor N16961 och El Tor variant MQ1795 visade kortare fördubblingstider (~ 1 h och ~ 1 h respektive) än WT klassiska O395 (~ 2 h) ( Figur 1 , Tabell 2 ).

V. choleraes genetiska manipulation och efterföljande analys bygger ofta på förmågan att korrekt skilja mellan biotyper. PCR-baserade genetiska skärmar och fenotypiska analyser genomfördes kollektivt som ett tillförlitligt system för att skilja mellan biotypbakgrunder av V. Kolerae kliniska och miljömässiga isolates; För representation, biotypreferensstammar (WT klassisk O395, WT El Tor C6706 och WT El Tor N16961) och representativa El Tor-varianter (MQ1795 och BAA-2163) inkluderades ( Tabell 1 ). WT klassisk O395 demonstrerade klassiska ctxB- och tcpA - sekvenser. Omvänt demonstrerade WT El Tor stammar N16961 och C6706 El Tor ctxB och tcpA - sekvenser. Intressant innehöll MQ1795 och BAA-2163 den klassiska biotyp ctxB-subenheten jämförbar med O395, men båda El Tor-varianterna innehöll tcpA som indikerar ElTr-biotypbakgrunden ( Tabell 1 ). WT klassisk biotypstam O395 visade känslighet för polymyxin B, medan WT El Tor-biotypstammar (C6706 och N16961) visade resistans och uppvisade tillväxt på LB-agarplattor kompletterade med polymyxin B. De representativa El Tor-variantstammarna (MQ1795 och BAA-2163) påvisades Liknande resistens mot antibiotikumet i förhållande till WT El Tor biotypstrIns (C6706 och N16961) ( Figur 2 , Tabell 2 ). WT-klassisk biotypstam O395 växte inte på minimalt citratmedium, medan WT El Tor-stammar (C6706 och N16961) kunde utnyttja citrat som en kolkälla och uppvisa tillväxt på minimalt citratmedium. Representativa El Tor-variantbiotypstammar (MQ1795 och BAA-2163) demonstrerade tillväxt jämförbar med den hos WT El Tor-biotypstammarna (C6706 och N16961) ( Figur 3 , Tabell 2 ). WT klassisk stam O395 och WT El Tor stam N16961 har en icke-funktionell HapR och demonstrerade således inte HapR-reglerad proteasaktivitet; WT El Tor-stam C6706 och representativa El Tor-varianter (MQ1795 och BAA-2163) är hapR- positiva-visualiserade som en clearancezon som kommer från inokulationspunkten ( Figur 4 , Tabell 2 ). WT klassisk stam O395 utsöndrar inte hemolytiska enzymer och var därförE-y-hemolytisk, medan WT El Tor-biotypstammar (C6706 och N16961) och representativa El Tor-variantstammar (MQ1795 och BAA-2163) utsöndrar hemolytiska enzymer som fullständigt lyser röda blodkroppar som omger inokulationspunkten och visade p-hemolys ( Figur 5 ; Tabell 2 ). Motiliteten varierar över och inom, biotypstammar; WT El Tor-stammen N16961 och El Tor-varianterna (MQ1795 och BAA-2163) demonstrerade hypermotilitet jämfört med den relativt mindre motila WT-klassiska stammen O395 och WT El Tor-stammen C6706 ( Figur 6 , Tabell 2 ). WT klassisk stam O395 och representativa El Tor-varianter metaboliserade inte glukos för att producera acetoin, medan WT El Tor-biotypstammar producerade aketoin som en biprodukt av glukosfermentering, vilket indikeras genom utveckling av en djupröd färg under Voges-Proskauer-analysen ( Figur 7 Tabell 2 ).

Anstränga CtxB- gen tcpA Referens
Bas 115 Bas 203 biotyp biotyp
O395 C C klassisk klassisk 8
C6706 T T El Tor El Tor 8
N16961 T T El Tor El Tor 8
MQ1795 C C klassisk El Tor 13
BAA-2163 C C klassisk El Tor 8

Tabell 1: Biotypberoende genetiska skillnader i Vibrio cholerae referensstammar. Visas i denna tabell är DNA-basförändringarna och relativa positioner i generna ctxB och tcpA . WT klassiska O395 och WT El Tor stammar N16961 och C6706 är vanligen använda biotypreferensstammar. MQ1795 och BAA-2163 är kända El Tor-varianter.

Analysera Ansökan Medium Selection Inkubation förväntade resultat
O395 C6706 N16961 MQ1795 BAA-2163
2.3) Tillväxtkurva 27 Bestämmer fördubblingstider av olika V. cholerae-stammar 1,2) flytande LB-buljong Upp till 30 timmar (37 ° C med luftning) ~ 2 h ND * ~ 1 h ~ 1 h ND *
3.1) PCR-baserad genetisk skärm med användning av ctxB och tcpA 8 Differentierar mellan klassiska och El Tor biotyp bakgrunder av ctxB N / A N / A klassisk El Tor El Tor klassisk klassisk
Differentierar mellan klassiska och El Tor biotyp bakgrunder av tcpA N / A N / A klassisk El Tor El Tor El Tor El Tor
3.2) Polymyxin B-resistans 21 Känslighet mot antibiotikumet polymyxin B 1,5) LB agarplattor kompletterade med polymyxin B 18 h (37 ° C) - + + + +
3.2) Citratmetabolism 22 Förmåga att metabolisera citrat som enbart kolkälla 1.6) Minimala citratmediumagarplattor 24 h (37 ° C) - + + + +
3.2) Kaseinhydrolys 23 HapR-reglerad proteasaktivitet 1,7) Mjölkagarplattor 18 h (37 ° C) - - + + +
3,2) hemolys 23 Åtgärder hemolytisk aktivitet Blod agar plattor 48 h (37 ° C) Gamma Beta Beta Beta Beta
3.3) Motilitet 23 Åtgärdar grad av rörlighet 1,8) Motilitetsagarplattor 14-24 timmar (37 ° C) 10 mm 15 mm 21 mm 25 mm 29 mm
3.4) Voges-Proskauer 21 Mäter förmåga att fermentera glocos och producera acetoin som en biprodukt 1,9) Flytande Voges-Proskauer-medium Upp till 4 timmar (rumstemperatur) - + + - -
Notera: "ND *" betyder inte bestämd; "+" Anger ett positivt resultat; "-" anger ett negativt resultat

Tabell 2: Sammanfattning av genetiska och fenotypa analyser som används för Vibrio cholerae Biotyp Distinction. Denna tabell sammanfattar de olika genetiska och fenotypiska analyserna, tillämpningarna och de förväntade resultaten som kollektivt användes för att skilja mellan klassiska och El Tor-biotyper som användes i denna studie. Protokollnummer och referenser till specifika protokoll anges i analyskolonnen. "ND *" betecknar ej bestämd; "+" Anger ett positivt resultat; "-" anger ett negativt resultat.

Figur 1
Figur 1: V. Kolerae tillväxtkurva för WT klassisk O395, WT El Tor N16961 och El Tor Variant MQ1795. Tillväxthastigheter för biotypreferensstammar (WT klassiska O395 och WT El Tor N16961) och representativa El Tor Variant MQ1795, odlade i LB-buljong med luftning vid 37 ° C analyserades genom mätning av OD 600 eMycket timme som börjar vid T 0 . Tillväxtkurvor utfördes på 8 oberoende experimentella replikat, varvid varje replik representerar en oberoende odlingshändelse för varje försök. WT El Tor-stammen N16961 och El Tor-varianten MQ1795 visade kortare fördubblingstider (~ 1 h respektive -1 h) i förhållande till WT-klassisk stam O395 (~ 2 h), såsom observerats genom en längre fördubblingstid. Vänligen klicka här för att se en större version av denna figur.

Figur 2
Figur 2: Bestämning av polymyxin B-resistans med användning av LB-agar kompletterad med polymyxin B. Resistens mot peptidantibiotikumpolymyxin B bestämdes genom förmågan att växa på LB-agar kompletterad med 50 IE / μl polymyxin B. WT-klassisk stam O395 visade ingen tillväxt på agar supplSmält med polymyxin B och ansågs känsligt för antibiotikumet. Medan WT El Tor-stammar (C6706 och N16961) och representativa El Tor-varianter (MQ1795 och BAA-2163) uppvisade tillväxt i närvaro av antibiotikumet och ansågs resistenta mot polymyxin B. Plattor inkuberades vid 37 ° C under 18 timmar. Vänligen klicka här för att se en större version av denna figur.

Figur 3
Figur 3: Mätning av citratmetabolism med användning av minimal citratmedia. Förmågan att utnyttja citrat som enbart kolkälla bestämdes av isolatets förmåga att växa på minimal citratmedium. WT klassisk stam O395 växte inte på minimalt citratmedium (negativt). Tillväxten uppenbarades av alla WT El Tor stammar (C6706 och N16961) och representativa ElTor-varianter (MQ1795 och BAA-2163), som visade förmågan att utnyttja citrat som en enda kolkälla (positiv). Plattor inkuberades vid 37 ° C i 18 timmar. Vänligen klicka här för att se en större version av denna figur.

Figur 4
Figur 4: Mätning av HapR-reglerad proteolytisk kaseinhydrolys med användning av mjölkagarmedia. Kaseinhydrolys genom HapR-reglerad proteasaktivitet bestämdes genom en visuell clearancezon som omringade inokulationspunkten på mjölkagar. Stammar innehållande en icke-funktionell HapR, såsom WT klassisk stam O395 och WT El Tor stam N16961, producerade inte en clearancezon som omringade inokulationspunkten ( hapR- negativ). WT El Tor stam C6706 och representativa El Tor varianter (MQ1795 och BAA-2163) innehåller en funktionell HapR, som kan visualiseras som varierande medelstora clearancezoner ( hapR- positiva). Plattor inkuberades vid 37 ° C i 18 timmar. Vänligen klicka här för att se en större version av denna figur.

Figur 5
Figur 5: Mätning av hemolytisk aktivitet med användning av blodagarmedium. Hemolytisk aktivitet uppmättes med användning av agarplattor kompletterade med fårens blod. WT klassisk stam O395 utsöndrar inte enzymer som lyser röda blodkroppar (y-hemolytisk). WT El Tor-stammar (N16961 och C6706) och representativa El Tor-varianter (MQ1795 och BAA-2163) utsöndrar hemolytiska enzymer, vilket resulterade i en genomskinlig zon av clearance som klarar av inokulationspunkten (p-hemolytisk). Plattor inkuberades vid 37° C i 48 h. Vänligen klicka här för att se en större version av denna figur.

Figur 6
Figur 6: Bestämning av motilitet med användning av motilitetsagarplattor. Motilzonen indikerades med en visuell färgförändring av saltet TTC som vänder sig från klart till rött när det metaboliseras, vilket indikerar var bakterierna har rört sig. WT El Tor-stammen C6706 (15 mm) visade minimal rörlighet, medan El Tor-stammen N16961 (21 mm) och representativa El Tor-varianter (MQ1795 (25 mm) och BAA-2163 (29 mm) ) Demonstrerade hypermotilitet relativt O395 och C6706. Plattor inkuberades vid 37 ° C i 18 timmar. var god klickaHär för att se en större version av denna figur.

Figur 7
Figur 7: Voges-Proskauer-analys. Acetoinproduktion via glukosfermentering bestämdes med användning av Voges-Proskauer-analysen. WT klassisk stam O395 och representativa El Tor-varianter (MQ1795 och BAA-2163) producerade inte acetoin som ett resultat av glukosfermentering (negativ). WT El Tor-stammar (N16961 och C6706) producerade biprodukten acetoin och kan visualiseras genom en djupröd färgförändring (positiv). Rören inkuberades vid rumstemperatur i 4 timmar. Vänligen klicka här för att se en större version av denna figur.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Av de över 200 identifierade V. Kolerae serogrupper, har endast O1 och O139 epidemisk potential. O1 serogruppen kan delas in i två biotyper: klassisk och El Tor. Hybridstammar, benämnda El Tor-varianter 13 , 17 har emellertid uppstått som besitter El Tor-biotypbakgrunden och har klassiska egenskaper 8 , 9 , 10 , 11 , 12 , 13 , 14 , 15 , 16 , 17 . De protokoll som beskrivs i detta manuskript är utformade för att ge utredare, intresserade av att karakterisera och / eller skilja olika kliniska och icke-kliniska isolat av V. cholerae med en pålitligIdentifieringssystem för flera analyser. Användning av ett pålitligt multi-assay-identifieringssystem som ett alternativ är en förbättring jämfört med tidigare etablerade identifieringssystem för enskilda analyser och arbetsintensiva genetiska skärmar. Alla genotypa och fenotypiska analyser bör innefatta WT klassisk stam O395 och WT El Tor stammar C6706 och N16961 för jämförelse ( Tabell 1 ). Medan de klassiska och El Tor-biotypstammarna ingår som referenser kan isolat, såsom MQ1795 och BAA-2163 som ingår i våra studier, visa fenotypiska profiler från antingen biotyp ( Figur 2 , Figur 3 , Figur 4 , Figur 5 , Figur 6 , Figur 7 , Tabell 2 ), som illustrerar behovet av analys av flera genotypiska och fenotypiska egenskaper för pålitlig karakterisering. Alla protokoll ska utföras aseptiskaLy 26 vid rumstemperatur om inget annat anges. V. Kolerae är en biosäkerhetsnivå 2 (BSL-2) patogen som är det etiologiska medlet för den potentiellt dödliga gastrointestinala sjukdomen kolera; Korrekt hantering och bortskaffande av allt material och avfallsprodukter måste genomföras enligt institutionella, lokala, statliga och federala bestämmelser.

Förberedelse av alla medier och reagens måste utföras med hjälp av analysreagens och ultralätt vatten avjoniseras till en lägsta känslighet av 18 MΩ-cm. Före bearbetningen bör medierna förberedas och tillåtas tillräckligt torra (1-2 dagar); Plattor anses vara tillräckligt torra när ingen kvarvarande vätska finns närvarande på agarets yta. På grund av det motila intervallet och zonerna av clearance kring bakteriell tillväxt, bör motilitet och mjölkplattor beredas i stora petriskålar (150 mm x 15 mm) upp till 50 ml per platta och kan förvaras i upp till 1 vecka insvept i plast , LiD-sidan ner vid 4 ºC. Dessutom kan agarkoncentrationen av motilitetsplattorna justeras för att sänka motiliteten; Det rekommenderas dock inte att överskrida 3 g agar per 500 ml lösning, eftersom detta avsevärt minskar den totala rörligheten så att skillnader inte kommer att observeras. Alla andra plåtmedier ska beredas till cirka 25 ml per platta i standardstorlek Petri-tallrikar (100 mm x 15 mm) och kan förvaras i upp till sex månader inslagna i plast, locksidan ner vid 4 ºC. För framställning av polymyxin B-plattor är det viktigt att låta smälta medier svalna efter autoklavering före tillsättning av polymyxin B, då överdriven värme kan bryta ned antibiotika. Polymyxin B-plattorna kan lagras i upp till 3 månader inslaget i plast, locket nedåt vid 4 ºC. Analyser som diskuteras i detta manuskript kräver en dag för ensam kolonihöjning (12-16 h), en ytterligare dag för tillväxt av över natten kulturer (12-16 h) och en tredje dag för överväganden av genotypisk (~ 4 h för kromosomal DNEn isolering och ~ 3 h för PCR) eller fenotypiska analyser (18-48 h, tabell 2 ). Före den biokemiska analysen av fenotypiska analyser som beskrivs i detta manuskript bör kulturer tvättas i 1x PBS för att förhindra återstående kulturmediaöverföring från skevningsresultat. Dessutom kan polymyxin B, citrat, proteasaktivitet, hemolys och motilitetsanalys inokuleras samtidigt med användning av en enda tvättad över nattkultur. Vid spotting av pläterade medier kan splatter av kulturer förekomma och kan leda till korskontaminering mellan stammar. För att förhindra splash, undvik fullständigt utstötning av kulturen från pipetten, i stället sluta kasta ut kulturen vid pipettens första stopp. Dessutom tillåter fläckar att absorberas fullt ut i agarytan före inkubation och var försiktig så att inte agaret punkteras, vilket kan påverka resultaten. Fenotypiska analyser resulterande i clearancezoner ( Figur 4 ; Figur 5 ; Tabell 2) Och / eller motilitet ( figur 6 , tabell 2 ) som omger inokulationspunkten, bör maximeras åtskilda för att förhindra sammanslagning av områden av clearance eller tillväxt, varpå respektive diametrar kan mätas för jämförande analys. Efter angivna inkubationstider kan isolaten avbildas och analyseras relativt biotypreferensstammarna (WT klassisk O395, WT El Tor C6706 och WT El Tor N16961).

De PCR-baserade genetiska skärmarna genom sekvensering som skisseras i detta manuskript kan användas för att identifiera isolatets biotypbakgrund med avseende på ctxB och tcpA, efter initial PCR-amplifiering. Standard-sekvenseringsriktlinjer kräver en specifik mängd PCR-produkt beroende på storleken på den amplifierade regionen (580 bp för ctxB och 1420 bp för tcpA ), och för att upprätta reaktionerna kan etablerade protokoll följas. Kortfattat, individuell framåt och rEverse sekvenseringsreaktioner bör beredas med 3-5 pmol primer / reaktion och volymen bör justeras till 20 pl med sterilt ultralätt vatten i ett 1,5 ml mikrocentrifugrör. För hjälp i primerdesign för både PCR-amplifiering och sekvensering kan NCBI-primerkonstruktionsverktyget http://www.ncbi.nlm.nih.gov/tools/primer-blast/ användas. Framgångsrik amplifiering och sekvensering av ctxB och tcpA har uppnåtts med användning av följande primers (5 '→ 3'): ctxB- framåt GGGAATGCTCCAAGATCATCGATGAGTAATAC, ctxB-omvänt CATCATCGAACCACAAAAAAGCTTACTGAGG, tcpA- framåt CCGCACCAGATCCACGTAGGTGGG, tcpA-omvänt GTCGGTACATCACCTGCTGTGGGGGCAG. Det bör noteras att hela kodningsregionen av ctxB är bevarad över båda biotyperna förutom baspositionerna 115 och 203 (både cytosin i klassisk och tymin i El Tor). Vidare bevaras flera basförändringar i tcpA bland de biotyper som dIffer över de två biotyperna ( tabell 1 ), som kan användas för att skilja mellan biotyper.

I många laboratoriestudier som involverar modellorganismen V. Kolerae, korrekt underhåll och odlingsteknik är kritiska 27 . Tillväxten av vanligt förekommande V. Koleraebiotypreferensstammar, såsom WT-klassisk stam O395 och WT El Tor-stam N16961, kan ge användbar inblick i karakteriseringen av El Tor-variantisolat ( Figur 1 , Tabell 2 ). På grund av de varierande tillväxttalen över V. Kolerae- isolat, är det viktigt att ta spektrofotometerabsorbansavläsningar varje timme tills kulturerna når maximal grumlighet under den sena stationära fasen. Mid-till-sen dödsfas kan inte visualiseras på grund av en platå i grumlighet som härrör från överflödig cellulär skräp. En 1: 4 utspädning av odling till steril L B-buljong bör utföras för att erhålla en fullständig tillväxtkurva och bibehålla precisionen hos instrumentet, eftersom absorbansavläsningen toppar vid en OD 600 ≈ 1,0. Vid utförande av tillväxtkurvor på multipla stammar bör absorbansavläsningar timas ca 5 minuter från varandra för varje stam för att säkerställa konsekvens mellan avläsningar. Förstå V. Koleraebiotyptillväxten är avgörande för många undersökningar, inklusive virulensgenuttrycksstudier, analys av metaboliska aktiviteter och lämpliga odlings- och lagringsförhållanden. För efterföljande analys bör över nattkulturer bearbetas i den sena loggen till tidig stationär tillväxtfas (12-16 h) för att maximera celltillväxt men upprätthålla cellulär integritet.

Odlingsbetingelser för klassiska och El Tor-biotypstammar liknar emellertid analys av virulensgenuttryck i V. Kolerae kräver biotypspecifika virulensinducerande tillståndRef "> 19. De två huvudsakliga virulensfaktorerna CT och TCP styrs av masterregulator ToxT och uttrycks optimalt under specifika tillväxtförhållanden, exempelvis under El Tor-virulensinducerande betingelser. ToxT kan analyseras genom behandling av helcellsekstrakt ( WCE) eller cellpelleten vid 3,5 timmar, medan CT- och TCP-uttryck kan analyseras genom behandling av den cellfria supernatanten och WCE vid 7,5 h respektive 8 , 20. De olika genotypiska och fenotypiska egenskaper som demonstreras genom detta manuskript visar hur Olika V- cholerae- biotyper kan vara och illustrera behovet av ett alternativ till tidigare användningsanalys av biotypkarakterisering.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Författarna har ingenting att avslöja.

Acknowledgements

Forskning som stöds av New Hampshire-INBRE genom ett Institutional Development Award (IDeA), P20GM103506, från National Institute of General Medical Sciences of the NIH.

Materials

Name Company Catalog Number Comments
1 kb DNA Ladder New England Biolabs N3232S https://www.neb.com/products/n3232-1-kb-dna-ladder
60% Glycerol Calbiochem 356352 http://www.emdmillipore.com/US/en/product/Glycerol%2C-Molecular-Biology-Grade---CAS-56-81-5---Calbiochem,EMD_BIO-356352
Agar Becto, Dickinson and Co. 214030 http://catalog.bd.com/nexus-ecat/getProductDetail?productId=214030&parentCategory=&parentCategoryName=&categoryId=&categoryName=&searchUrl=%2FsearchResults%3Fkeyword%3D214030%26typeOfSearch%3DproductSearch
Agar with brain-heart infusion Becto, Dickinson and Co. 237500 http://catalog.bd.com/nexus-ecat/getProductDetail?productId=237500&parentCategory=&parentCategoryName=&categoryId=&categoryName=&searchUrl=%2FsearchResults%3Fkeyword%3D237500%26typeOfSearch%3DproductSearch
Agarose Peqlab 732-2789 https://de.vwr.com/store/catalog/product.jsp?catalog_number=732-2789&_DARGS=/store/cms/de.vwr.com/de_DE/header_2016111711383215.jsp_AF&_dynSessConf=1766917479792147141&targetURL=/store/catalog/product.jsp%3Fcatalog_number%3D732-2789&lastLanguage=en&/vwr/userprofiling/EditPersonalInfoFormHandler.updateLocale=&_D%3AcurrentLanguage=+&currentLanguage=en&_D%3AlastLanguage=+&_D%3A/vwr/userprofiling/EditPersonalInfoFormHandler.updateLocale=+
Anhydrous K2HPO4 Fisher Scientific P288-500 https://www.fishersci.com/shop/products/potassium-phosphate-dibasic-anhydrous-crystalline-powder-certified-acs-fisher-chemical-5/p288500?searchHijack=true&searchTerm=P288500&searchType=RAPID
Blood Agar Plates Remel R01200 Store at 4 °C;  http://www.remel.com/Catalog/Item.aspx?name=Blood+Agar
Boric Acid Fisher Scientific A73-500 https://www.fishersci.com/shop/products/boric-acid-crystalline-certified-acs-fisher-chemical-6/a73500?searchHijack=true&searchTerm=A73500&searchType=RAPID
Bromothymol Blue Fisher Scientific B388-10 https://www.fishersci.com/shop/products/bromothymol-blue-certified-acs-fisher-chemical/b38810?searchHijack=true&searchTerm=B38810&searchType=RAPID
Cirtric acid ·H2O Fisher Scientific S72836-3 https://www.fishersci.com/shop/products/citric-acid-monohydrate-4/s728363#?keyword=s728363
Deoxynucleotide (dNTP) Solution Kit New England Biolabs N0446S Store at -20 °C;  https://www.neb.com/products/n0446-deoxynucleotide-solutionset
Disodium EDTA Fisher Scientific S311-500 https://www.fishersci.com/shop/products/ethylenediaminetetraacetic-acid-disodium-salt-dihydrate-crystalline-certified-acs-fisher-chemical-7/s311500?searchHijack=true&searchTerm=S311500&searchType=RAPID
DNA Clean & Concentrator™ -25 Kit Zymo Research D4007 http://www.zymoresearch.com/dna/dna-clean-up/zymoclean-gel-dna-recovery-kit
GelGreen Nucleic Acid Stain Biotium 41005 https://biotium.com/product/gelgreentm-nucleic-acid-gel-stain-10,000x-in-water/
Genesys 10SUV-VIS Spectrophotometer Thermo Scientific 840-208100 https://www.thermofisher.com/order/catalog/product/840-208100?ICID=search-840-208100
Gentra Puregene Yeast/Bact. Kit Qiagen 158567 https://www.qiagen.com/us/shop/sample-technologies/dna/dna-preparation/gentra-puregene-yeastbact-kit/#orderinginformation
HCl Fisher Scientific A144-212 Corrosive;  https://www.fishersci.com/shop/products/hydrochloric-acid-certified-acs-plus-fisher-chemical-10/a144212?searchHijack=true&searchTerm=A144212&searchType=RAPID
KCl Fisher Scientific P217-500 https://www.fishersci.com/shop/products/potassium-chloride-crystalline-certified-acs-fisher-chemical-4/p217500?searchHijack=true&searchTerm=P217500&searchType=RAPID
KH2PO4 Fisher Scientific P285-500 https://www.fishersci.com/shop/products/potassium-phosphate-monobasic-crystalline-certified-acs-fisher-chemical-5/p285500?searchHijack=true&searchTerm=P285500&searchType=RAPID
KOH Fisher Scientific P250-500 https://www.fishersci.com/shop/products/potassium-hydroxide-pellets-certified-acs-fisher-chemical-5/p250500?searchHijack=true&searchTerm=P250500&searchType=RAPID
Le Loop Decon Labs Inc. MP190-25 http://deconlabs.com/products/leloop/
Le Stab Decon Labs Inc. MP186-5 http://deconlabs.com/products/lestab/
MgSO4·7H2O Fisher Scientific M63-500 https://www.fishersci.com/shop/products/magnesium-sulfate-heptahydrate-crystalline-certified-acs-fisher-chemical-3/m63500?searchHijack=true&searchTerm=M63500&searchType=RAPID
Mini-Sub Cell GT Horizontal Electrophoresis System Bio Rad Labs 1704406 http://www.bio-rad.com/en-us/product/mini-sub-cell-gt-cell?WT.srch=1&WT.mc_id=aw-cbb-NA-sub_cell_systems_brand_gold&WT.knsh_id=7eb1981f-a011-42a3-aece-1236ff453373
MR-VP Broth Difco 216300 http://catalog.bd.com/nexus-ecat/getProductDetail?productId=216300&parentCategory=&parentCategoryName=&categoryId=&categoryName=&searchUrl=%2FsearchResults%3Fkeyword%3Dmr-vp%2Bmedium%26typeOfSearch%3DproductSearch
Na2HPO4 Fisher Scientific S374-500 https://www.fishersci.com/shop/products/sodium-phosphate-dibasic-anhydrous-granular-powder-certified-acs-fisher-chemical-5/s374500?searchHijack=true&searchTerm=S374500&searchType=RAPID
NaCl Fisher Scientific S271-10 https://www.fishersci.com/shop/products/sodium-chloride-crystalline-certified-acs-fisher-chemical-6/s27110?searchHijack=true&searchTerm=S27110&searchType=RAPID
NaHCO3 Fisher Scientific S233-500 https://www.fishersci.com/shop/products/sodium-bicarbonate-powder-certified-acs-fisher-chemical-5/s233500?searchHijack=true&searchTerm=S233500&searchType=RAPID
NaNH4HPO4·4H2O Fisher Scientific S218-500 https://www.fishersci.com/shop/products/sodium-ammonium-phosphate-tetrahydrate-crystalline-certified-fisher-chemical/s218500?searchHijack=true&searchTerm=S218500&searchType=RAPID
NanoDrop Lite Spectrophtometer Thermo Scientific ND-LITE-PR https://www.thermofisher.com/order/catalog/product/ND-LITE-PR?ICID=search-ND-LITE-PR
Nonfat dry milk Nestle Carnation N/A N/A
Peptone Becto, Dickinson and Co. 211677 http://catalog.bd.com/nexus-ecat/getProductDetail?productId=211677&parentCategory=&parentCategoryName=&categoryId=&categoryName=&searchUrl=%2FsearchResults%3Fkeyword%3D211677%26typeOfSearch%3DproductSearch
Petri Dishes (100 mm x 15 mm) Fisher Scientific FB0875712 https://www.fishersci.com/shop/products/fisherbrand-petri-dishes-clear-lid-12/fb0875712#?keyword=FB0875712
Petri Dishes (150 mm x 15 mm) Fisher Scientific FB0875714 https://www.fishersci.com/shop/products/fisherbrand-petri-dishes-clear-lid-12/fb0875714?searchHijack=true&searchTerm=FB0875714&searchType=RAPID
Polymyxin B sulfate salt Sigma-Aldrich P1004-10MU Store at 2-4 °C; http://www.sigmaaldrich.com/catalog/product/sial/p1004?lang=en&region=US
Taq DNA Polymerase New England Biolabs M0273S Store at -20 °C; https://www.neb.com/products/m0273-taq-dna-polymerase-with-standard-taq-buffer
Taq Reaction Buffer New England Biolabs M0273S Store at -20 °C;  https://www.neb.com/products/m0273-taq-dna-polymerase-with-standard-taq-buffer
Thermal Cycler Bio-Rad C1000 Touch™  Bio Rad Labs 1840148 http://www.bio-rad.com/evportal/evolutionPortal.portal?_nfpb=true&_pageLabel=search_page&sfMode=search&sfStartNumber=1&clearQR=true&js=1&searchString=1840148&database=productskus+productcategories+productdetails+abdProductDetails+msds+literatures+inserts+faqs+downloads+webpages+assays+genes+pathways+plates+promotions&tabName=DIVISIONNAME
Triphenyltetrazolium chloride Alfa Aesar A10870 https://www.alfa.com/en/catalog/A10870/
Tris Base Fisher Scientific BP152-1 https://www.fishersci.com/shop/products/tris-base-white-crystals-crystalline-powder-molecular-biology-fisher-bioreagents-7/bp1521?searchHijack=true&searchTerm=BP1521&searchType=RAPID
Tryptone Becto, Dickinson and Co. 211705 http://catalog.bd.com/nexus-ecat/getProductDetail?productId=211705&parentCategory=&parentCategoryName=&categoryId=&categoryName=&searchUrl=%2FsearchResults%3Fkeyword%3D211705%26typeOfSearch%3DproductSearch
Yeast Extract Becto, Dickinson and Co. 212750 http://catalog.bd.com/nexus-ecat/getProductDetail?productId=212750&parentCategory=&parentCategoryName=&categoryId=&categoryName=&searchUrl=%2FsearchResults%3Fkeyword%3D212750%26typeOfSearch%3DproductSearch
α-napthol MP Biomedicals 204189 http://www.mpbio.com/product.php?pid=05204189

DOWNLOAD MATERIALS LIST

References

  1. Shimada, T., et al. Extended serotyping scheme for Vibrio cholerae. Curr. Microbiol. 28, (3), 175-178 (1994).
  2. Yamai, S., Tadayuki, O., Toshio, S., Yasuji, K. Distribution of serogroups of Vibrio cholerae non-O1 non-O139 with specific reference to their ability to produce cholera toxin, and addition of novel serogroups. Jpn. J. Infect. Dis. 71, (10), 1037-1045 (1997).
  3. Karaolis, D. K., Lan, R., Reeves, P. R. The sixth and seventh cholera pandemics are due to independent clones separately derived from environmental, nontoxigenic, non-O1 Vibrio cholerae. J. Bacteriol. 177, (11), 3191-3198 (1995).
  4. Albert, M. J., et al. Large epidemic of cholera-like disease in Bangladesh caused by Vibrio cholerae O139 synonym Bengal. Lancet. 342, (8868), 387 (1993).
  5. Barua, D. History of Cholera. Cholera. Barua, D., Greenough III, W. B. Plenum Publishing Corporation. 1-36 (1992).
  6. Morales, R., Delgado, G., Cravioto, A. Population Genetics of Vibrio cholerae. Vibrio cholerae-Genomics and Molecular Biology. Faruque, S. M., Nair, G. B. Caister Academic Press. 29-47 (2008).
  7. Samadi, A. R., Chowdhury, M. K., Huq, M. K., Khan, M. U. Seasonality of classical and El Tor cholera in Dhaka, Bangladesh: 17-year trends. Trans. R. Soc. Trop. Med. Hyg. 77, (6), 853-856 (1983).
  8. Son, M. S., Megli, C. J., Kovacikova, G., Qadri, F., Taylor, R. K. Characterization of Vibrio cholerae O1 El Tor biotype variant clinical isolates from Bangladesh and Haiti, including a molecular genetic analysis of virulence genes. J. Clin. Microbiol. 49, (11), 3739-3749 (2011).
  9. Ghosh-Banerjee, J., et al. Cholera toxin production by the El Tor variant of Vibrio cholerae O1 compared to prototype El Tor and classical biotypes. J. Clin. Microbiol. 48, (11), 4283-4286 (2010).
  10. Ansaruzzaman, M., et al. The Mozambique cholera vaccine demonstration project coordination group. Cholera in Mozambique, variant of Vibrio cholerae. Emerg. Infect. Dis. 10, (11), 2057-2059 (2004).
  11. Ansaruzzaman, M., et al. Genetic diversity of El Tor strains of Vibrio cholerae O1 with hybrid traits isolated from Bangladesh and Mozambique. Int. J. Med. Microbiol. 297, (6), 443-449 (2007).
  12. Lan, R., Reeves, P. R. Pandemic spread of cholera: genetic diversity and relationships within the seventh pandemic clone of Vibrio cholerae determined by amplified fragment length polymorphism. J. Clin. Microbiol. 40, (1), 172-181 (2002).
  13. Nair, G. B., Faruque, S. M., Bhuiyan, N. A., Kamruzzaman, M., Siddique, A. K., Sack, D. A. New variants of Vibrio cholerae O1 biotype El Tor with attributes of the classical biotype from hospitalized patients with acute diarrhea in Bangladesh. J. Clin. Microbiol. 40, (9), 3296-3299 (2002).
  14. Nair, G. B., et al. Isolation of Vibrio cholerae O1 strains similar to pre-seventh pandemic El Tor strains during an outbreak of gastrointestinal disease in an island resort in Fiji. J. Med. Microbiol. 55, (11), 1559-1562 (2006).
  15. Nair, G. B., Mukhopadhyay, A. K., Safa, A., Takeda, Y. Emerging hybrid variants of Vibrio cholerae O1. Vibrio cholerae—Genomics and Molecular Biology. Faruque, S. M., Nair, G. B. Horizon Scientific Press. 179-190 (2008).
  16. Safa, A., et al. Genetic characteristics of Matlab variants of Vibrio cholerae O1 that are hybrids between classical and El Tor biotypes. J. Med. Microbiol. 55, (11), 1563-1569 (2006).
  17. Nusrin, S., et al. Diverse CTX phages among toxigenic Vibrio cholerae O1 and O139 strains isolated between 1994 and 2002 in an area where cholera is endemic. J. Clin. Microbiol. 42, (12), 5854-5856 (2004).
  18. Carignan, B. M., Brumfield, K. D., Son, M. S. Single nucleotide polymorphisms in regulator-encoding genes have an additive effect on virulence gene expression in a Vibrio cholerae clinical isolate. mSphere. 1, (5), e00253 (2016).
  19. Iwanaga, M., Yamamoto, K., Higa, N., Ichinose, Y., Nakasone, N., Tanabe, M. Culture conditions for stimulating cholera toxin production by Vibrio cholerae O1 El Tor. Microbiol. Immunol. 30, (11), 1075-1083 (1986).
  20. DiRita, V. J., Claude, P., Georg, J., Mekalanos, J. J. Regulatory cascade controls virulence in Vibrio cholerae. Proc. Natl. Acad. Sci. USA. 88, (12), 5403-5407 (1991).
  21. Kovacikova, G., Lin, W., Skorupski, K. Duel regulation of genes involved in acetoin biosynthesis and motility/biofilm formation by the virulence activator AphA and the acetate-responsive Lys-R type regulator AlsR in Vibrio cholerae. Mol. Microbiol. 57, (2), 420-433 (2005).
  22. Vogel, H. J., Bonner, D. M. Acetylornithinase of Escherechia coli: partial purification and some properties. J. Biol. Chem. 218, (1), 97-106 (1956).
  23. Son, M. S., Taylor, R. K. Genetic screens and biochemical assays to characterize Vibrio cholerae O1 biotypes: classical and El Tor. Curr. Protoc. Microbiol. 6A.2.1-6A.2.17 (2011).
  24. Kovacikova, G., Skorupski, K. Regulation of virulence gene expression in Vibrio cholerae by quorum sensing: HapR functions at the aphA promoter. Mol. Microbiol. 46, (4), 1135-1147 (2002).
  25. Wang, Y., et al. The prevalence of functional quorum-sensing systems in recently emerged Vibrio cholerae toxigenic strains. Environ. Microbiol. Rep. 3, (2), 218-222 (2011).
  26. Sanders, E. R. Aseptic laboratory techniques. J. Vis. Exp. (63), e3064 (2012).
  27. Martinez, R. M., Megli, C. J., Taylor, R. K. Growth and laboratory maintenance of Vibrio cholerae. Curr. Protoc. 6A.1.1-6A.1.6 (2010).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics