Formation de granulés chondrogéniques à partir de cellules souches pluripotentes induites par sang de cordon

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Ici, nous proposons un protocole pour la différenciation chondrogénique des cellules souches pluripotentes induites par les cellules mononucléaires du sang du cordon de l'omble.

Cite this Article

Copy Citation | Download Citations

Nam, Y., Rim, Y. A., Ju, J. H. Chondrogenic Pellet Formation from Cord Blood-derived Induced Pluripotent Stem Cells. J. Vis. Exp. (124), e55988, doi:10.3791/55988 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Le cartilage articulaire humain n'a pas la capacité de se réparer. La dégénérescence du cartilage est donc traitée non par traitement curatif mais par des traitements conservateurs. Actuellement, des efforts sont déployés pour régénérer le cartilage endommagé avec des chondrocytes expansés ex vivo ou des cellules souches mésenchymateuses dérivées de la moelle osseuse (BMSC). Cependant, la viabilité et l'instabilité restreintes de ces cellules limitent leur application dans la reconstruction du cartilage. Les cellules souches pluripotentes induites par l'homme (hiPSC) ont reçu l'attention scientifique comme nouvelle alternative pour les applications regénératives. Avec une capacité d'auto-renouvellement illimitée et multipotence, les hiPSC ont été mis en évidence comme une nouvelle source de cellules de remplacement pour la réparation du cartilage. Cependant, l'obtention d'une quantité élevée de granulés chondrogéniques de haute qualité est un défi majeur pour leur application clinique. Dans cette étude, nous avons utilisé des cellules de descendance dérivées du corps embryoïde (EB) pour la différenciation chondrogénique. Une chondrogénèse réussie a été confirmée par PCR etD coloration avec bleu alcian, bleu de toluidine et anticorps contre les collagènes types I et II (COL1A1 et COL2A1, respectivement). Nous fournissons une méthode détaillée pour la différenciation des iPSC à base de cellules mononucléaires du sang du cordon de cordon (CBMC-hiPSC) en pastilles chondrogéniques.

Introduction

L'utilisation de hiPSCs représente une nouvelle stratégie pour le dépistage de drogue et les études mécanistes de diverses maladies. Du point de vue de la régénération, les hiPSC sont également une source potentielle de remplacement des tissus endommagés qui ont une capacité de guérison limitée, comme le cartilage articulaire 1 , 2 .

La régénération du cartilage articulaire natif a été un défi depuis plusieurs décennies. Le cartilage articulaire est un tissu doux et blanc qui recouvre la fin des os, les protégeant des frottements. Cependant, il a une capacité de régénération limitée lorsqu'il est endommagé, ce qui rend l'auto-réparation presque impossible. Par conséquent, la recherche axée sur la régénération du cartilage est en cours depuis plusieurs décennies.

Auparavant, la différenciation in vitro dans la lignée chondrogénique était habituellement réalisée avec des BMSC ou des chondrocytes indigènes isolés de l'articulation du genou 3 . Due tO leur potentiel de chondrogenic, BMSC et chondrocytes indigènes ont de nombreux mérites soutenant leur utilisation dans la chondrogénèse. Cependant, en raison de leur expansion limitée et de leur phénotype instable, ces cellules sont confrontées à plusieurs limitations dans la reconstruction des défauts du cartilage articulaire. Dans des conditions de culture in vitro , ces cellules ont tendance à perdre leurs propres caractéristiques après 3 à 4 passages, ce qui finit par affecter leurs capacités de différenciation 4 . En outre, dans le cas des chondrocytes indigènes, des dommages supplémentaires à l'articulation du genou sont inévitables lors de l'obtention de ces cellules.

Contrairement aux BMSC ou aux chondrocytes indigènes, les hiPSC peuvent se développer indéfiniment in vitro . Avec les conditions de culture appropriées, les hiPSC ont un grand potentiel en tant que source de remplacement pour la différenciation chondrogénique. Cependant, il est difficile de modifier les caractéristiques intrinsèques des hiPSC 5 . En outre, il faut plusieurs essais in vitro compliqués.Ps pour diriger le sort des hiPSC vers un type de cellule spécifique. Malgré ces complications, l'utilisation de hiPSC est toujours recommandée en raison de leur capacité d'auto-renouvellement élevé et de leur capacité à se différencier en cellules ciblées, y compris les chondrocytes 6 .

La différenciation chondrogénique est généralement effectuée avec des systèmes de culture tridimensionnels, tels que la culture de pastilles ou la culture de micromasses, en utilisant des cellules progénitrices de type MSC. Si vous utilisez le système HiPSC, le protocole pour générer des cellules progénitrices MSC diffère des protocoles existants. Certains groupes utilisent une culture monocouche de hiPSC pour convertir directement le phénotype en cellules MSC 7 . Cependant, la plupart des études utilisent les EB pour générer des cellules secondaires qui ressemblent aux MSC 8 , 9 , 10 , 11 .

Différents types de facteurs de croissance sont utilisés pour induire ChondrogeNesis. Habituellement, les protéines de famille BMP et TGFβ sont utilisées, seules ou en combinaison. La différenciation a également été induite avec d'autres facteurs, tels que GDF5, FGF2 et IGF1 12 , 13 , 14 , 15 . On a montré que le TGFß1 stimule la chondrogénèse de manière dose-dépendante dans les MSC 16 . Par rapport à l'autre isotype, le TGFβ3, le TGFß1 induit une chondrogénèse en augmentant la condensation de la cellule mésenchymateuse pré-cartilagineuse. Le TGFβ3 induit la chondrogénèse en augmentant significativement la prolifération des cellules mésenchymateuses 17 . Cependant, le TGFβ3 est utilisé plus fréquemment par les chercheurs que TGFβ1 7 , 10 , 18 , 19 . BMP2 améliore l'expression de gènes liés aux composants de la matrice chondrogénique chez l'hommeChondrocytes articulaires dans des conditions in vitro 20 . BMP2 augmente l'expression de gènes critiques pour la formation de cartilage dans les MSC en combinaison avec des protéines TGFβ 21 . Il a également été démontré que BMP2 améliore de manière synergique l'effet du TGFβ3 par les voies Smad et MAPK 22 .

Dans cette étude, les CBMC-hiPSC ont été agrégés en EB en utilisant du milieu EB dans une boîte de Petri à faible fixation. Les cellules de dépassement ont été induites en fixant les EB à un plat revêtu de gélatine. La différenciation chondrogénique à l'aide de cellules secondaires a été réalisée par culture de pastilles. Le traitement à la fois avec le BMP2 et le TGFß3 a condensé avec succès les cellules et a induit une accumulation de protéines de la matrice extracellulaire (ECM) pour la formation de granules chondrogéniques. Cette étude suggère un protocole de différenciation chondrogénique simple mais efficace utilisant CBMC-hiPSCs.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Ce protocole a été approuvé par le comité d'examen institutionnel de l'Université catholique de Corée (KC12TISI0861). Les CBMC utilisés pour la reprogrammation ont été obtenus directement de la banque de sang de cordon de l'hôpital St. Mary's de Seoul.

1. Différenciation chondrogénique des iPSC

  1. Production CBMC-iPSC
    1. Générer des CBMC-hiPSC en utilisant le protocole montré dans nos travaux antérieurs 23 .
    2. Recueillir les globules sanguins dans un tube conique de 15 ml et les compter en utilisant un hémocytomètre.
    3. Préparer 3 x 10 5 cellules et centrifuger pendant 5 min à 515 xg et RT. Jeter le surnageant par aspiration et ré-endiguer les cellules dans 0,5 ml de milieu sanguin.
    4. Transférer les cellules dans un puits d'une plaque non-revêtue à 24 puits et ajouter le mélange de virus Sendai, en suivant les recommandations du fabricant.
    5. Centrifuger la plaque pendant 30 min à 1.150 xg et 30 ° C.
    6. En arrièreEr centrifugation, incuber les cellules pendant une nuit (O / N) à 37 ° C dans 5% de CO 2 .
    7. Le lendemain, transférez les cellules transduites vers un puits revêtu de matrice. Centrifuger la plaque à 1 150 xg pendant 30 min à 30 ° C.
    8. Après centrifugation, éliminer le surnageant, ajouter 1 mL de milieu iPSC et maintenir les cellules O / N à 37 ° C dans 5% de CO 2 .
    9. Maintenir les cellules attachées à 37 ° C et 5% de CO 2 . Changez le support tous les jours, en le remplaçant par un support iPSC frais.
      NOTE: Les colonies apparaîtront au jour 14-21 après la transduction.
  2. Génération EB
    1. Maintenir les hiPSC à 37 ° C et 5% de CO 2 . Changez le milieu tous les jours, en le remplaçant par du Essential Essential 8 (E8) moyen.
    2. Préparez 2 x 10 6 hiPSC dans un plat 100 mm en revêtement de vitronectine en milieu E8.
    3. Retirer le milieu E8 du plat de culture et laver avec une solution salée tamponnée au phosphate stérile (PBS).
    4. Ajouter 1Ml d'acide éthylènediaminetétracétique 1 mM (EDTA) et incuber à 37 ° C et 5% de CO 2 pendant 2 min.
    5. Récoltez les cellules avec 3 ml de milieu E8 et transférez-les à un nouveau tube conique de 15 ml. Centrifuger les cellules à 250 xg à température ambiante (RT) pendant 2 min.
    6. Aspirer le surnageant sans perturber le culot cellulaire et ré-endiguer les cellules dans 5 ml de milieu E8.
    7. Comptez les cellules en utilisant un hémocytomètre et préparez 2 x 10 6 cellules pour chaque boîte de Petri de 100 mm. Remettre en suspension les cellules préparées dans un mélange de 10 ml de milieu E8 et EB (1: 1) avec un inhibiteur de la kinase associée au rho 10 μM (ROCK).
    8. Incuber les cellules O / N pour l'agrégation à 37 ° C et 5% de CO 2 .
    9. Le lendemain, récoltez les EB agrégées par pipettage. Centrifuger les cellules à 250 xg pendant 1 min. Retirer le surnageant et remettre en suspension les EB dans 10 ml de milieu E8 frais.
    10. Agrandir les EB générés pendant 5 jours, effectuer des changements quotidiens avec fresH E8 moyen. Pour une maturation supplémentaire, changer le milieu de culture en milieu E7. Maintenir les EB à 37 ° C et 5% de CO 2 pendant 5 jours supplémentaires, en effectuant des modifications quotidiennes moyennes avec du moyen E7 frais.
      REMARQUE: Le support E7 est E8 moyen sans FGF2.
  3. Induction des cellules de décrochage des EB
    1. Ajouter 6 ml de gélatine à 1% dans un plat 100 mm et incuber à 37 ° C et 5% de CO 2 pendant 30 min.
    2. Retirez la gélatine et séchez complètement le plat pendant 2-3 h avant utilisation.
    3. Transférer les EB à un tube conique de 50 ml. Permettre aux EB de s'installer au bas du tube conique. Retirer le surnageant sans déranger les EB.
    4. Remettre en suspension les EB dans 10 mL de milieu de Eagle modifié (DMEM) de Dulbecco avec 20% de sérum bovin fœtal (FBS). Transférer les EB sur le plat en gelée et 100 mm. Ajouter 10 μM ROCK inhibiteur.
    5. Incuber et maintenir les cellules à 37 ° C et 5% de CO 2 pendant 7 jours. Change le thèmeTous les deux jours sans addition d'inhibiteur de ROCK.
  4. Formation de culot chromatographique
    1. Aspirer le milieu de culture du plat et laver les cellules trois fois avec du PBS.
    2. Appliquer 1 mL d'EDTA 1 mM et incuber à 37 ° C et 5% de CO 2 pendant 2 min.
    3. Récoltez les cellules en utilisant 5 mL de DMEM avec 20% de FBS et transférez-les dans un nouveau tube conique de 15 mL.
    4. Centrifuger les cellules pendant 2 min à 250 xg et RT. Jeter le surnageant et remettre à nouveau le culot dans 10 mL de DMEM avec 20% de FBS.
    5. Filtrer et jeter les grappes cellulaires en utilisant une crépine cellulaire de 40 μm et récolter les cellules individuelles. Comptez les cellules individuelles à l'aide d'un hémocytomètre.
    6. Centrifuger les cellules pendant 2 min à 250 xg et RT. Retirer le surnageant et semer 3 x 10 5 cellules par pellet dans un tube conique de 15 ml avec 300 μL de milieu de différenciation chondrogénique (MDP).
    7. Pour la formation de pastilles, centrifuger les cellules pendant 5 min à680 xg et RT.
      REMARQUE: Les granulés sont maintenus dans des tubes coniques de 15 mL lors de la différenciation des pastilles chondrogéniques.
    8. Incuber les cellules pendant une nuit à 37 ° C et 5% de CO 2 .
    9. Changez le MDP tous les 2-3 jours. Dans les 3 jours, les granulés présenteront des morphologies sphéroïdales aplaties. Maintenir les pastilles pendant 21 jours à 37 ° C et 5% de CO 2 .

2. Caractérisation des granulés chondrogéniques par coloration

  1. Incorporation chondrogénique
    1. Avant d'incorporer, préparer et faire fondre la paraffine à 58 ° C.
    2. Fixer les pastilles dans 1 mL de paraformaldéhyde à 4% pendant 2 h à la température ambiante dans un tube de 1,5 ml.
      Attention: le paraformaldéhyde est très toxique. Éviter tout contact avec les yeux, la peau ou les muqueuses. Minimiser l'exposition et éviter l'inhalation tout en la préparant.
    3. Placez une couche de gaze sur la cassette et transférez les pastilles fixes à l'aide d'une pipette. Couvrir la pastille en pliantÉgentez et fermez le couvercle de la cassette.
    4. Initier la déshydratation dans 100 ml d'éthanol à 70% (EtOH) deux fois, 10 min chacun. Déhydrate les pastilles à travers des lavages séquentiels de 10 minutes dans 80% et 95% d'EtOH.
    5. Transférer les pastilles à 100% d'EtOH pendant 10 min. Répétez trois fois avec de l'EtOH frais.
    6. Pour "nettoyer", échanger la solution pour un mélange 100 mL, 1: 1 d'EtOH et de xylene, suivi d'un mélange 1: 2 d'EtOH et de xylène pendant 10 minutes chacun. Effacer l'EtOH restant en incubant les pastilles deux fois dans 100% de xylene, 10 min chacun.
    7. Pour l'infiltration de paraffine, incuber les pastilles dans des mélanges de xylène et de paraffine séquentiels. Effectuer l'ensemble du processus d'infiltration de paraffine à 58 ° C. Incuber les pastilles dans 100 ml d'un mélange 2: 1 de xylène et de paraffine pendant 30 minutes.
    8. Échangez la solution pour 100 ml d'un mélange 1: 1 de xylène et de paraffine et incuberez pendant 30 min.
    9. Échangez la solution pour 100 ml d'un mélange 1: 2 de xylène et de paraffine et incuberez pendant 30 min.
    10. Pour l'infiltration finale, transférer les pastilles au premier bain de 100% de paraffine et incuber pendant 2 h.
    11. Transférer les pastilles au deuxième bain de 100% de paraffine et incuber O / N à 58 ° C.
    12. Le lendemain, transférez doucement les pastilles à un moule à l'aide d'une pince. Ajouter de la paraffine au moule du distributeur de paraffine. Solidifier la paraffine pendant 30 min à 4 ° C.
    13. Coupez les sections à 7 μm et transférez les sections sur la glissière. Laissez les diapositives sécher pendant la nuit et rangez les diapositives à la température ambiante jusqu'à ce qu'elles soient prêtes à l'emploi.
  2. Préparation de la diapositive
    1. Déparaffiner les diapositives en les déplaçant à travers 100 mL de 100%, 90%, 80% et 70% d'EtOH séquentiellement pendant 5 min chacun.
    2. Placez les glissières dans un pot en verre et rincez avec de l'eau du robinet pendant 5 min.
  3. Coloration bleue Alcian
    1. Incuber les glissières dans 50 ml d'une solution de bleu alice à 1% pendant 30 minutes.
      NE PASE: Le bleu Alcian est dilué dans une solution à 3% d'acide acétique. Ajuster le pH à 2,5 en utilisant de l'acide acétique.
    2. Placez les glissières dans un pot en verre et rincez avec de l'eau du robinet pendant 2 min.
    3. Rincer les lames dans de l'eau déminéralisée (DW) et contraster avec une solution nucléaire rapide et rouge pendant 2 min.
    4. Placez les glissières dans un pot en verre et rincer à l'eau du robinet pendant 1 min.
    5. 2.3.5) Procédez pour déshydrater et montez les diapositives à l'étape 2.6.
  4. Teinture de bleu de toluidine
    1. Incuber des lames dans 50 ml de solution de bleu de toluidine pendant 4 min.
    2. Placez les glissières dans un pot en verre et rincez avec de l'eau du robinet pendant 5 min.
    3. Procédez pour déshydrater et montez les diapositives à l'étape 2.6.
  5. Coloration immunohistochimique
    1. Incuber les diapositives dans 3% de H 2 O 2 pendant 15 minutes pour le blocage de peroxydase endogène.
    2. Appliquer 200 μl d'anticorps primaire (anti-COL1A1 et -COL2A1) dilué 1: 100 en tris-bu(TBS) contenant 1% d'albumine de sérum bovin (BSA) et 5% de sérum de chèvre normal (NGS) aux lames et incuber à O / N à 4 ° C.
    3. Le lendemain, placez les diapositives dans un pot en verre et lavez-les avec 50 ml de TBS contenant 0,1% de polysorbate 20 (TBST) trois fois pendant 5 min chacun.
    4. Appliquer 200 μl d'anticorps secondaire (anticorps IgG anti-lapin de chèvre, dilué 1: 200 dans du TBS contenant 1% de BSA et 5% de NGS) aux diapositives et incuber à TA pendant 40 min.
    5. Placez les glissières dans un pot en verre et lavez-les trois fois avec 50 mL, 5 minutes chacune.
    6. Pour l'amplification du signal, appliquer une solution de streptavidine conjugue HRP aux lames et incuber pendant 10 min.
    7. Placez les glissières dans un pot en verre et lavez-les trois fois avec 50 mL, 5 minutes chacune.
    8. Mélanger la solution de substrat DAB-peroxydase, appliquer 200 μL de solution à chaque diapositive et incuber pendant 1 min.
    9. Placez les glissières dans un pot en verre et rincez avec de l'eau du robinet pendant 5 min.
    10. CounterstainAvec l'hématoxyline de Mayer pendant 1 min.
    11. Lavez les diapositives avec DW.
    12. Procédez pour déshydrater et montez les diapositives à l'étape 2.6.
  6. Déshydratation et montage
    1. Déshydratez les diapositives en les déplaçant séquentiellement dans 100 mL de 70%, 80%, 90% et 100% d'EtOH, 30 s chacun.
    2. Trempez les diapositives en deux changements de xylène pendant 1 min chacun.
    3. Ajoutez 50 μL de solution de montage aux lamelles et placez les diapositives sur le dessus.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Dans cette étude, nous avons généré des granulés chondrogéniques provenant de CBMC-hiPSC en induisant des cellules secondaires des EB. La différenciation chondrogénique a été induite par CBMC-hiPSC avec une forte pluripotence confirmée 11 . Un schéma simple de notre protocole est illustré à la figure 1A . Avant la différenciation, les colonies iPSC ont été développées ( figure 1B ). Les iPSC développés ont été assemblés en EB pour initier la différenciation ( figure 1C ). Les EB générés ont été attachés à des plaques revêtues de gélatine pour induire des cellules de décroissance ( Figure 1D ). Ensuite, les cellules descendantes ont été récoltées et utilisées pour générer des granulés chondrogénés. Après 21 jours de différenciation, des granulés chondrogéniques petits et semblables à des perles ont été obtenus et utilisés pour une autre caractérisation ( Figure 1E ). La qualité du chon généré in vitroLes pastilles drogènes ont été confirmés par divers essais.

Nous avons évalué histologiquement la qualité des pastilles chondrogéniques au jour 21. Les pastilles chondrogéniques BMSC ont été utilisées comme témoin positif. L'accumulation de protéines ECM sécrétées par les chondrocytes différenciés a été confirmée par une coloration bleu alcian et bleu toluidine à la figure 2A . Les principales caractéristiques du cartilage sain, comme la production de lacunes et de protéoglycanes, ont augmenté à mesure que le processus de différenciation s'est poursuivi pendant 21 jours. Les granulés chondrogéniques générés par CBMC-hiPSC ont exprimé COL2A1, qui est le principal composant ECM dans le cartilage sain ( figure 2B ). L'expression de COL2A1 des pastilles dérivées de CBMC-hiPSC était supérieure à celle des pastilles dérivées de BMSC. L'expression du collagène type I, un marqueur pour le cartilage fibrotique, était plus faible dans les pastilles CBMC-hiPSC par rapport à l'expression de COL2A1. L'expression génique des protéines ECM du cartilage dans les pastilles chondrogéniques du jour 21 a été confirmée par PCR en temps réel. L'expression d'aggrecan (ACAN) des pastilles dérivées de CBMC-hiPSC était similaire à celle des pastilles dérivées de BMSC ( Figure 3A ). L'expression de COL2A1 était significativement plus élevée dans les pastilles CBMC-hiPSC dérivées ( Figure 3B ). L'expression de la zone Y-box 9 (Sox9) déterminée par le sexe, un marqueur progenitor chondrogénique, a également été évaluée. Les granulés générés à partir de CBMC-hiPSC ont exprimé des niveaux élevés de Sox9 ( Figure 3C ). Nous avons confirmé que ces gènes étaient significativement régulés à la hausse dans les pastilles chondrogènes CBMC-hiPSC par rapport aux granulés de contrôle BMSC au jour 21. L'expression d'un marqueur hypertrophique, COL1A1, a été évaluée ( Figure 3D ). L'expression de COL1A1 dans les pastilles dérivées de CBMC-hiPSC a été réduite par rapport à celle du BMSC-deriPellets fermés. L'efficacité de la différenciation a été analysée par le rapport COL2A1 à COL1A1 ( Figure 3E ). L'augmentation du rapport dans les pastilles CBMC-hiPSC a démontré l'expression relativement élevée de COL2A1 par rapport à COL1A1. En conclusion, nous avons confirmé la capacité de différenciation chondrogénique des CBMC-hiPSCs. La qualité des granulés chondrogéniques dérivés de CBMC-hiPSC générés avait une qualité compatible avec celle des BMSC.

Figure 1
Figure 1: différenciation chondrogénique des hiPSCs. ( A ) Schéma de génération de pastilles chondrogéniques des hiPSCs. ( B ) Morphologie du CBMC-hiPSC généré. ( C ) Morphologie des EB générés. ( D ) Les cellules extractives dérivées des EB sont attachées à un plat de culture enduit de gélatine. ( E ) Image de t Il a obtenu une granulation chondrogénique après 21 jours de différenciation. Les unités des intervalles sont indiquées en millimètres. Barres d'échelle = 200 μm. Cliquez ici pour voir une version plus grande de ce chiffre.

Figure 2
Figure 2: Analyse histologique de la pastille chondrogénique. ( A ) Évaluation histologique des pastilles chondrogéniques au jour 21 en bleu alcian et en bleu toluidine. ( B ) Image d'immunohistochimie des pastilles chondrogéniques colorées avec des anticorps COL1A1 et COL2A1. Barres d'échelle = 100 μm. Cliquez ici pour voir une version plus grande de ce chiffre.

1 "> figure 3
Figure 3: Expression génique de la pastille chondrogénique. ( A ) Expression relative du gène de l'ACAN. ( B ) Expression génique relative de COL2A1. ( C ) Expression génique relative de SOX9. ( D ) Expression génique relative de COL1A1. ( E ) Expression génique de COL1A1. ( F ) Expression génique de COL10A1. ( G ) Le rapport de l'expression du gène COL2A1: COL1A1. Les granulés ont été récoltés et analysés après 21 jours de différenciation. Les données ont été obtenues en utilisant la PCR en temps réel et affichées comme l'erreur standard moyenne des expériences en triple par échantillon (n = 3). L'expression génétique a été normalisée à GAPDH en tant que contrôle interne. (* P <0,05, ** p <0,01, *** p <0,001).K "> Cliquez ici pour voir une version plus grande de ce chiffre.

Numéro de téléphone Rendement des cellules de décroissance Rendement des pastilles
HiPSCs 2 x 10 6 2-5 x 10 7 70-150
MSC 2 x 10 6 - 6

Tableau 1: comparaison de rendement de MSC et hiPSCs.

Nom de la cible Direction Séquence d'amorçage Taille
Vers l'avant TTCCGCGACGTGGACAT 77 pb
Sens inverse TCAAACTCGTTGACATCGAAGGT
UNE CANETTE Vers l'avant AGCCTGCGCTCCAATGACT 107 pb
Sens inverse TAATGGAACACGATGCCTTTCA
COL2A1 Vers l'avant GGCAATAGCAGGTTCACGTACA 79 pb
Sens inverse CGATAACAGTCTTGCCCCACTTA
COL1A1 Vers l'avant CCCCTGGAAAGAATGGAGATG 148 pb
Sens inverse TCCAAACCACTGAAACCTCTG

Tableau 2: Séquences des amorces contre les marqueurs chondrogéniques en PCR en temps réel.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Ce protocole a généré avec succès des hiPSC à partir de CBMC. Nous avons reprogrammé les CBMC aux hiPSC en utilisant un vecteur viral Sendai contenant des facteurs Yamanaka 24 . Trois cas ont été utilisés en différenciation, et toutes les expériences ont généré avec succès des granulés chondrogéniques avec ce protocole. De nombreuses études ont rapporté des protocoles pour la différenciation des hiPSC en chondrocytes 25 , 26 , 27 , 28 . Cependant, des recherches supplémentaires sont nécessaires pour confirmer l'utilisation de CBMC-hiPSC comme candidat à la régénération et à la récupération du cartilage.

La chondrogénèse a été confirmée en utilisant des hiPSC générés à partir de divers types de cellules somatiques 11 , 25 , 26 , 27 , 29 . De nombreux rapports démontrentQue l'origine de la cellule somatique utilisée dans la reprogrammation peut affecter les résultats de différenciation des hiPSC 30 , 31 , 32 , 33 . Le sang de cordon est une source enrichie en HSC et MSC. Il n'y a pas de rapport sur la différence entre les cellules dérivées du cordon, telles que les cellules sanguines ou MSC. Cependant, des études antérieures ont montré que les HiPSC dérivés de chondrocytes articulaires sont plus susceptibles de subir une chondrogénèse que les hiPSC générés à partir de sang de cordon ou de fibroblastes de peau 29 . Les résultats de la différenciation endothéliale à l'aide de hiPSC générés à partir de fibroblastes, de cellules progénitrices cardiaques et de cellules endothéliales ont démontré que le tissu d'origine peut refléter la mémoire somatique spécifique du tissu dans la dérivation iPSC terminale différenciée, en particulier dans les passages précoces, entre 10 et 20 34 . Dans les premiers pas des hiPSC, les cellules endothéliales-deriLes hiPSC ont été différenciés plus efficacement dans la lignée endothéliale. Cependant, la différence significative entre ces lignes cellulaires a disparu dans les hiPSC sur plus de 20 passages. Par conséquent, il est important de considérer soigneusement la mémoire somatique portée par les hiPSC dans les premiers passages lorsqu'ils sont utilisés dans la recherche clinique.

Récemment, diverses procédures ont été développées pour réparer le cartilage articulaire défectueux. La microfracture se fait en forçant de multiples trous dans l'os pour induire l'afflux de moelle osseuse pour une réparation naturelle 35 . Le remplacement du genou, également connu sous le nom d'arthroplastie du genou, sert à remplacer le cartilage endommagé. Cependant, la microfracture n'est pas utile pour les dommages sévères au cartilage articulaire, et l'instrument utilisé pour les remplacements de genou doit être changé tous les 10-15 ans.

Ces jours-ci, les thérapies à base de cellules sont une méthode alternative prometteuse pour la réparation du cartilage. L'implantation autonome des chondrocytes (ACI) est largeUtilisé pour la récupération du cartilage à base de cellules. L'ACI se fait en injectant directement des chondrocytes autologues dans le défaut. Cependant, les chondrocytes autologues se transforment en cellules fibroblastiques sous des conditions de culture in vitro . Des dommages supplémentaires sont également inévitables lors du processus de récolte de chondrocytes autologues. Les MSC ont été suggérés comme source cellulaire pour la récupération du cartilage. Le sang de cordon est une source cellulaire utile et accessible de MSC pour l'ingénierie du cartilage 36 . Le taux de réussite pour isoler les MSC du sang de cordon, cependant, est controversé 37 , 38 . De nombreuses études rapportent l'isolement réussi des MSC du cordon de cordon. Plusieurs études ont montré que le volume de sang du cordon est un paramètre critique qui peut affecter le taux de rendement de l'isolement MSC 36 , 39 . Pour acquérir des MSC de haute qualité, le passage des cellules est également critique. Des études antérieures indiquent queLes MSC ont une durée de vie restreinte après un certain nombre de division cellulaire. En entrant dans la sénescence, les MSC sont caractérisés par une diminution de la prolifération, comme pour toute cellule somatique normale 40 . Par conséquent, les MSC dérivés du sang du cordon doivent être utilisés avant le sixième passage pour éviter la sénescence cellulaire et les anomalies chromosomiques 41 .

Pour éviter ces limitations, les iPSC humaines ont ouvert une nouvelle possibilité pour une thérapie personnalisée basée sur des cellules avec une productivité élevée 11 . Les hiPSC établis peuvent théoriquement proliférer sans limite. En outre, avec la même identité immunitaire que le donneur, ils peuvent éviter le rejet et des effets secondaires inférieurs lorsqu'ils sont implantés in vivo . La transition des banques de sang de cordon dans les banques hiPSC pour un traitement médical allogénique a énormément de possibilités et de potentiel 42 . Le dépistage de CBMC homozygotes à typographie HLA avant la reprogrammation peut largement utiliser les lignes iPSC allogéniques pourR traitement clinique. Les lignées iPSC homozygotes peuvent éviter les réactions immunologiques après une transplantation d'allogreffe. Ce concept peut également être appliqué à la régénération du cartilage en générant du cartilage HLA homozygote 11 .

Habituellement, la différenciation chondrogénique s'effectue par deux étapes critiques: l'induction de cellules de croissance et de formation de pastilles dérivées de EB. La différenciation initiale des hiPSC dans les cellules de croissance dérivées de EB est essentielle pour augmenter leur potentiel de différenciation chondrogénique. Les cellules extracôtières différenciées des hiPSC sont fonctionnellement et moléculairement similaires aux BMSC natives 7 , 43 . Des études antérieures ont utilisé la culture monocouche ou la culture EB comme étape de pré-différenciation pour induire des cellules 10 semblables à des mésenchymes 10 , 43 . Cependant, la différenciation directe par culture monocouche prend beaucoup de temps par rapport à l'utilisation d'EB et ch Les granulés ondrogènes ont tendance à se différencier en fibrocartyle avec des caractéristiques hypertrophiques. Il a été rapporté que la morphologie cellulaire et le potentiel de différenciation chondrogénique des cellules progénitrices mésenchymateuses générées diffèrent considérablement selon la densité cellulaire de la monocouche cellulaire 9 .

Nous avons utilisé des EB pour induire des cellules de croissance, ce qui est une méthode relativement rapide et simple par rapport à la culture monocouche. En utilisant ce protocole, nous avons pu générer de nombreux granulés en utilisant un nombre relativement petit de hiPSC ( tableau 1 ). La taille et le nombre d'EB ont été essentiels à la réussite de la production en masse de granulés chondrogènes. Pour cette raison, nous avons agrandi les EGB agrégés dans le milieu E8, jusqu'à ce que plus de la moitié des EB générés soit supérieure à 100 μm. Après l'élargissement EB, nous avons maintenu les EB en moyen E8 sans FGF2. Auparavant, les chercheurs ont maintenu EBs générés sans FGF2 pour l'induction de lignée mésodermiqueXref "> 9.

Même si nous avons tenté de maintenir les cellules génératrices générées à une densité élevée pour une meilleure qualité, plusieurs limitations subsistent. Bien que nous ayons confirmé que les cellules de croissance générées partagent une morphologie similaire, les cellules peuvent être encore hétérogènes. Des études antérieures ont tenté de trier pour un type de cellule spécifique; Cependant, cette procédure a entraîné la collecte d'un faible nombre de cellules. Une nouvelle tentative d'isolement de cellules de croissance homogènes à plus grande échelle sera nécessaire pour générer une grande quantité de granulés chondrogéniques avec des caractéristiques améliorées.

Divers groupes induisent des cellules progénitrices des hiPSC en utilisant une culture monocouche ou EB. L'induction de cellules progénitrices avec une forte similitude avec les MSC peut être la clé pour obtenir des granulés chondrogéniques de meilleure qualité. Ces cellules progénitrices dérivées d'EB ont des caractéristiques similaires à celles des MSC. Cependant, cela pourrait être dû à laIr fibroblastique. Par conséquent, une étude de validation détaillée sur les cellules de décroissance est nécessaire.

Dans cette étude, nous proposons un protocole qui peut générer une quantité relativement importante de granulés chondrogéniques. Nous avons confirmé que le cartilage régénéré en utilisant CBMC-hiPSCs a montré un phénotype sain et peut être utilisé comme matériau pour la régénération tissulaire. Cependant, une méthode améliorée avec un calendrier de différenciation plus court est nécessaire pour une nouvelle application. Le développement ultérieur des normes de contrôle de la qualité pour valider le cartilage avec un niveau de hyaline plus élevé est également requis pour les futures applications de CBMC-hiPSC en tant que matériau cellulaire pour la régénération du cartilage. Le protocole est simple mais efficace et ne nécessite aucun processus de tri supplémentaire avant la formation de granulés. En conclusion, en utilisant ce protocole, des granulés chondrogéniques de haute qualité peuvent être générés pour des études sur la modélisation de la maladie, le dépistage de médicaments et la médecine régénératrice afin de mieux comprendre notre compréhension de tLa nature du cartilage.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Les auteurs n'ont rien à dévoiler.

Acknowledgements

Ce travail a été soutenu par une subvention du projet de R & D en matière de technologie de la santé de Corée, Ministère de la santé, du bien-être et de la famille, République de Corée (HI16C2177).

Materials

Name Company Catalog Number Comments
Plasticware
100 mm Dish TPP 93100
6-well Plate TPP 92006
50 mL Cornical Tube SPL 50050
15 mL Cornical Tube SPL 50015
10 mL Disposable Pipette Falcon 7551
5 mL Disposable Pipette Falcon 7543
12-well Plate TPP 92012
Name Company Catalog Number Description
E8 Medium Materials
DMEM/F12, HEPES Life Technologies 11330-057 E8 Medium (500 mL)
Sodium Bicarbonate Life Technologies 25080-094 E8 Medium (Conc.: 543 μg/mL)
Sodium Selenite Sigma Aldrich S5261 E8 Medium  (Conc.: 14 ng/mL)
Human Transfferin Sigma Aldrich T3705 E8 Medium (Conc.: 10.7 μg/mL)
Basic FGF2 Peprotech 100-18B E8 Medium  (Conc.: 100 ng/mL)
Human Insulin Life Technologies 12585-014 E8 Medium (Conc.: 20 μg/mL)
Human TGFβ1 Peprotech 100-21 E8 Medium (Conc.: 2 ng/mL)
Ascorbic Acid Sigma Aldrich A8960 E8 Medium  (Conc.: 64 μg/mL)
DPBS Life Technologies 14190-144
Vitronectin Life Technologies A14700
ROCK Inhibitor Sigma Aldrich Y0503
Name Company Catalog Number Description
Quality Control Materials
18 mm Cover Glass Superior HSU-0111580
4% Paraformaldyhyde Tech & Innovation BPP-9004
Triton X-100 BIOSESANG 9002-93-1
Bovine Serum Albumin Vector Lab SP-5050
Anti-SSEA4 Antibody Millipore MAB4304
Anti-Oct4 Antibody Santa Cruz SC9081
Anti-TRA-1-60 Antibody Millipore MAB4360
Anti-Sox2 Antibody Biolegend 630801
Anti-TRA-1-81 Antibody Millipore MAB4381
Anti-Klf4 Antibody Abcam ab151733
Alexa Fluor 488 goat anti-mouse IgG (H+L) antibody Molecular Probe A11029
Alexa Fluor 594 goat anti-rabbit IgG (H+L) antibody Molecular Probe A11037
DAPI Molecular Probe D1306
Prolong gold antifade reagent Invitrogen P36934
4% Paraformaldyhyde Tech & Innovation BPP-9004
Tween 20 BIOSESANG T1027
Bovine Serum Albumin Vector Lab SP-5050
Anti-Collagen II antibody abcam  ab34712 1:100
Alcian blue Sigma Aldrich A3157-10G
Fast Green FCF Sigma Aldrich F7252-25G
Safranin O Sigma Aldrich 090m0039v
Nuclear fast red Americanmastertech STNFR100 
xylene Duksan 115 
Ethanol Duksan 64-17-5
Mayer's hematoxylin solution wako pure chemical industries LAK7534
DAP VECTOR LABORATORIES SK-4100
Slide Glass, Coated Hyun Il Lab-Mate HMA-S9914
Trizol Invitrogen 15596-018
Chloroform Sigma Aldrich 366919
Isoprypylalcohol Millipore 109634
Ethanol Duksan 64-17-5
RevertAid First Strand cDNA Synthesis kit Thermo Scientfic K1622
Name Company Catalog Number Description
Chondrogenic Differentiation Materials
DMEM Life Technologies 11885 Chondrogenic media component (500 mL)
Penicilin Streptomycin Life Technologies P4333 Chondrogenic media component (Conc.: 1%)
Ascorbic Acid Sigma Aldrich A8960 Chondrogenic media component (Conc.: 64 μg/mL) 
MEM Non-Essential Amino Acids Solution (100x) Life Technologies 11140-050 Chondrogenic media component (Conc.: 100 mM)
rhBMP-2 R&D 355-BM-050 Chondrogenic media component (Conc.:100 ng/ml)
Recombinant Hman TGF-beta3 R&D 243-B3-002 Chondrogenic media component (Conc.:10 ng/ml)
KnockOut Serum Replacement Life Technologies 10828-028 Chondrogenic media component (Conc.: 1%)
ITS+ Premix BD 354352 Chondrogenic media component (Conc.: 1%)
Dexamethasone-Water Soluble  Sigma Aldrich D2915-100MG Chondrogenic media component (Conc.:10-7 M)
GlutaMAX Supplement Life Technologies 35050-061 Chondrogenic media component (Conc.: 1%)
Sodium pyruvate solution Sigma Aldrich S8636 Chondrogenic media component (Conc.: 1%)
L-Proline Sigma Aldrich P5607-25G Chondrogenic media component (40 μg/ml)

DOWNLOAD MATERIALS LIST

References

  1. van Osch, G. J., et al. Cartilage repair: past and future--lessons for regenerative medicine. J Cell Mol Med. 13, (5), 792-810 (2009).
  2. Ahmed, T. A., Hincke, M. T. Strategies for articular cartilage lesion repair and functional restoration. Tissue Eng Part B Rev. 16, (3), 305-329 (2010).
  3. Diekman, B. O., et al. Cartilage tissue engineering using differentiated and purified induced pluripotent stem cells. Proc Natl Acad Sci USA. 109, (47), 19172-19177 (2012).
  4. Solchaga, L. A., Penick, K., Goldberg, V. M., Caplan, A. I., Welter, J. F. Fibroblast growth factor-2 enhances proliferation and delays loss of chondrogenic potential in human adult bone-marrow-derived mesenchymal stem cells. Tissue Eng Part A. 16, (3), 1009-1019 (2010).
  5. Guzzo, R. M., Drissi, H. Differentiation of Human Induced Pluripotent Stem Cells to Chondrocytes. Methods Mol Biol. 1340, 79-95 (2015).
  6. Drissi, H., Gibson, J. D., Guzzo, R. M., Xu, R. H. Derivation and Chondrogenic Commitment of Human Embryonic Stem Cell-Derived Mesenchymal Progenitors. Methods Mol Biol. 1340, 65-78 (2015).
  7. Nejadnik, H., et al. Improved approach for chondrogenic differentiation of human induced pluripotent stem cells. Stem Cell Rev. 11, (2), 242-253 (2015).
  8. Teramura, T., et al. Induction of mesenchymal progenitor cells with chondrogenic property from mouse-induced pluripotent stem cells. Cell Reprogram. 12, (3), 249-261 (2010).
  9. Koyama, N., et al. Human induced pluripotent stem cells differentiated into chondrogenic lineage via generation of mesenchymal progenitor cells. Stem Cells Dev. 22, (1), 102-113 (2013).
  10. Ko, J. Y., Kim, K. I., Park, S., Im, G. I. In vitro chondrogenesis and in vivo repair of osteochondral defect with human induced pluripotent stem cells. Biomaterials. 35, (11), 3571-3581 (2014).
  11. Nam, Y., Rim, Y. A., Jung, S. M., Ju, J. H. Cord blood cell-derived iPSCs as a new candidate for chondrogenic differentiation and cartilage regeneration. Stem Cell Res Ther. 8, (1), 16 (2017).
  12. Hotten, G. C., et al. Recombinant human growth/differentiation factor 5 stimulates mesenchyme aggregation and chondrogenesis responsible for the skeletal development of limbs. Growth Factors. 13, (1-2), 65-74 (1996).
  13. Murphy, M. K., Huey, D. J., Hu, J. C., Athanasiou, K. A. TGF-beta1, GDF-5, and BMP-2 stimulation induces chondrogenesis in expanded human articular chondrocytes and marrow-derived stromal cells. Stem Cells. 33, (3), 762-773 (2015).
  14. Shintani, N., Siebenrock, K. A., Hunziker, E. B. TGF-ss1 enhances the BMP-2-induced chondrogenesis of bovine synovial explants and arrests downstream differentiation at an early stage of hypertrophy. PLoS One. 8, (1), e53086 (2013).
  15. Fukumoto, T., et al. Combined effects of insulin-like growth factor-1 and transforming growth factor-beta1 on periosteal mesenchymal cells during chondrogenesis in vitro. Osteoarthritis Cartilage. 11, (1), 55-64 (2003).
  16. Worster, A. A., Nixon, A. J., Brower-Toland, B. D., Williams, J. Effect of transforming growth factor beta1 on chondrogenic differentiation of cultured equine mesenchymal stem cells. Am J Vet Res. 61, (9), 1003-1010 (2000).
  17. Knippenberg, M., et al. Differential effects of bone morphogenetic protein-2 and transforming growth factor-beta1 on gene expression of collagen-modifying enzymes in human adipose tissue-derived mesenchymal stem cells. Tissue Eng Part A. 15, (8), 2213-2225 (2009).
  18. Jang, Y., et al. Centrifugal gravity-induced BMP4 induces chondrogenic differentiation of adipose-derived stem cells via SOX9 upregulation. Stem Cell Res Ther. 7, (1), 184 (2016).
  19. Kang, R., et al. Mesenchymal stem cells derived from human induced pluripotent stem cells retain adequate osteogenicity and chondrogenicity but less adipogenicity. Stem Cell Res Ther. 6, 144 (2015).
  20. Tao, H., et al. Biological evaluation of human degenerated nucleus pulposus cells in functionalized self-assembling peptide nanofiber hydrogel scaffold. Tissue Eng Part A. 20, (11-12), 1621-1631 (2014).
  21. Sekiya, I., Larson, B. L., Vuoristo, J. T., Reger, R. L., Prockop, D. J. Comparison of effect of BMP-2, -4, and -6 on in vitro cartilage formation of human adult stem cells from bone marrow stroma. Cell Tissue Res. 320, (2), 269-276 (2005).
  22. Shen, B., Wei, A., Tao, H., Diwan, A. D., Ma, D. D. BMP-2 enhances TGF-beta3-mediated chondrogenic differentiation of human bone marrow multipotent mesenchymal stromal cells in alginate bead culture. Tissue Eng Part A. 15, (6), 1311-1320 (2009).
  23. Rim, Y. A., Nam, Y., Ju, J. H. Induced Pluripotent Stem Cell Generation from Blood Cells Using Sendai Virus and Centrifugation. J Vis Exp. (118), (2016).
  24. Kim, Y., et al. The Generation of Human Induced Pluripotent Stem Cells from Blood Cells: An Efficient Protocol Using Serial Plating of Reprogrammed Cells by Centrifugation. Stem Cells Int. 2016, 1329459 (2016).
  25. Oldershaw, R. A., et al. Directed differentiation of human embryonic stem cells toward chondrocytes. Nat Biotechnol. 28, (11), 1187-1194 (2010).
  26. Toh, W. S., et al. Differentiation and enrichment of expandable chondrogenic cells from human embryonic stem cells in vitro. J Cell Mol Med. 13, (9B), 3570-3590 (2009).
  27. Hwang, N. S., Varghese, S., Elisseeff, J. Derivation of chondrogenically-committed cells from human embryonic cells for cartilage tissue regeneration. PLoS One. 3, (6), e2498 (2008).
  28. Nakagawa, T., Lee, S. Y., Reddi, A. H. Induction of chondrogenesis from human embryonic stem cells without embryoid body formation by bone morphogenetic protein 7 and transforming growth factor beta1. Arthritis Rheum. 60, (12), 3686-3692 (2009).
  29. Guzzo, R. M., Scanlon, V., Sanjay, A., Xu, R. H., Drissi, H. Establishment of human cell type-specific iPS cells with enhanced chondrogenic potential. Stem Cell Rev. 10, (6), 820-829 (2014).
  30. Rim, Y. A., Park, N., Nam, Y., Ju, J. H. Generation of Induced-pluripotent Stem Cells Using Fibroblast-like Synoviocytes Isolated from Joints of Rheumatoid Arthritis Patients. J Vis Exp. (116), (2016).
  31. Pfaff, N., et al. Efficient hematopoietic redifferentiation of induced pluripotent stem cells derived from primitive murine bone marrow cells. Stem Cells Dev. 21, (5), 689-701 (2012).
  32. Xu, H., et al. Highly efficient derivation of ventricular cardiomyocytes from induced pluripotent stem cells with a distinct epigenetic signature. Cell Res. 22, (1), 142-154 (2012).
  33. Lee, S. B., et al. Contribution of hepatic lineage stage-specific donor memory to the differential potential of induced mouse pluripotent stem cells. Stem Cells. 30, (5), 997-1007 (2012).
  34. Hu, S., et al. Effects of cellular origin on differentiation of human induced pluripotent stem cell-derived endothelial cells. JCI Insight. 1, (8), 1-12 (2016).
  35. Vonk, L. A., de Windt, T. S., Slaper-Cortenbach, I. C., Saris, D. B. Autologous, allogeneic, induced pluripotent stem cell or a combination stem cell therapy? Where are we headed in cartilage repair and why: a concise review. Stem Cell Res Ther. 6, (94), 1-11 (2015).
  36. Gomez-Leduc, T., et al. Chondrogenic commitment of human umbilical cord blood-derived mesenchymal stem cells in collagen matrices for cartilage engineering. Sci Rep. 6, 32786 (2016).
  37. Mareschi, K., et al. Isolation of human mesenchymal stem cells: bone marrow versus umbilical cord blood. Haematologica. 86, (10), 1099-1100 (2001).
  38. Wexler, S. A., et al. Adult bone marrow is a rich source of human mesenchymal 'stem' cells but umbilical cord and mobilized adult blood are not. Br J Haematol. 121, (2), 368-374 (2003).
  39. Zhang, X., et al. Isolation and characterization of mesenchymal stem cells from human umbilical cord blood: reevaluation of critical factors for successful isolation and high ability to proliferate and differentiate to chondrocytes as compared to mesenchymal stem cells from bone marrow and adipose tissue. J Cell Biochem. 112, (4), 1206-1218 (2011).
  40. Wagner, W., et al. Replicative senescence of mesenchymal stem cells: a continuous and organized process. PLoS One. 3, (5), e2213 (2008).
  41. Tarte, K., et al. Clinical-grade production of human mesenchymal stromal cells: occurrence of aneuploidy without transformation. Blood. 115, (8), 1549-1553 (2010).
  42. Chen, W. C., et al. Prediction of poor survival by cyclooxygenase-2 in patients with T4 nasopharyngeal cancer treated by radiation therapy: clinical and in vitro studies. Head Neck. 27, (6), 503-512 (2005).
  43. Guzzo, R. M., Gibson, J., Xu, R. H., Lee, F. Y., Drissi, H. Efficient differentiation of human iPSC-derived mesenchymal stem cells to chondroprogenitor cells. J Cell Biochem. 114, (2), 480-490 (2013).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics