Gene-targeted Random Mutagenesis to Select Heterochromatin-destabilizing Proteasome Mutants in Fission Yeast


Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:



This article describes a detailed methodology for random mutagenesis of a target gene in fission yeast. As an example, we target rpt4+, which encodes a subunit of the 19S proteasome, and screen for mutations that destabilize heterochromatin.

Cite this Article

Copy Citation | Download Citations

Seo, H. D., Lee, D. Gene-targeted Random Mutagenesis to Select Heterochromatin-destabilizing Proteasome Mutants in Fission Yeast. J. Vis. Exp. (135), e57499, doi:10.3791/57499 (2018).


Random mutagenesis of a target gene is commonly used to identify mutations that yield the desired phenotype. Of the methods that may be used to achieve random mutagenesis, error-prone PCR is a convenient and efficient strategy for generating a diverse pool of mutants (i.e., a mutant library). Error-prone PCR is the method of choice when a researcher seeks to mutate a pre-defined region, such as the coding region of a gene while leaving other genomic regions unaffected. After the mutant library is amplified by error-prone PCR, it must be cloned into a suitable plasmid. The size of the library generated by error-prone PCR is constrained by the efficiency of the cloning step. However, in the fission yeast, Schizosaccharomyces pombe, the cloning step can be replaced by the use of a highly efficient one-step fusion PCR to generate constructs for transformation. Mutants of desired phenotypes may then be selected using appropriate reporters. Here, we describe this strategy in detail, taking as an example, a reporter inserted at centromeric heterochromatin.


Forward genetics is a classical method in which researchers seek naturally occurring mutants that display a particular phenotype, and perform genetic analyses. In reverse genetics, mutations are introduced into a gene of interest and the phenotype is examined. In the latter case, random mutagenesis of a target gene is often used to generate a pool of mutants that are subsequently selected for desired phenotypes, such as temperature sensitivity or altered enzymatic activity. Various methods may be used to achieve random mutagenesis, including error-prone PCR1; UV irradiation2; chemical mutagens, such as ethyl methanesulfonate (EMS) or nitrous acid3; the use of temporary mutator strains, such as those over-expressing mutD5 4; and DNA shuffling5.

Here, we describe a reverse-genetics strategy in which we utilize error-prone PCR to generate mutant pools for a target gene in the fission yeast. As one might guess from its name, this method generates mutations by deliberately introducing errors during PCR. Unlike other mutagenesis methods, error-prone PCR allows the user to define the region to be mutagenized. This makes it particularly useful in efforts to study the function of a protein/domain of interest.

To demonstrate this random mutagenesis procedure, we herein use rpt4+, which encodes the 19S proteasome subunit, as an example. Rpt4 has been shown to have proteolysis-independent functions in organisms other than fission yeast6,7,8,9, and a defect in proteolysis could cause indirect effects by altering proteins levels. We, therefore, screened for mutants that triggered proteolysis-independent changes, with the goal of investigating the function of the proteasome on heterochromatin.

Error-prone PCR can be applied to any gene region by tuning the location at which the primers bind. Mutants that exhibit the desired phenotypic change can be identified with appropriate reporters. Here, we utilized an ade6+ reporter inserted at the centromere 1 outer repeat (otr) region10. Constitutive heterochromatin is formed at this region11, so the ade6+ reporter is silenced in the wild-type condition; this is indicated by red colonies10. A mutation that destabilizes the constitutive heterochromatin at the centromere will lead to the expression of the ade6+ reporter, which is visualized as white colonies.

Subscription Required. Please recommend JoVE to your librarian.


1. Preparation of Media

  1. Prepare Yeast Extract with supplements (YES), YES without adenine (YES Low Ade), Pombe Glutamate medium (PMG12), and PMG without adenine (PMG-Ade) by mixing the components as described in Table 1. YES-Ade (Low Ade) and PMG-Ade plates have all of the same components, but the adenine is omitted from the latter.
    1. Use the following salt (50x) stock: 52.5 g/L MgCl2·6H2O, 2 g/L CaCl2·2H2O, 50 g/L KCl, 2 g/L Na2SO4 in distilled water. Filter sterilize using a 0.22-µm pore-size filter and store at 4 °C.
    2. Use the following vitamin (1,000x) stock: 1 g/L pantothenate, 10 g/L nicotinic acid, 10 g/L inositol, 10 mg/L biotin in distilled water. Filter sterilize using a 0.22-µm pore-size filter and store at 4 °C.
    3. Use the following mineral (10,000x) stock: 5 g/L boric acid, 4 g/L MnSO4, 4 g/L ZnSO4·7H2O, 2 g/L FeCl2·4H2O, 0.4 g/L MoO3, 1 g/L KI, 0.4 g/L CuSO4·5H2O, 10 g/L citric acid in distilled water. Filter sterilize using a 0.22-µm pore-size filter and store at 4 °C.
      NOTE: YES liquid medium can be made by omitting the agar.
  2. Autoclave the medium and cool it to below 60 °C while stirring with a stir bar, at the rate of 200 rpm.
  3. For YES+G418 (geneticin) plates, add 1 mL/L G418 stock solution to the YES medium.
    1. Use the following G418 (1,000x) stock: 100 mg/mL G418 in distilled water. Filter sterilize using a 0.22-µm pore-size filter, aliquot to 1.5 mL centrifuge tubes, and store at -20 °C.
  4. Stir for another 5 - 10 min and aliquot the media into 90-mm Petri dishes (1 L of medium aliquots to roughly 40 Petri dishes. Store the plates at 4 °C.

2. Cloning of rpt4+ and its 5'/3' UTRs

  1. Perform PCR with primers p1 and p2 (Figure 1A) using fission yeast genomic DNA (gDNA) as the template in a total volume of 50 µL (~1 µg DNA, 20 U enzyme, 1x reaction buffer), and applying the reaction cycles described in Table 2 to amplify a 3,315-base pair (bp) fragment comprising rpt4+ and its 5'/3' UTRs. Purify the PCR product using a purification kit13 as directed by the manufacturer (Figure 1A).
  2. Digest the pBlueScript KS(-) vector14 and the amplified DNA fragment containing rpt4+ with its 5'/3' UTRs with BamH1 and Xho1 in a total volume of 20 µL (~1 µg DNA, 20 U enzyme, 1x digestion buffer) at 37 °C in a water bath for 16 - 18 h (Figure 1B).
  3. Gel purify the digested vector (1.2% agarose gel) and DNA insert by performing TAE-based agarose gel electrophoresis (100 V, 1 h), excising the DNA bands of the desired sizes, and isolating the DNA with a gel extraction kit15.
  4. Ligate the vector and DNA insert using T4 DNA ligase by performing a 20-µL ligation reaction containing 50 - 100 ng of the vector DNA, a ~3-fold molar excess of the insert DNA, 400 U T4 DNA ligase, and 1x ligation buffer. Incubate this mixture at 18 °C for 16 - 18 h.
  5. Transform the ligated DNA into 100 µL of E. coli DH5α by applying heat shock for 70 s at 42 °C. Add 1 mL of LB and incubate for 1 h at 37 °C for recovery. Perform centrifugation (13,800 x g), discard the supernatant, plate all of the transformed E. coli cells on LB-Ampicillin (LA) plates, and incubate at 37 °C for 16 h.
  6. Pick 4 - 8 colonies with toothpicks and grow overnight at 37 °C in 3 mL LA medium.
  7. Isolate the plasmids with a plasmid purification kit16 used according to the manufacturer's protocol and perform analytical restriction enzyme digestions with 5 µL of the isolated plasmid, 5 U of each restriction enzyme (BamH1 and Xho1) and 1x restriction buffer. Incubate the reaction mixture at 37 °C in a water bath for 3 h. Confirm the cloning by sequencing candidate plasmids.

3. Introduction of the Silent Mutation (Xho1 Restriction Site)

  1. Design a pair of 33-bp primers (p3 and p4) that contain the desired mutation in the otherwise complementary sequence.
  2. Perform PCR with high-fidelity polymerase17 (Figure 1C) in a total volume of 25 µL (10 ng of cloned plasmid, 2 µL of 10 pmol primer mix, 2 U enzyme, 1x reaction buffer) using the cycling parameters listed in Table 3.
  3. Digest the template plasmid with DpnI in a total volume of 20 µL (20 U enzyme, 1x digestion buffer) at 37 °C in a water bath for 1 h.
  4. Transform, propagate, isolate, and sequence the plasmid containing the silent mutation, as described in steps 2.5 - 2.7.
    Note: The silent mutation can also be introduced using a cloning method which allows for the joining of multiple DNA fragments in a single reaction18.

4. Random Mutagenesis of rpt4+ by Error-prone PCR

  1. Perform error-prone PCR, using the plasmid with the silent mutation (Xho1 site) as the template, primers p5 and p6, a total volume of 50 µL (the amount of template defined in step 4.1.1, 2 µL of 10 pmol primer mix, 2.5 U enzyme, 1x reaction buffer), and a special polymerase that is designed to generate a high error rate19 (Figure 1D). Perform PCR as described in Table 2.
    1. Use 4 - 5 µg of template plasmid to control the mutation frequency to 1 bp/kb (kilobase).
      Note: A high-concentration (>500 ng/µL) of plasmid, which may be obtained using a Mini-prep kit20, is required.
  2. Use gel electrophoresis to confirm a PCR product of 2670 bp (1.2% agarose gel). Gel purify this PCR product as described in step 2.5.

5. Preparation of Fusion PCR Fragments (KAN, 3'UTR)

  1. Perform PCR using pFA6a-KANMX621 as the template, primers p7 and p8, and the conditions listed in Table 4 to obtain the marker (KAN) fragment. Gel purify the resulting 1,480-bp fragment as described in step 2.5 (Figure 1E).
    1. Check if the stop codon of the gene targeted for mutation and the coding region of its adjacent gene are separated by more than 500 bp. The endogenous terminator may not be used when this region is less than 500 bp; rather, the ADH terminator should be used instead of the endogenous terminator. The protocol changes required to use the ADH terminator are presented in Table 5.
      Note: These changes only apply when the ADH terminator, which is available in the pFA6a-3HA-KANMX6 plasmid, is used instead of the endogenous terminator.
  2. Perform PCR with the cloned rpt4+-containing vector as the template and primers p9 and p10 in a total volume of 50 µL (20 ng of the cloned plasmid, 2 µL of 10 pmol primer mix, 2 U enzyme, 1x reaction buffer), using the conditions presented in Table 6. Gel purify the obtained 506-bp 3'UTR fragment (Figure 1E).

6. Generation of the Transformation Construct by Fusion PCR (Figure 1E)

  1. Prepare the 3 fragments (mutagenized rpt4+, KAN, and the 3'UTR) at 50 ng/µL.
  2. Perform fusion PCR of the three fragments using primers p11 and p12, as described in Table 7. (The protocol for fusion PCR is a modification of the original protocol22.) Purify the major 4,398-bp PCR product.
    1. Use rpt4+:KAN:3'UTR fragments at a ratio of 1:3:1 for optimal results.
      Note: The total amount of the insert DNA should not exceed 500 ng. The recommended amount of rpt4+:KAN:3'UTR is 50 ng:150 ng:50 ng. The mutagenized region is approximately 1.6 kb, so the minimum number of yeast colonies that would account for all possible combinations of each base being mutated to the other three is 1,600 x 3 = 4,800 colonies. Because one transformation reaction typically yields 400 - 500 colonies, at least 10 reactions worth of fusion PCR construct is needed. This need can be met by simply increasing the reaction amount (i.e., the number of PCR tubes) by a factor of ten.

7. Transformation of Fission Yeast by Electroporation (Figure 1F)

  1. Inoculate yeast to 10 mL of YES medium to saturation by incubating it for more than 16 h.
  2. Dilute the cells to an optical density at 600 nm (OD600) of 0.2 in 200 mL of YES medium and incubate at 30 °C with shaking for 5 - 6 h, to OD600 = 0.6 - 0.8.
  3. Concentrate cells to OD600 = 30, dispense to four 50-mL conical tubes and chill on ice for 10 min.
  4. Harvest the cells by performing centrifugation at 1,050 x g for 3 min at 4 °C. Place the tubes and 10 electro-cuvettes on ice. Perform the steps 7.3 - 7.8 on ice.
  5. Discard the supernatant and add 15 mL of 1.2 M sorbitol. Gently shake the tubes to resuspend the cells.
  6. Centrifuge the cells at 1050 x g for 3 min at 4 °C.
  7. Repeat steps 7.4 and 7.5. Discard the supernatant. Add 500 µL of 1.2 M sorbitol to each tube, resuspend the cells, and collect all of the cells in one 15-ml conical tube.
  8. Add 1.2 M sorbitol up to 2.4 mL (OD600 = 10 per 0.2 mL). Keep the tube on ice.
  9. Add 200 µL of sorbitol-suspended cells (make sure they are fully suspended) to an EP tube containing the fusion PCR construct, mix well, and transfer the sample to an electro-cuvette.
  10. Electroporate the cells with the following options: Fungi, ShS (2.00kV, 1 pulse).
  11. Add 600 µL of 1.2 M sorbitol to each electro-cuvette for a total volume of 800 µL, and then spread the cells on four YES plates (200 µL/plate). Ten electro-cuvettes will dispense to 40 YES plates.
  12. Incubate the plates at 30 °C for 24 h.
  13. Perform replica plating to YES+G418 and incubate the plates at 30 °C for 3 days.

8. Selection of Heterochromatin-destabilizing Mutants and Checking for False Positives

  1. For each YES+G418 plate, perform replica plating to YES-Ade (Low Ade) and PMG-Ade (No Ade) plates. Incubate the replica plates for 1 - 2 days at 30 °C, until some of the colonies on the YES-Ade plates show a red coloration (Figure 1G).
  2. Compare YES-Ade and PMG-Ade plates and select cells that show pink or white on the YES-Ade plate and also grow on the PMG-Ade plate. Do not select colonies without growth on PMG-Ade, as they are false positives (e.g., reflecting that the KAN cassette has been integrated at a non-target site elsewhere in the genome).
  3. Pick approximately 1 x 105 cells from each colony and incubate in 10 µL of SPZ solution containing 2.5 mg/mL zymolyase 100 T at 37 °C for at least 30 min. Use 1 µL of this solution to perform as the starting template for colony PCR (Figure 1H).
    1. Make SPZ (50 mL) by mixing 30 mL of 2 M sorbitol, 4.05 mL of 1 M Na2HPO4, 0.95 mL NaH2PO4 and 15 mL of distilled water (final pH, 7.5). Samples (5 mL) can be supplemented with zymolyase and stored in 500-µL aliquots at -20 °C until use.
  4. Perform gel electrophoresis (1.2% agarose gel, 180V, 20 min) to visualize the results of +the colony PCR. Select reactions that exhibit PCR bands of the proper size and digest 5 µL of each reaction product with XhoI (4 U enzyme, 1x digestion buffer, 37 °C water bath, 1 h) to screen out false positives (Figure 1H).
  5. Perform gel electrophoresis to visualize the XhoI digests (1.2% Agarose gel, 180 V, 20 min). Mark the colonies whose PCR products are cut by XhoI, and patch them to YES+G418 plates (Figure 1I).
  6. Isolate gDNA from the fission yeast cells and perform sequencing of the PCR products23. Compare the obtained sequence with the wild-type sequence to identify mutations (Figure 1I).
  7. Directly re-introduce the mutation(s) to wild-type cells by transforming them with fusion constructs amplified by PCR from mutant cells23. Use spotting to confirm the phenotype in the newly made mutant cells (Figure 1J).
    1. Fusion transformation construct can be easily amplified by PCR with primers p1 and p10 using the genomic DNA of mutants as the template in a total volume of 50 µL (~1 µg DNA, 20 U enzyme, 1x reaction buffer), and applying the reaction cycles described in Table 2. Transformation of the construct can be done by following the steps 7.1 - 7.13.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

The acquired Rpt4 mutants by following the procedures described in Figure 1 can be analyzed by assessing the colors of the colonies. The colors of the colonies are spotted onto the relevant plates in decreasing cell number in Figure 2. The ade6+ reporter inserted at the heterochromatin region is silenced in wild-type and shows red colonies in YES-Ade plate. Once the heterochromatin is destabilized and the ade6+ reporter is expressed, white colonies can be observed in YES-Ade plate as in clr4Δ mutant. The screened Rpt4 mutants are as shown. rpt4-1 mutant shows the most severe heterochromatin destabilization.

Figure 1
Figure 1: Schematic representation of the protocol. (A) Schematic representation of the PCR product obtained by the first round of PCR, which is performed with primers 1 and 2. (B) Restriction-based cloning of the rpt4+ fragment. (C) Site-directed mutagenesis of the cloned vector is used to introduce a silent mutation that adds an XhoI restriction site. (D) Random mutagenesis of the rpt4+ coding region is performed using error-prone PCR. (E) The mutated rpt4+ fragment, the KAN fragment, and the 3'UTR fragment are joined by fusion PCR to generate a transformation-ready cassette. (F) Fission yeast cells are transformed with the fusion PCR construct, which replaces the endogenous rpt4+ sequence by homologous recombination. (G) KAN-selected colonies are replica plated to YES-Ade (Low Ade) and PMG-Ade (No Ade) plates, and positive colonies are selected. (H) PCR and subsequent XhoI restriction of the PCR product are used to avoid false positives. (I) The mutation that causes the phenotype is identified by patching of the selected colonies, propagation of cells, extraction of genomic DNA (gDNA), and sequencing of the relevant portion of rpt4+. (J) Causative mutations are confirmed (and false positives are ruled out) by directly introducing the mutation to wild-type cells. Please click here to view a larger version of this figure.

Figure 2
Figure 2: Heterochromatin de-repression mutants of Rpt4. Schematic diagram of the otr1::ade6+ reporter (top). 5-fold serial dilutions of select screened Rpt4 mutants were spotted onto the indicated plates in order of increasing level of heterochromatin destabilization (bottom). This figure was modified from the article 'The 19S proteasome is directly involved in the regulation of heterochromatin spreading in fission yeast' by Seo et al., 201724. The non-cropped figure can be found in the original article. Please click here to view a larger version of this figure.

Component Type of plate
Yeast extract 5 g/L
Glucose 30 g/L 20 g/L
Adenine 0.15 g/L 0.1g/L
Histidine 0.15 g/L 0.1g/L
Leucine 0.15 g/L 0.1g/L
Uracil 0.15 g/L 0.1g/L
Potassium hydrogen pthalate 3 g/L
Na2HPO4 2.2 g/L
L-glutamic acid 3.75 g/L
Salts 20 ml/L
Vitamins 1 ml/L
Minerals 0.1 ml/L
Agar 16 g/L 16 g/L

Table 1. Components of YES and PMG plates

Temperature Time Cycle(s)
95oC 2 min   1 cycle
95oC 20 s  30 cycles
55oC 30 s
72oC 2 min
72oC 8 min 1 cycle
8oC Hold

Table 2. Recommended PCR program for site-directed mutagenesis

Temperature Time Cycle(s)
95oC 2 min   1 cycle
95oC 30 s  19 cycles
55oC 1 min
72oC 7 min
72oC 10 min 1 cycle
8oC Hold

Table 3. Recommended PCR program for error-prone PCR

Temperature Time Cycle(s)
95oC 2 min   1 cycle
95oC 20 s  30 cycles
55oC 30 s
72oC 2 min
72oC 8 min 1 cycle
8oC Hold

Table 4. Recommended PCR program for obtaining the KAN fragment

Change To Example case of rpt4+
Template vector pFA6a-3HA-KANMX6
Vector-binding sequence of p7 ATTACGCTGCTCAGTGCTGA ttgctgacctgaagaaacttgaaggtacaattgattaccaaaagctttag ATTACGCTGCTCAGTGCTGA
Hanging sequence of p7 The last 50bp sequence including the stop codon
Hanging sequence of p8 The first 50bp sequence right after the stop codon (complementary sequence) AATCTTCATCGGTAAACTTATCATTTCATGGCTTTTTGGATATATGTGCA GAATTCGAGCTCGTTTAAAC
Sequence of p9 Start right after the stop codon tgcacatatatccaaaaagccatgaa
Sequence of p10 Produce ~500bp fragment with p9 (complementary seqeucne) TAGACGTTTTTCCTCGTTTCTTTGTC

Table 5. Changes needed when the ADH terminator is used instead of the endogenous terminator

Temperature Time Cycle(s)
95oC 2 min   1 cycle
95oC 20 s  30 cycles
55oC 30 s
72oC 1 min
72oC 8 min 1 cycle
8oC Hold

Table 6. Recommended PCR program for obtaining the 3'UTR fragment

Temperature Time Ramp Cycle(s)
94oC 2 min   1 cycle
94oC 20 s  10 cycles
70oC 1 s
55oC 30 s 0.1 oC/s
68oC 2:30 min 0.2 oC/s
94oC 20 s  5 cycles
70oC 1 s
55oC 30 s 0.1 oC/s
68oC 2:30 min 0.2 oC/s + 5 s/cycle
94oC 20 s  10 cycles
70oC 1 s
55oC 30 s 0.1 oC/s
68oC 2:30 min 0.2 oC/s + 20 s/cycle
72oC 10 min 1 cycle
8oC Hold

Table 7. Recommended PCR program for fusion PCR

CBL1877 h+ ade6-210 leu1-32 ura4-D18 otr1R (dg-glu) Sph1:ade6

Table S1: Strain used in this study

Table S2: List of primers used in this study

Subscription Required. Please recommend JoVE to your librarian.


Random mutagenesis via error-prone PCR is a powerful tool for generating a diverse pool of mutants in a given region. This technique is especially useful for studies that seek to assess the function of a protein under a specific circumstance. For example, we herein used error-prone PCR to assess the function of the 19S proteasome subunit, Rpt4, in heterochromatin maintenance. By varying the region targeted by the error-prone PCR and adjusting the screening conditions, we were able to mutate cells at the genomic region of interest and screen for the desired phenotype. Recently, a similar method was used to isolate fission yeast cells harboring mutations in the spindle pole body component25.

The key advantage of random mutagenesis is that it may be applied to both non-essential and essential genes. Random mutagenesis of essential genes may yield diverse mutants, such as those with subtle and/or partial functional defects that allow cell viability to be sustained, or mutants whose functions are affected only under a specific condition. An example of the latter is a temperature-sensitive mutant. Such mutants may be isolated using 5 mg/L phloxine B, which stains dying cells in red and enables slow-growing cells to be distinguished from dying cells26.

The critical step of this protocol is the error-prone PCR step. At this step, it is important to control the mutation frequency, which can vary widely depending on the number of PCR cycles and the initial amount of template. We recommend that the user fix the number of PCR cycles and vary the initial amount of template, as we found this to be a more convenient strategy for optimization. We note that the technique of error-prone PCR has been widely available for decades. If the user chooses, they may seek a method for manually performing error-prone PCR27 without using a commercially available mutagenesis kit.

As a caution, the false positive rate of this protocol is rather high. Thus, mutant candidates should undergo a series of screenings intended to weed out the false positives. We found that the silent incorporation of a restriction site in the target gene can help avoid the need to subject false positives to the relatively laborious step of sequencing. This is cost-effective, as the mutant candidates may number in the hundreds or even beyond.

Subscription Required. Please recommend JoVE to your librarian.


The authors have nothing to disclose.


Funding support for this project was provided by the Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Science and ICT (2016R1A2B2006354).


Name Company Catalog Number Comments
1. Media
Glucose Sigma-Aldrich G8270-10KG
Yeast extract BD Biosciences 212720
L-Leucine JUNSEI 87070-0310
Adenine sulfate ACR 16363-0250
Uracil  Sigma-Aldrich U0750
L-Histidine Sigma-Aldrich H8125
KH2PO4 Sigma-Aldrich 1.05108.0050
NaCl JUNSEI 19015-0350
MgSO4•7H2O Sigma-Aldrich 63140
CaCl2 Sigma-Aldrich 12095
Potassium phthalate Sigma-Aldrich P6758-500g
Inositol Sigma-Aldrich I7508-50G
Biotin Sigma-Aldrich B4501-100MG
Boric Acid Sigma-Aldrich B6768-1KG
MnSO4 Sigma-Aldrich M7634-500G
ZnSO4•7H2 JUNSEI 83060-031
FeCl2•4H2O KANTO CB8943686
Sodium molybdate dihydrate YAKURI 31621
KI JUNSEI 80090-0301
CuSO4•5H2O YAKURI 09605
D-myo-inositol MP biomedicals 102052
Pantothenate YAKURI 26003
Nicotinic Acid Sigma-Aldrich N4126-500G
(NH4)2SO4  Sigma-Aldrich A4418-100G
Agarose Biobasic D0012
G418, geneticin LPS G41805
2. Enzyme reactions
PfuUltra II Fusion HS DNA Polymerase Aglient 600380 For site-directed mutagenesis
GeneMorphII Random mutagenesis Kit Aglient 200500 For error-prone PCR
Phusion High-Fidelity DNA Polymerase Thermo Fisher F-530L For fusion PCR
Ex Taq DNA Polymerase Takara RR001b For general PCR
BamH1 New England BioLabs R0136S
Xho1 New England BioLabs R0146S
Dpn1 New England BioLabs R0176S
3. Equipment
Velveteen square, black VWR 89033-116 For replica
Replica-plating tool VWR 25395-380 For replica
MicroPulser Electroporator Biorad 1652100  For fission yeast transformation
Electroporation Cuvettes, 0.2 cm gap Biorad 1652086  For fission yeast transformation
Thermal Cycler Bioer BYQ6078 For fusion PCR ramp reaction 



  1. Pritchard, L., Corne, D., Kell, D., Rowland, J., Winson, M. A general model of error-prone PCR. J Theor Biol. 234, (4), 497-509 (2005).
  2. Pfeifer, G. P., You, Y. H., Besaratinia, A. Mutations induced by ultraviolet light. Mutat Res. 571, (1-2), 19-31 (2005).
  3. Moreno, S., Klar, A., Nurse, P. Molecular genetic analysis of fission yeast Schizosaccharomyces pombe. Methods Enzymol. 194, 795-823 (1991).
  4. Selifonova, O., Valle, F., Schellenberger, V. Rapid evolution of novel traits in microorganisms. Appl Environ Microbiol. 67, (8), 3645-3649 (2001).
  5. Cohen, J. How DNA shuffling works. Science. 293, (5528), 237 (2001).
  6. Sahu, P. P., Sharma, N., Puranik, S., Chakraborty, S., Prasad, M. Tomato 26S Proteasome subunit RPT4a regulates ToLCNDV transcription and activates hypersensitive response in tomato. Sci Rep. 6, 27078 (2016).
  7. Xu, Q., Singer, R. A., Johnston, G. C. Sug1 modulates yeast transcription activation by Cdc68. Mol Cell Biol. 15, (11), 6025-6035 (1995).
  8. Bhat, K. P., et al. The 19S proteasome ATPase Sug1 plays a critical role in regulating MHC class II transcription. Mol Immunol. 45, (8), 2214-2224 (2008).
  9. Chang, C., et al. The Gal4 activation domain binds Sug2 protein, a proteasome component, in vivo and in vitro. J Biol Chem. 276, (33), 30956-30963 (2001).
  10. Ekwall, K., Cranston, G., Allshire, R. C. Fission yeast mutants that alleviate transcriptional silencing in centromeric flanking repeats and disrupt chromosome segregation. Genetics. 153, (3), 1153-1169 (1999).
  11. Grewal, S. I., Jia, S. Heterochromatin revisited. Nat Rev Genet. 8, (1), 35-46 (2007).
  12. Forsburg, S. L. Forsburg Lab Recipes: Fission Yeast Media. (2011).
  13. QIAquick PCR Purification Kit. Qiagem. Venlo, Netherlands. Available from (2013).
  14. pBlueScript II Vector. Aglint. Santa Clara, CA. Available from (2005).
  15. QIAquick Gel Extraction Kit. Qiagen. Venlo, Netherlands. Available from (2013).
  16. QuickGene SP Kit Plasmid Kit II (SP-PL2). Wako Chemicals GmbH. Fuggerstra├če 12 41468 Neuss, Germany. Available from (2016).
  17. PfuUltra High-fidelity DNA Polymerase. Aglient. Santa Clara, CA. Available from (2004).
  18. Gibson Assembly Master Mix. New England Biolabs. Ipswich, MA. Available from (2017).
  19. GeneMorph II Random Mutagenesis Kits. Agilent. Santa Clara, CA. Available from (2012).
  20. Plasmid Plus Midi Kit. Qiagen. Venlo, Netherlands. Available from (1999).
  21. Bahler, J., et al. Heterologous modules for efficient and versatile PCR-based gene targeting in Schizosaccharomyces pombe. Yeast. 14, (10), 943-951 (1998).
  22. Szewczyk, E., et al. Fusion PCR and gene targeting in Aspergillus nidulans. Nat Protoc. 1, (6), 3111-3120 (2006).
  23. Nurse, P. Fission Yeast Handbook. (2000).
  24. Seo, H. D., et al. The 19S proteasome is directly involved in the regulation of heterochromatin spreading in fission yeast. J Biol Chem. (2017).
  25. Tang, N. H., et al. Generation and characterisation of temperature sensitive mutants of genes encoding the fission yeast spindle pole body. PeerJ Preprints. 5, e3377v3371 (2017).
  26. Rasooly, A., Weisz, A. In vitro antibacterial activities of phloxine B and other halogenated fluoresceins against methicillin-resistant Staphylococcus aureus. Antimicrob Agents Chemother. 46, (11), 3650-3653 (2002).
  27. Wilson, D. S., Keefe, A. D. Random mutagenesis by PCR. Curr Protoc Mol Biol. Chapter 8. Unit 8 (2001).



    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics