Montering och rening av prototyp skummande Virus Intasomes

Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Rekombinant retrovirala integras och DNA oligomerer härma virala DNA-ändarna kan bilda ett enzymatiskt aktivt komplex som kallas en intasome. Intasomes kan användas för biokemiska, strukturella och kinetiska studier. Detta protokoll Detaljer hur man monterar och rena prototyp skummande virus intasomes.

Cite this Article

Copy Citation | Download Citations

Mackler, R. M., Lopez Jr., M. A., Yoder, K. E. Assembly and Purification of Prototype Foamy Virus Intasomes. J. Vis. Exp. (133), e57453, doi:10.3791/57453 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

A definiera funktionen och nödvändigt steg av retrovirus livscykel är integrationen av det virala genomet i värd genomet. Alla retrovirus koda en integrashämmare (IN) enzym som katalyserar den kovalenta sammanfogningen av viral till värd DNA, som kallas strand överföring. Integration kan vara modellerade i vitro med rekombinant retrovirala IN och DNA oligomerer härma ändarna av det virala genomet. För att sammanfatta närmare integration reaktionen som uppstår i vivo, integration är komplex monteras från rekombinant IN och syntetiska oligomerer av dialys i en minskad salthalt buffert. Att integrera komplexa, kallas en intasome, kan renas genom storlek utslagning kromatografi. När det gäller prototyp skummande virus (PFV), intasome är en tetramer av i och två DNA oligomerer och separeras lätt från monomer IN och gratis oligomer DNA. PFV intasomes integration effektivitet kan analyseras under en mängd experimentella förhållanden att bättre förstå dynamiken och mekanik av retrovirala integration.

Introduction

Integrering av det virala genomet i värd genomet är ett obligatoriskt steg i livscykeln för alla retrovirus1. Den virala enzymet integras (IN) katalyserar den kovalenta sammanfogningen av varje ände av det virala DNA-genomet till värd DNA. Under en cellulär infektion, är en del av ett före integration-komplex som medierar integration. Rekombinant i komplex med dubbel stranded DNA oligomerer härma de virala DNA-ändarna kan också utföra integrering i en target DNA in vitro-2. En gemensam integration test in vitro- använder en supercoiled plasmid som mål DNA. Integrering av både viral DNA oligomerer (vDNA) till plasmiden resulterar i en linjär produkt och kallas samordnade integration (figur 2A). Den integration test in vitro- kan också ge produkter med endast en vDNA kovalent ansluten till målet plasmiden vilket resulterar i en avslappnad cirkel. Denna halv-site integrering produkt verkar vara en artefakt av test in vitro.

Rekombinant IN och vDNA kan utföra integration i vitro, men de är inte perfekta reagenser för studiet av dynamiken eller struktur av integration komplex när monomer IN skulle skymma relevanta visualisering. Renat integration komplex, eller ”intasomes”, krävs för dynamiska enda molekyl analys eller strukturella studier. PFV IN och vDNAs kan monteras genom dialys från en relativt hög saltkoncentration buffert till en lägre saltkoncentration3,4. Under dialys, en fällning former. Denna utfällning tas bort från dialys och Saltkoncentrationen ökar. Högre Saltkoncentrationen solubilizes den fällning som innehåller PFV intasomes. Intasomes sedan renas genom storlek utslagning kromatografi (SEC). Rekombinant prototyp skummande virus (PFV) IN har visat att existera som en monomer i lösningen vid koncentrationer upp till 225 µM5. SEC fraktionering separerar effektivt det PFV intasomes (225.5 kDa), som omfattar en tetramer PFV i och två vDNAs, från monomer PFV i (44,4 kDa) och gratis vDNA (24,0 kDa). Den PFV intasomes kan frysas och bevara integration aktivitet för minst sex månaders lagring vid-80 ˚C.

Rekombinant PFV intasomes kan också ändras för att inkludera i aminosyran substitutioner eller trunkering mutationer eller vDNAs märkt med fluorophores eller biotin4,6. De renade PFV intasomes utför lätt integreras måltavla supercoiled plasmid DNA i vitro. Bulk biokemiska integration analyser med intasomes kan testa effekterna av mutationer, i-hämmare eller andra kemiska tillsatser. Biotinylerade intasomes kan användas till probe samhörighet med nukleinsyror eller proteiner. PFV intasomes är funktionella vid omgivande temperatur möjliggör enda molekyl mikroskopi analys av magnetisk pincett att mäta tiden mellan sammanfogningen av de två vDNA ändar eller totalreflexion fluorescens att visualisera intasome Sök på målet DNA6. PFV intasomes var dessutom först med att vara strukturellt kännetecknas avsevärt påverkar området för retrovirala integration3.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. glödgning av vDNA

  1. Kombinera 1 X tio buffert (10 X tio lager: 100 mM Tris-HCl, pH 8,0, 1 M NaCl, 10 mM EDTA), 10 µM Oligo 1 (5' ATTGTCATGGAATTTTGTATATTGAGTGGCGCCCGAACAG 3', 100 µM lager) och 10 µM Oligo 2 (5' CTGTTCGGGCGCCACTCAATATACAAAATTCCATGACA 3', 100 µM lager) i en slutlig volym av 1,5 mL . Alikvotens 25 µL till sextio 0,2 mL polymeras-kedjereaktion (PCR) rör.
    Obs: Beroende på applikation, oligomerer modifieras med fluorophores eller taggar i 5'-slutet av Oligo 2 eller som en inre amino-T bas 13 från 5'-ände Oligo 1. Modifierade oligomerer bör renas genom högpresterande vätskekromatografi (HPLC) före glödgning. Vi har funnit att 5'-änden Cy3 eller Cy5 fluorophore märkning av Oligo 2 minskar den intasome montageverkstadseffektivitet 10-faldigt. Interna fluorophore märkning minskar inte montageverkstadseffektivitet.
  2. Glödga med en termocykler med följande tider och temperaturer: 1 cykel vid 94,0 ˚C 3 min, 99 cykler vid (94,0 ˚C 1 min, 93,6 ˚C 1 min) minskar både temperaturer av 0,8 ° c per cykel (den sista cykeln är 14,8 ˚C 1 min, 14.4 ° c 1 min) , och lagra vid 4.0 ˚C.
  3. Kombinera glödgning reaktionerna från alla sextio rör. Ladda 500 µL till två 0,5 mL 3 kDa molekylvikt cutoff (MWCO) ultracentrifugal koncentration filteraggregat. Koncentrat av glödgad vDNA genom centrifugering i en mikrocentrifug vid 14 000 x g under 10 minuter vid rumstemperatur (RT).
    Obs: Den retentate volymen bör vara ~ 50 µL i varje koncentration enhet.
  4. Kassera flödet genom. Tillsätt 250 µL av de återstående glödgad vDNA till varje filterenhet. Upprepa spin och kasta flödet genom. Buffra exchange in TE buffert (10 mM Tris-HCl, pH 8,0, 1 mM EDTA) genom att tvätta tre gånger med 450 µL TE.
  5. Invertera den filterenheten och snurra på 1 000 x g under 2 minuter vid RT. Den slutliga retentate volymen för varje filterenhet bör ~ 50 µL. kombinera retentates och överföring till ett 1,5 mL skruvlock rör.
  6. Mät absorbansen hos vDNA 260-nm ultraviolett (UV). Använda detta värde för att beräkna den slutliga molar DNA-koncentrationen. En extinktionskoefficient (ε260) av denna vDNA är 622,803 cm-1 M-1 och dess molekylvikt är 23,972 Da. förvaras vid-20 ° c.

2. Intasome församling

  1. Om möjligt, utför den intasome församlingen i ett litet rum med en variabel termostat. Justera termostaten att ungefär 18-22 ˚C.
    Obs: Vår erfarenhet intasome församlingen vid 4 ° c är ineffektiva.
  2. Laga 1 L av dialys buffert (20 mM Bis-tris propan, pH 7.5, 200 mM NaCl, 2 mM Ditiotreitol (DTT), 25 µM ZnCl2) i en 2 L bägare med en uppståndelse bar på en uppståndelse tallrik. Temperera bufferten i 18-22 ˚C rummet för minst 6 h.
  3. För att montera intasomes, kombinera 50 mM Bis-tris propan, pH 7.5, 500 mM NaCl, 120 µM PFV i och 50 µM vDNA i en total volym på 150 µL.
    Obs: PFV IN bör fritt av kontaminerande nuclease aktivitet7,8. Om koncentrationen av PFV i är alltför utspädd att rymma 120 µM IN i 150 µL volym, då är det möjligt att öka den slutliga volymen till 200 µL. De kritiska faktorerna för detta steg är att upprätthålla molar förhållandet av i att vDNA (2.4:1) och har tillräckligt komplex att visualisera under kromatografi.
  4. Ren en ~ 10 cm lång bit 10 mm 6-8 kDa MWCO dialys slangar och klipp med dubbel destillerat vatten (ddH2O) eller det högsta renhet vattnet tillgängligt. Kläm fast ena änden av slangen.
    Obs: Dialys slangar ska hanteras med omsorg för att förhindra möjlig kontaminering från lab utrymme.
  5. Göra 15 mL av dialys slangar skölj buffert (50 mM Bis-tris propan, pH 7.5, 500 mM NaCl). Skölj insidan av dialys slangar tre gånger med 1-2 mL skölj buffert. Avlägsna så mycket av skölj bufferten som möjligt med en pipett och tunn gel lastning tip.
  6. Om det behövs, Använd en ren rakblad eller skalpell skära den dialys slangar så att en tunn gel lastning spets kan nå slutet av slangen.
  7. Överföra den intasome församlingen från steg 2,3 till dialys slangar med en pipett och en tunn gel som laddar tip. Klipp den öppna änden av dialys slangar, minimera mängden luft som infördes inom slangen. Placera slangen in i dialys bufferten.
  8. Dialyze övernattning (16-20 h) med skonsam omrörning så att slangen roterar men är inte i en virvel. Säkerställa att dialys slangar är nedsänkt och mobil. Efter cirka en timme, iaktta en synlig fällning inuti slangen.
    Obs: Med Cy3 eller Cy5 fluorescently märkt vDNA, fällningen är mer uppenbara. Detta gäller för både slutet märkt och internt märkt fluorescerande vDNA.

3. Intasome lösbarhet

  1. Förbered två breda bore pipettspetsar genom att ta bort 2-4 mm från slutet av ett 200 µL tips med en ny rakhyvel eller skalpell bladet på en ren yta.
    Obs: Tips kommer att användas i steg 3.3 och 3.5.
  2. Ta bort dialys slangar från dialys bufferten. För att förhindra utspädning av intasome provet med dialys buffert som kan finnas kvar i slutet av slangen nära klippet, Använd en mikropipett med en liten pipettspetsen ta bort någon överflödig dialys buffert. Ta bort klippet från ena änden av dialys slangar.
  3. Använda ett brett bore pipettspetsen från steg 3.1 överföra provet inklusive fällningen inuti dialys slangar till en 1,5-mL tub på is. Notera den totala volymen av det återvunna materialet; den totala volymen är vanligtvis ~ 140 µL.
  4. Provet med fällning är på 200 mM NaCl. öka saltet till en slutlig koncentration av 320 mM NaCl genom att lägga lämplig volym av ett lager 5 M NaCl-lösning. Lägg exempelvis till 3,9 µL 5 M för ett urval av 150 µL, NaCl och 1.1 µL ddH2O för en slutlig volym av 155 µL. överföring ishink med prov i ett kallt rum 4 ˚C.
  5. Använda ett brett bore pipettspetsen från steg 3.1 för att resuspendera och solubilize fällningen av pipettering. Upprepa varje 20 min för minst 1 h. Observera att de flesta av fällningen bör gå i lösning.
    Obs: Pipettering för att resuspendera fällningen kan stoppas när det är uppenbart att fällningen längre märkbart minskar mellan tidpunkter. När vDNA inte är märkt eller är internt märkt, minskar fällningen av ~ 90% baserat på visuell inspektion. Cy5 slutet märkt vDNA, är fällningen sänkas med endast ~ 20%; de flesta av fällningen med fluorophore slutet märkt vDNA kommer inte solubilize. Mängden utfällning som är effektivt solubilized är variabel och bestämmas empiriskt.

4. Intasome rening

  1. Bereda 250 mL storlek utslagning kromatografi (SEC) kör buffert (20 mM Bis-tris propan, pH 7.5, 320 mM NaCl, 10% glycerol). Sterila filter bufferten med ett 0,2 µm filter enhet och lagra vid 4 ˚C.
    Obs: Alla reningssteg utförs i ett kallt rum 4 ˚C.
  2. Temperera en tvärbunden agaros SEC kolumn (diameter = 10 mm, längd = 300 mm; säng volym = 24 mL; prova volym = 25-500 µL; maximalt tryck = 1,5 MPa; uteslutning gräns = 4 x 107 Da; separerar molekylvikter mellan 5 och 5.000 kDa, se av bordsunderlägg bergavverk) med SEC rinnande buffert med en flödeshastighet av 0,4 mL/min.
    Obs: Denna rening kan anpassas till olika storlek utslagning kolumner om de kan effektivt separera 300 kDa från 44 kDa, såsom Superose 12 10/300 GL eller Superose 6 öka. Superose 12 10/300 GL har lägre upplösning, vilket leder till mer överlappning av topparna. Omvänt, Superose 6 öka har högre upplösning och bättre separation.
  3. Centrifugera intasome provet i en microfuge vid 14 000 x g under 10 minuter vid 4 ° c till pellet eventuell återstående fällning. Ta försiktigt bort supernatanten. Ladda supernatanten till en 200 µL injektionsslinga (slang som kan hålla ~ 200 μL). Gälla kolumnen SEC provet.
    Obs: Mindre belastning volymer tillåter större upplösning av SEC.
  4. Eluera med 25 mL SEK kör buffert och samla 95 fraktioner av 270 µL. Observera att SEC kromatogrammet visar tre A280/a260 toppar (figur 1).
    Obs: Först ska vara en sammanvägning (~9.0 - 11,5 mL eluering), följt av PFV tetramer intasome topp (~12.0 - 14.75 mL eluering) och PFV i monomeren med gratis vDNA topp (~15.0 - 18,0 mL).

5. integration Strand överföring Assay, bråkdel urval och Storage

  1. Kombinera 2 µL av varje intasome peak bråkdel och 50 ng 3 kb supercoiled plasmid DNA (lager koncentration är 50 ng/µL) i reaktion buffert (10 mM Bis-tris propan, pH 7.5, 110 mM NaCl, 5 mM MgSO4, 4 µM ZnCl2, 10 mM DTT) i en slutlig reaktionsvolym 15 µL. Inkubera vid 37 ° c i 5 min.
  2. Inkludera en negativ kontroll med inga extra PFV-intasome. Stoppa reaktionen med 0,75 µL proteinas K (20 mg/mL stamlösning) och 0,75 µL SDS (10% stamlösning). Inkubera vid 55 ° c för 1 h. Store prover som behövs vid-20 ˚C för senare analyser.
    Obs: Denna analys är en kvalitativ bedömning av integration aktivitet. Intasome molära koncentrationen av respektive fraktion bestäms inte före denna analys. Fraktioner som ingår i integration strand överföring analysen kan förvaras på is (inklusive övernattning lagring) tills integration aktivitet bekräftas och valda fraktioner är aliquoted. Här använder vi pMP2, en pUC19 derivat9. Vi har också framgångsrikt använt den 5.4 kb plasmiden pcDNA 3.1. Någon Plasmiden kan lösas till avslappnad cirkel, linjär, och supercoiled former kan användas som ett mål för integration.
  3. Förbereda en 120 mL 1% vikt per volym (w/v) agarosgel i 1 X TAE buffert (40 mM Tris-acetat, 1 mM EDTA) med 0,1 μg/mL etidiumbromid metylbromid (EtBr, 10 mg/mL stamlösning)10. Smälta agarosen lösningen och häll det i en 15 x 10 cm gel gjutning facket. Infoga en 15-väl kam med 5 mm brett, 0,75 mm tjock brunnar.
    Obs: Smalare brunnar ge bättre band upplösning jämfört med 1,5 mm tjock brunnar.
  4. Låt gelen stelna i rumstemperatur. Sänk ner gelen i 1 X TAE med 0,1 μg/mL EtBr.
  5. Lägga till 3 µL 50% glycerol varje integration reaktion från steg 5.2. Fyll hela reaktion volymen till gelen. Ladda 1 µL 10 kb DNA storlek-markör (150 ng/µL lager koncentration) till lanes på vardera sidan av proverna; med andra ord, bör DNA storlek markören flankerar köer som provet.
  6. I en yttre lane, Ladda 6 µL Orange G färgämne (0,25% Orange G, 30% glycerol). Kör gelen vid konstant spänning, 10 V/cm (100 V) vid rumstemperatur i 1 h eller tills Orange G dye framdel når slutet av gelen.
  7. Omedelbart bild på agarosgel med fluorescerande skanner anger att upptäcka EtBr (532 nm excitation, 610 nm utsläpp filter). Om fluorophore märkt vDNAs användes, också bild med lämpliga fluorophore inställningar.
    Obs: till exempel att upptäcka Cy5 märkt DNA, bild med 633 nm excitation och 670 nm utsläpp filter. Samordnade integrationsprodukter (CI, linjära DNA) bör köra normal i storleken på ~ 3 kb, oreagerad supercoiled plasmid (SC) ska köras snabbare (~ 2 kb) och halv-site integrationsprodukter (HSI, avslappnad cirkel DNA) bör köra långsammare (~3.5 kb). Oreagerad vDNA bör köra normal i storleken på ~ 40 bp.
  8. Kvantifiera banden i varje lane med imaging software7. Beräkna del av DNA i varje körfält som är CI, HSI eller SC; vDNA ingår inte i denna beräkning.
    Obs: Integration effektivitet eller fraktionen av SC omvandlas till en linjär produkt, beräknades genom att dividera mängden pixel samordnade integrationsprodukter (CI) av den totala pixel volymen av tre band (HSI + CI + SC). Om intasomes är fluorophore märkt, kan HSI och CI produkter också vara quantitated av fluorescens.
  9. Välj fraktioner som har den mest samordnade integration-aktiviteten.
    Obs: Vår erfarenhet peak samordnade integration aktiviteten sammanfaller med protein toppen identifieras som tetrameriskt PFV intasomes. Mät den A280 av varje av dessa fraktioner och beräkna den slutliga intasome koncentrationen. Den ε280 för en tetramer av vildtyp PFV IN med två vDNAs som beskrivs här är 908,339 cm-1M-1 och molekylvikten är 225.5 kDa. Koncentrationerna bör följa samma mönster som SEC kromatogrammets topp och i strand överföring analysen.
  10. Distribuera varje fraktion i 5 µL portioner och nafsa frysa i flytande kväve. Lagra alikvoter vid-80 ˚C. Fraktioner som valts för lagring är vanligen mellan 200-600 nM.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

PFV intasomes monteras från rekombinant IN och vDNA. Efter monteringen renas intasomes av SEC (figur 1). Integration aktiviteten av respektive fraktion har analyserats med en supercoiled DNA mål och agaros gel-elektrofores (figur 2). Denna gel är avbildade med fluorescerande skanner anger att upptäcka EtBr (och fluorophore, om fluorophore-märkt vDNA används). Med bild analys programvara, kan bandet pixel volymer användas att beräkna integration effektivitet (figur 3). Fraktioner med högsta integration effektivitet är kick frysas för senare användning. Fryst fraktioner behålla integration aktivitet (figur 4), vilket möjliggör långsiktig lagring av sammansatta intasomes. Någon etikett molekylen och dess ställning inom vDNA kan påverka intasome montageverkstadseffektivitet (figur 5).

Figure 1
Figur 1: storlek utslagning kromatogrammet. En PFV intasome församling avskildes med en agaros SEC kolumn. Den här kolumnen tillåter för separation av sammanlagt (1), PFV intasome bestående av en tetramer av PFV i och två vDNA (2), och monomer PFV i vDNA (3). Detta exempel ingår vDNA med en inre Cy5 fluorophore etikett upptäcks av 650 nm excitation. Y-axeln anger optiska densitet (OD) milli-absorbans enheter (mAU). Klicka här för att se en större version av denna siffra.

Figure 2
Figur 2: Integration haltbestämning av SEC fraktioner. (A) Schematisk bild av integration strand överföring reaktion. Vänster, tecknad av en PFV intasome inklusive en tetramer av i (blå cirklar) och två vDNA (tjocka svarta linjer), och en target plasmid (tunna svarta linjer). Supercoils (SC) i målet plasmiden dras inte. Center, tecknad av en halv-site integrering (HSI) produkt när en vDNA har fått sällskap kovalent till målet Plasmiden. Gå med reaktionen introducerar en nick och slappnar av i supercoils. Höger, tecknad av en samordnade integration (CI) produkt där två vDNAs har fått sällskap till mål-DNA. Denna integration produkt resulterar i en linjär DNA med vDNAs i ändarna. (B) Supercoiled plasmid DNA lades till varje sekund bråkdel #49-55. Efter inkubation, integration reaktionerna var deproteinated och åtskilda av 1% agaros gel-elektrofores innehållande EtBr. Negativ kontroll var plasmid DNA med ingen protein (T). DNA-markörer som storlek visas i kb. Supercoiled plasmid (SC), samordnade integrationsprodukter (CI), halv-site integrering produkter (HSI) och vDNA indikeras. (C) agarosen gel skannades för förekomst av Cy5. Endast den vDNA CI och HSI produkter är synliga. Klicka här för att se en större version av denna siffra.

Figure 3
Figur 3: kvantitering av integration assay. Agarosgel från figur 2 var skannas och kvantifieras för förekomst av både (A) EtBr och (B) Cy5. (A) för EtBr beräkning, HSI, CI och SC bandet pixel volymer erhölls med gel analysprogramvara. Integration effektivitet har beräknats genom att dividera mängden pixel samordnade integrationsprodukter (CI) av den totala pixel volymen av alla tre band (HSI + CI + SC). Till exempel pixelvärdena i EtBr kanal för banden i bråk #49 är: 110565.2, SC, 25152.56 CI och 6313.04 HSI. Det totala DNA pixelvärdet för bråkdel #49 är summan av dessa värden, 142030.8. Integration effektiviteten är CI pixel volymen av 25152.56 dividerat med det totala DNA-värdet 142030.8 för 0,18. (B), Cy5 CI bandet pixel volymer återgivningsegenskaper som godtyckliga enheter. Fraktioner med peak integration aktivitet är individuellt aliquoted och fryst. I det här exemplet valdes fraktioner #50-53. Alikvoter är kick fryst med flytande kväve och lagras vid-80 ° c för framtida bruk.

Figure 4
Figur 4: effekten av frysning på intasome aktivitet. Hälften av en SEC bråkdel var flash frozen med flytande kväve, lagras vid-80 ˚C för 1 h, och sedan långsamt tinats på is. Den andra hälften i bråket som SEC hölls på is i ett kallt rum medan den första halvan var frysta och tinade. Intasomes testades för aktivitet utan (-) och med (+) frysning/upptining. Integration effektivitet mättes som beskrivs ovan. (A) EtBr målat agarosgel av integration reaktionsprodukter. Supercoiled plasmid (SC), samordnade integrationsprodukter (CI), halv-site integrering produkter (HSI) och oreagerade vDNA indikeras. DNA-markörer som storlek visas i kb. (B) kvantitering av integration effektivitet från EtBr bilden. Beräkningarna beskrivs i figur 3 legend. Det finns ingen förlust av integrering aktivitet efter frysning och upptining. Den genomsnittliga integration effektiviteten visas 5 oberoende experiment med 2 intasome preparat. Felstaplar visar standardavvikelsen. Parat t-test analyser gav en tvåsidiga P = 0,011, vilket tyder på att frysas och tinas kan något har förstärkt integration aktivitet. Klicka här för att se en större version av denna siffra.

Figure 5
Figur 5: etikett molekyl och position effekter intasome montering. PFV intasome församlingar ingår vDNAs som var omärkt (röd), slutet märkt på Oligo 2 med Cy5 (blått), internt märkt på Oligo 1 med Cy5 (svart), eller slutet märkt på Oligo 2 med biotin (orange). Alla församlingar var separerade med en agaros SEC kolumn. Y-axeln betecknar OD i mAU. Kromatogram är representativa för minst 2 oberoende sammansättningar av varje intasome. Slutet märkning minskar avkastningen av PFV intasomes med Cy5 10-faldigt och biotin 1.8-fold. Slutet Cy5 och biotin församlingar har märkbart mer fällningen återstår efter hög salt resolubilization (steg 3.5), vilket resulterar i uppenbar förlust av material på uteslutning i kolumnen storlek. Intern märkning av vDNA med Cy5 fluorophore leder till en lika avkastning på intasomes som omärkta vDNA. Klicka här för att se en större version av denna siffra.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Retrovirala INs bildar ett multimeric komplex med viral genomiskt DNA att utföra integrering och fortsätta viral livscykel. Antalet i monomerer per intasome kan vara tetramers, octamers eller eventuellt högre ordning multimers11,12,13,14. PFV intasomes är en tetramer av rekombinant in med dubbelsträngat DNA oligomerer som efterliknar viral genomiskt DNA slutar3. Dessa intasomes har använts i strukturella och dynamiska studier3,5,13,14.

Montering av PFV intasomes inträffar under dialys från en relativt hög saltkoncentration buffert till en lägre salthalt. Detta resulterar i bildandet av en fällning som inkluderar den PFV intasomes. Intasomes är solubilized genom att öka saltkoncentrationen. PFV i har visat sig vara monomer vid koncentrationer upp till 225 µM5. Komplexen är sedan isolerade från monomer i och gratis vDNA av SEC. Vi har ändrat rening av PFV intasomes att inkludera glycerol i SEC buffert6. Tillsats av glycerol tillåter det PFV intasomes att frysas för framtida användning utan förlust av aktivitet (figur 4).

I området i närheten finns det flera viktiga funktioner i detta protokoll. Även om protein rening sker ofta vid låga temperaturer, har vi funnit empiriskt att PFV intasome församling är ineffektiv vid 4 ˚C. Istället bör församlingen dialysen uppstå i intervallet 18-22 ˚C. Det är också viktigt att använda rekombinant PFV i som är fri av kontaminerande bakteriell nuclease7,8. Slutligen, förhållandet av i vDNA är en nyckelfaktor för församlingen. Om start i proteinkoncentration är lägre än rekommenderat här, måste vDNA koncentrationen minskas proportionellt. Det är möjligt att montera PFV intasomes vid lägre koncentrationer, måste komplexen vara på en hög tillräcklig koncentration för att upptäcka under SEC separation.

Denna metod kan användas för PFV intasomes med omärkta eller märkta vDNA. Vi har funnit att vDNA effektivt kan märkas med en fluorophore eller biotin6. Andra småmolekylära etiketter kan också vara möjligt. När det gäller Cy5 fluorophore finner vi därför märkt vDNA minskar avkastningen av sammansatta intasomes med maximal koncentration minskat 10-faldigt. Internt har Cy5 märkt vDNA dock en motsvarande avkastning till namnlösa vDNA. Denna montering metod kan också användas med punktmutationer eller trunkering mutationer av PFV IN4. Eftersom PFV i hämmas av kliniskt relevanta IN strand överföring hämmare (INSTI) droger inriktning HIV-1 IN, det är möjligt att använda dessa PFV intasomes för att studera mekanismen av INSTIs3. Dessutom förekomma vissa INSTI resistenta mutationer av HIV-1 IN på bevarade rester i PFV, möjliggör studier av läkemedelsresistens med bakåtkompilerade PFV intasomes.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Författarna har något att avslöja.

Acknowledgments

Detta arbete stöds av NIH AI099854 och AI126742 till nyckel.

Materials

Name Company Catalog Number Comments
DNA Oligomers IDT N/A Custom DNA Oligos
Tris Ultra Pure Gojira Fine Chemicals UTS1003
NaCl P212121 RP-S23020
UltraPure EDTA Invitrogen/Gibco 15575
Amicon Ultra 0.5 mL centrifugal filters Sigma-Aldrich Z677094-24EA 3 kDa MWCO
DTT P212121 SV-DTT
BIS-TRIS propane,>=99.0% (titration) Sigma-Aldrich B6755-500G
ZnCl2 Sigma-Aldrich 208086
MgSO4 Amresco 0662
Glycerol Thermo Fisher Scientific G37-20
Gel-loading tips, 1 - 200 μL Corning CLS4853-400EA
Razor blade; Single-edged; 100/Pk.; Pack of 100 Fisher Scientific 12-640
Sterile Disposable Filter Units with PES Membrane > 250mL Thermo Fisher Scientific 568-0020
Dialysis tubing clips Spectrum Labs 132734
6-8 kDa 10 mm Dialysis Tubing Spectrum Medical 132645
Superose 6 10/300 GL GE Healthcare Life Sciences 17517201
Hi-Res Standard Agarose AGTC Bioproducts AG500D1
Ethidium bromide Thermo Fisher Scientific BP1302
Orange G Fisher Scientific 0-267
Hyladder 10kb, 500 lanes Denville Scientific CB4225-4

DOWNLOAD MATERIALS LIST

References

  1. Coffin, J. M., Hughes, S. H., Varmus, H. E. Retroviruses. Cold Spring Harbor Laboratory Press. (1997).
  2. Valkov, E., et al. Functional and structural characterization of the integrase from the prototype foamy virus. Nucleic Acids Res. 37, (1), 243-255 (2009).
  3. Hare, S., Gupta, S. S., Valkov, E., Engelman, A., Cherepanov, P. Retroviral intasome assembly and inhibition of DNA strand transfer. Nature. 464, (7286), 232-236 (2010).
  4. Li, M., Lin, S., Craigie, R. Outer domains of integrase within retroviral intasomes are dispensible for catalysis of DNA integration. Protein Sci. 25, (2), 472-478 (2016).
  5. Gupta, K., et al. Solution conformations of prototype foamy virus integrase and its stable synaptic complex with U5 viral DNA. Structure. 20, (11), 1918-1928 (2012).
  6. Jones, N. D., et al. Retroviral intasomes search for a target DNA by 1D diffusion which rarely results in integration. Nat Commun. 7, 11409 (2016).
  7. Lopez, M. A., Mackler, R. M., Altman, M. P., Yoder, K. E. Detection and removal of nuclease contamination during purification of recombinant prototype foamy virus integrase. J Vis Exp. (2017).
  8. Lopez, M. A., Mackler, R. M., Yoder, K. E. Removal of nuclease contamination during purification of recombinant prototype foamy virus integrase. J Virol Methods. 235, 134-138 (2016).
  9. Poirier, M. G., Bussiek, M., Langowski, J., Widom, J. Spontaneous access to DNA target sites in folded chromatin fibers. J Mol Biol. 379, (4), 772-786 (2008).
  10. Lee, P. Y., Costumbrado, J., Hsu, C. Y., Kim, Y. H. Agarose gel electrophoresis for the separation of DNA fragments. J Vis Exp. (62), (2012).
  11. Ballandras-Colas, A., et al. Cryo-EM reveals a novel octameric integrase structure for betaretroviral intasome function. Nature. 530, (7590), 358-361 (2016).
  12. Ballandras-Colas, A., et al. A supramolecular assembly mediates lentiviral DNA integration. Science. 355, (6320), 93-95 (2017).
  13. Passos, D. O., et al. Cryo-EM structures and atomic model of the HIV-1 strand transfer complex intasome. Science. 355, (6320), 89-92 (2017).
  14. Yin, Z., et al. Crystal structure of the Rous sarcoma virus intasome. Nature. 530, (7590), 362-366 (2016).
  15. Maertens, G. N., Hare, S., Cherepanov, P. The mechanism of retroviral integration from X-ray structures of its key intermediates. Nature. 468, (7321), 326-329 (2010).
  16. Maskell, D. P., et al. Structural basis for retroviral integration into nucleosomes. Nature. 523, (7560), 366-369 (2015).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics