Génération du premier cœur comme champ progéniteurs cardiaques et Cardiomyocytes ventriculaires-comme des cellules souches pluripotentes humaines

* These authors contributed equally
Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Nous décrivons ici une méthode évolutive, en utilisant une combinaison simple d’activine A et induite par le lentivirus Id1-surexpression, pour générer des premiers progéniteurs cardiaques de coeur comme champ et cardiomyocytes ventriculaires-comme des cellules souches pluripotentes humaines.

Cite this Article

Copy Citation | Download Citations

Yu, M. S., Spiering, S., Colas, A. R. Generation of First Heart Field-like Cardiac Progenitors and Ventricular-like Cardiomyocytes from Human Pluripotent Stem Cells. J. Vis. Exp. (136), e57688, doi:10.3791/57688 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

La génération de grandes quantités de pluripotentes humaines fonctionnels dérivés de cellules souches cardiaques progéniteurs et les cardiomyocytes d’origine champ défini de coeur est une condition sine qua non pour la modélisation de la maladie et les thérapies cellulaires cardiaques. Nous avons récemment démontré que les gènes Id sont à la fois nécessaire et suffisante pour spécifier la premières progéniteurs de champ de cœur au cours du développement des vertébrés. Ce protocole de différenciation s’appuie sur ces constatations et utilise Id1 surexpression en combinaison avec l’activine A comme puissants repères indiquant pour produire des progéniteurs de (FHF-L) premiers cœur comme champ. Ce qui est important, résultant des progéniteurs différencient efficacement (~ 70 – 90 %) dans les cardiomyocytes ventriculaires ressemblant. Nous décrivons ici une méthode détaillée pour 1) générer Id1-surexprimant hPSCs et 2) se différencient des quantités évolutives des progéniteurs de FHF-L cryopreservable et des cardiomyocytes ventriculaires ressemblant.

Introduction

Production à grande échelle des cellules souches pluripotentes humaines (hPSCs)-dérivées de cellules souches cardiaques et les cardiomyocytes est une condition sine qua non pour les thérapies basées sur les cellules souches1, modélisation2,3 et la caractérisation rapide de la maladie nouvelles voies réglementant la différenciation cardiaque4,5,6 et physiologie7,8. Bien qu’un certain nombre d’études9,10,11,12,13,14,,,15 ont décrits précédemment très efficace protocoles de différenciation cardiaques de hPSCs, aucune a abordé l’origine domaine de cœur des cardiomyocytes qui en résulte, en dépit de l’identification des importantes différences moléculaires entre gauche (premier champ du coeur) et droite (second champ de coeur) cardiomyocytes ventriculaires16 et l’existence de maladies cardiaques congénitales par coeur domaine spécifique ; c'est-à-dire, hypoplasie du coeur gauche syndrome17 ou arythmogène dysplasie ventriculaire droite18. Ainsi, la génération des progéniteurs cardiaques et les cardiomyocytes d’origine champ défini de coeur de hPSCs devient une nécessité afin d’augmenter leur pertinence en tant que thérapeutique et outils de modélisation de la maladie.

Ce protocole repose sur la surexpression constitutive ID1, récemment identifié5 premier cœur en spécifiant le champ repère qui, en combinaison avec l’activine A, est nécessaire et suffisante pour initier cardiogenesis dans hPSCs. Notamment, Cunningham et al. (2017) 5 démontrent que les progéniteurs induite par l’Id1 spécifiquement premier champ de cœur (HCN4, TBX5) mais pas second marqueurs de champ de cœur (SIX2, ISL1) car ils subissent une différenciation cardiaque. En outre, les auteurs montrent également que des embryons de souris transgéniques dépourvus de toute la famille de gènes (Id1-4), de Id développe sans former premier cœur champ cardiaque progéniteurs, en plus des progéniteurs cardiaques médial et postérieur ( deuxième champ de cœur) peut encore former, ce qui laisse croire que les protéines Id sont essentiels d’initier une première heart champ cardiogenesis in vivo. Idéalement, les progéniteurs induite par l’Id1 peut être cryoconservés et spontanément se différencient en cardiomyocytes ventriculaires-comme caractéristiques, notamment de l’expression des marqueurs spécifiques ventriculaire (IRX4, MYL2) et potentiels d’action ventriculaire-like.

Nous décrivons ici une méthode simple et évolutive pour générer des premier cœur comme champ (FHF-L) cardiaques progéniteurs et cardiomyocytes ventriculaires ressemblant de Id1 sur-exprimant hPSCs. Une caractéristique importante de ce protocole est la possibilité de découpler la génération de progéniteurs cardiaques du cardiomyocyte ultérieures de production utilisant une étape pratique de cryoconservation. En résumé, ce protocole détaille les étapes nécessaires pour (1) générer Id1-surexprimant hPSCs, (2) générer des cellules souches cardiaques FHF-L de hPSCs, (3) cryoconservé progéniteurs qui en résulte et (4) reprendre la différenciation des progéniteurs cardiaques FHF-L et générer hautement enrichi (> 70 – 90 %) battant cardiomyocytes ventriculaires-like.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. infection et préparation de Virus Id1

  1. Générer des lentivirus sur-exprimant Id1 par transfection co pCMVDR8.74, pMD2.G et pCDH-EF1-Id1-PGK-PuroR (Addgene : plasmide #107735) dans les cellules HEK293T. Recueillir des particules virales, filtrer, purifier du surnageant et stocker à-80 ° C comme Kitamura et al. (2003) 19. vous pouvez également produire Id1 lentivirus commercialement en envoyant pCDH-EF1-Id1-PGK-PuroR à un fournisseur produisant des lentivirus.
    ATTENTION : Veuillez suivre les consignes des gènes et des protocoles de fonctionnement standard.
    Note : IMPORTANT : titre virus optimale doit être au moins 108 à 109 Transducing unités/mL (TU/mL).
  2. Avant l’infection, enduire un puits d’une plaque 96 puits 50 µl de réactif de revêtement, généralement un mélange de protéines gélatineuse sécrété par les cellules de sarcome de souris Engelbreth-Holm-Swarm (voir Table des matières).
  3. Dissocier un puits de cultivé dans une plaque 6 puits en ajoutant 1 mL de PBS avec 0,5 mM EDTA et sans Ca2 + et Mg2 + des cellules souches pluripotentes.
    NOTE : Le temps de Dissociation varie de 3 à 10 min. Lorsque plus de 80 % des cellules sont détachés du fond de la plaque, passez à l’étape suivante.
  4. Recueillir la suspension cellulaire avec pipette stérile dans tube à centrifuger en plastique 15 mL.
  5. Neutraliser le réactif de dissociation avec 5 mL de PBS contenant Ca2 + et Mg2 +.
  6. Pellet cellules par centrifugation (200 g x 3 min).
  7. Éliminer le surnageant et effleurer doucement le tube afin de déloger le culot.
  8. Remettre en suspension les cellules dans 1 mL de cellules souches médias.
  9. Compter les cellules à l’aide d’un compteur de cellules automatisés suivant les instructions du vendeur.
  10. Cellules viables plaque 20 000 / enduit bien (plaque à 96 puits) dans 50 µL de cellules souches milieux supplémentés avec inhibiteur de voie 2 µM RHO/ROCK (voir tableaux 1 et 2).
  11. Après 24h, surveiller pour la fixation des cellules et de remplacer le support avec 100 µl cellules souches médias additionnés de 2 inhibiteur de voie de RHO/ROCK µM et le bromure de hexadimethrine 6 ng/mL (voir tableaux 1 et 2), 1 heure avant l’infection des gènes.
    Remarque : Les cellules doivent être fermement fixés au fond de la plaque.
  12. Décongeler l’Id1-lentivirus sur la glace.
  13. Ajouter 3 µL de lentivirus purifiée par puits (titre de virus doit être comprise entre 108 à 109 TU/mL), puis transférer la plaque arrière d’incubateur de culture cellulaire (37 ° C, 5 % de CO2, 20 % O2).
  14. infection virale après 24 h, ajouter 100 µL de milieux frais souches cellulaires dans les cellules infectées.
  15. infection après des gènes de 48 h, remplacer les virus contenant les médias avec 200 µL de cellules fraîches de souches milieux supplémentés avec 1 puromycine µg/mL.
  16. Actualiser les médias tous les jours avec 200 µL de cellules souches milieux supplémentés avec 1 puromycine µg/mL.
  17. Quand les cultures atteignent 80 % confluence, dissocier les cellules à l’aide de 200 µL de PBS sans Ca2 + et Mg2 + + 0,5 mM EDTA (pour un puits d’une plaque de 96 puits).
  18. Recueillir suspension de cellules dans un tube à centrifuger.
  19. Neutraliser le réactif de dissociation avec 5 mL de PBS contenant Ca2 + et Mg2 +.
  20. Pellet cellules par centrifugation (200 g x 3 min).
  21. Éliminer le surnageant et effleurer doucement le tube afin de déloger le culot.
  22. Remettre en suspension les cellules dans 1 mL de cellules souches milieux supplémentés avec inhibiteur de voie 2 µM RHO/ROCK.
  23. Toutes les cellules (1 mL) de transfert à un enduit bien d’une plaque de 12 puits.
  24. Après 24h, moniteur pour la fixation des cellules aux médias puits et remplacer avec 1 mL de cellules souches médias additionné d’inhibiteur de voie de RHO/ROCK 2 µM et bromure de hexadimethrine de 6 ng/mL, 1 heure avant la transduction.
  25. Décongeler l’Id1-lentivirus sur la glace.
  26. Ajouter 5 µL de virus purifié par puits (plaque de 12 puits).
  27. infection après des gènes de 24h, remplacer les virus contenant les médias avec 1 mL de frais cellules souches milieux supplémentés avec 3 puromycine µg/mL.
  28. 48 h après l’infection des gènes, remplacer le virus contenant des médias avec 1 mL de cellules fraîches de souches milieux supplémentés avec 6 puromycine µg/mL.
  29. Quand les cultures atteignent 80 % confluence, dissocier les cellules à l’aide de 500 µL de PBS avec 0,5 mM EDTA et sans Ca2 + et Mg2 + (pour un puits d’une plaque de 12 puits).
  30. Transférer la moitié (250 µL) de la suspension cellulaire à un puits d’un réactif de revêtement enduit plaque 6 puits contenant 2 mL de cellules souches milieux supplémentés avec inhibiteur de voie 2 µM RHO/ROCK.
  31. Utiliser l’autre moitié (250 µL) de l’échantillon pour l’extraction de l’ARN et qRT-PCR afin de déterminer l’Id1 LENTIVIRAUX médiée par les niveaux d’expression, comme Colas et al. (2012) 4.
    NOTE : IMPORTANT : si Id1 ARNm expression est inférieures à 0,005 pli GAPDH des niveaux d’expression (voir tableau 3 pour amorces qRT-PCR), répétez les processus d’infection comme décrit ci-dessus jusqu'à ce que les niveaux d’expression Id1 dépassent la seuil.

2. hPSCs entretienId1

  1. Culture hPSCsId1 dans enduit 6-plats et croître dans 3 mL par puits de cellules souches milieux supplémentés avec 6 puromycine µg/mL.
  2. Quand hPSCsId1 atteignent 80 % confluence, les cellules comme agrégats (rapport de 1:6 split) utilisant le réactif de dissociation sans enzymes suivant directives du vendeur de passage et croître dans 3 mL par puits de cellules souches milieux supplémentés avec 6 puromycine µg/mL.

3. préparation des hPSCsId1 de différenciation

  1. Recouvrir une plaque de 12 puits avec 500 µL / puits de réactif de revêtement.
  2. Lorsque hPSCsId1 atteignent 90 % confluence dissocient les cellules en ajoutant 1 mL de PBS avec 0,5 mM EDTA / puits et sans Ca2 + et Mg2 + pour 5 à 10 min. vérifier le processus de dissociation chaque minute, et une fois les 80 % des cellules sont dissociées de la plaque , passez à l’étape suivante.
  3. Recueillir suspension de cellules dans un tube à centrifuger.
  4. Neutraliser le réactif de dissociation avec 5 mL de PBS contenant Ca2 + et Mg2 +.
  5. Pellet cellules par centrifugation (200 g x 3 min).
  6. Éliminer le surnageant et effleurer doucement le tube afin de déloger le culot.
  7. Remettre en suspension les cellules dans 2 mL de cellules souches milieux supplémentés avec inhibiteur de voie 2 µM RHO/ROCK.
  8. Compter les cellules à l’aide d’un compteur de cellules automatisées.
  9. Cellules de plaque 300 000 / puits dans 1 mL de cellules souches milieux supplémentés avec inhibiteur de voie 2 µM RHO/ROCK et 6 µg/mL puromycine et plaque de transfert dans l’incubateur de culture de tissus.
  10. Actualiser les médias tous les jours avec 2 mL de cellules souches milieux supplémentés avec 6 puromycine µg/mL cultures jusqu'à confluence de 90 %. Ouvrir à ce stade, la différenciation cardiaque (étape suivante).

4. différenciation des hPSCsId1 en premier coeur comme champ progéniteurs cardiaques (FHF-L CPs)

  1. Pour le format de la plaque de 12 puits, initier la différenciation (jour 0) en remplaçant les cellules souches médias avec 1,5 mL de médias d’induction (tableau 1) additionné l’activine A (100 ng/mL) (voir tableau 2 pour les volumes et l’activine A les concentrations recommandées pour plaque de différents formats).
  2. Jour 1 (24 h après que la différenciation est lancée), remplacer les médias avec 2 mL de médias d’induction sans activine A (/ puits d’une plaque de 12 puits).
  3. Le jour 3, remplacer les médias avec 2 mL de médias d’induction sans activine A (/ puits d’une plaque de 12 puits).
  4. Le jour 5, recueillir FHF-L CPs pour la cryoconservation (étape suivante).
    NOTE : IMPORTANT : Cryopreservation est préférable à ce stade, car elle permet de découpler la génération de progéniteurs cardiaques de myocytes cardiaques subséquentes production et biobanque importants lots de cellules. Notez que vous pouvez également jour 5 CPs FHF-L peut être passé à une plaque fraîchement enduite à la différenciation de continuer, s’il vous plaît se référer aux étapes 5.1 – 5,5 à passFHF-L CPs et passez à l’étape 6.5 de différenciation.

5. cryoconservation du CPs FHF-L

  1. Aspirez tous les médias de puits contenant des J5 FHF-L CPs et rapidement ajouter 1 mL de tiède (37 ° C) 1 x réactif de dissociation enzymatique contenant (voir Table des matières). Placer la plaque dans l’incubateur de culture de tissus.
  2. Après 1 min, secouer la plaque côté à l’autre dans l’incubateur.
  3. Après 2 min (temps total), retirer la plaque de l’incubateur et ajouter 1 mL de médias FBS de 10 %.
  4. Doucement pipette cellules de haut en bas avec une pipette de 5 mL pour faciliter le détachement des cellules de la plaque.
  5. Recueillir la suspension cellulaire à une centrifugeuse tube granules des cellules et par centrifugation à 200 x g pendant 3 min
  6. Resuspendre le culot dans 2 mL de réactif de cryoconservation.
  7. Compter les cellules à l’aide d’un compteur de cellules automatisées.
  8. Ajouter le réactif de cryoconservation (voir Table des matières) à un volume suffisant de cryopréserver des cellules à la concentration désirée (en général 5 à 10 x 106 cellules/mL).
  9. Cellules de transfert pour les flacons de cryoconservation et placer les flacons dans ventilation tangentielle (1 ° C/min) et placer le dispositif de refroidissement dans le congélateur-80 ° C du jour au lendemain.
  10. Après 24h, transfert des flacons congelés à l’azote liquide pour le stockage à long terme.
    Remarque : Le protocole peut être suspendu ici.

6. FHF-L CP différenciation dans les Cardiomyocytes ventriculaires-like

  1. Transfert flacons FHF-L CPs congelés J5 de stockage d’azote liquide dans le récipient de glace sèche.
  2. Placer les flacons dans le bain-marie à 37 ° C pendant 2 à 3 min, jusqu'à ce que la suspension cellulaire est complètement décongelée.
    NOTE : IMPORTANT : la décongélation est sensible au temps. Exposer les médias de la cryoconservation des cellules pour une quantité excessive de temps (c.-à-d., 10 min) diminue la viabilité des cellules.
  3. Cellules de transfert de 15 ou 50 mL tube à centrifuger, selon le nombre de flacons décongelés.
  4. Verser goutte à goutte (5 gouttes toutes les 30 secondes) cardiogénique préchauffé (37 ° C) médias (tableau 1) à la solution de la cellule. Continuez ce processus jusqu'à ce qu’un média de cryoconservation de 1:3 : ratio de médias cardiogénique est atteint. À ce stade, augmenter le taux d’addition de médias cardiogénique jusqu'à un 01:10 médias de cryoconservation : ratio de médias cardiogénique est atteint.
    NOTE : IMPORTANT : les changements rapides d’osmolarité augmentera la mort cellulaire durant la décongélation ; Ajouter goutte à goutte cardiogénique médias tel que décrit ci-dessus est donc fortement recommandé.
  5. Centrifuger suspension et pellet cellules par centrifugation (200 g x 3 min).
  6. Éliminer le surnageant et effleurer doucement tube à centrifuger pour déloger le culot cellulaire.
  7. Remettre en suspension les cellules avec cardiogénique milieux supplémentés avec inhibiteur de voie 2 µM RHO/ROCK.
    Remarque : La viabilité cellulaire peut varier de dégel de dégel et, en général, > 65 % viabilité prédit placage bonne efficacité.
  8. Diluer concentrée suspension cellulaire avec cardiogénique milieux supplémentés avec 2 inhibiteur de la voie µM RHO/ROCK pour obtenir la concentration de la cellule souhaitée pour le placage (voir le tableau 2 pour les formats de plaque différente).
    NOTE : IMPORTANT : Notez que l’efficacité de différenciation cardiaques peut refuser si les cellules sont ensemencées trop faiblement.
  9. Cellules de semence sur la plaque.
  10. Maintenir la plaque dans la hotte de vitroplants pendant 20 min avant de transférer à l’incubateur de culture de tissus.
  11. Jour 6 de différenciation, contrôler la fixation des cellules.
    Remarque : Les progéniteurs cardiaques sont cryoconservés jour 5 de la différenciation. 24h après décongélation des cellules serait le jour 6 de la différenciation.
    Remarque : La présence de flottants (mortes) est fréquente.
  12. Jour 7, aspirer 50 % des médias et remplacer par une quantité égale de supports cardiogénique neufs.
    Remarque : L’ajout de l’inhibiteur voie RHO/ROCK aux médias cardiogénique n’est pas nécessaire après ce point.
  13. Remplacez 50 % des médias par cardiogénique médias tous les deux jours.
  14. Remarque spontanée battant qui apparaît entre 11 et 13 de jour.
  15. Le 15e jour, quantifier l’efficacité cardiaque différenciation par immunofluorescence à l’aide de DAPI (tache de noyau) et ACTC1 (pan-cardiaque marqueur).

7. transfert et Maintenance des Cardiomyocytes ventriculaires-like

Remarque : Par jour 14 – 16, une monocouche de contracter spontanément des cardiomyocytes ventriculaires semblable devrait être obtenue. À ce stade, il est suggéré de se dissocier et re-plaque de cardiomyocytes afin d’homogénéiser la culture et empêcher les cellules de détacher de la plaque.

  1. Aspirer tous les médias de puits et rapidement ajouter 1 mL de pré chauffé (37 ° C) 1 x enzyme contenant des réactifs de dissociation.
    Remarque : 1 x volumes de réactifs contenant des enzymes dissociation varient en fonction du format de la plaque, mais doit couvrir complètement le fond de la surface du bien.
  2. Plaque de transfert dans un incubateur de culture de tissus.
  3. Secouer doucement plaque côté à l’autre toutes les 2 min à l’intérieur de l’incubateur pour accélérer le processus de détachement.
  4. Après 5 à 15 min, lorsque 80 à 100 % des cellules sont détachés du fond de la plaque, retirez la plaque de l’incubateur et inhiber 1 x activité de réactif de dissociation enzymatique contenant en ajoutant un volume égal de médias FBS de 10 %.
    NOTE : Temps d’Incubation avec dissociation d’enzyme contenant x 1 pour ce processus changeront de lot à lot.
  5. Recueillir des suspension de cellules dans un tube à centrifuger.
  6. Suspension cellulaire se mêlent pipette et nombre de cellules à l’aide d’un compteur de cellules automatisées.
  7. Diluer la suspension cellulaire à concentration cellulaire désiré (voir tableau 2 pour les formats de plaque différente) avec les médias de maintenance complétée avec inhibiteur de voie 2 µM RHO/ROCK.
  8. Après l’ensemencement des cardiomyocytes dans l’assiette, répartir les cellules et permettre les cellules attacher pendant 10 à 20 min avant de transférer la plaque à l’incubateur de culture de tissus.
  9. 24h après modification des plaques, surveiller la récupération et fixation des cellules.
    Remarque : La présence de flottants (mortes) est fréquente. 48 à 72 h après modification des plaques, cardiomyocyte devrait reprendre la contraction spontanée.
  10. Afin de maintenir la culture cardiomyocyte, remplacez 50 % des médias avec les médias d’entretien tous les deux jours jusqu'à l’utilisation des cardiomyocytes ventriculaires-comme pour les expériences ultérieures.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Génération de hPSCs ID1 lignes
hPSCs sont infectés par un lentivirus médiation surexpression Id1 (Figure 1A). Une fois que hPSCId1 sont générés, expression du transgène est quantifiée par qRT-PCR (Figure 1B). HPSC uniquement les lignes deId1 exprimant Id1 ARNm à des concentrations supérieures à 0,005 pli de celle de GAPDH doivent être utilisés pour la différenciation.

hPSCs ID1 Entretien et préparation pour D ifferentiation
Conditions de culture optimales sont nécessaires et essentiels pour une première réussie coeur la différenciation des progéniteurs cardiaques comme champ (Figure 2A). hPSCId1 cultures doivent être surveillées tous les jours pour l’entretien de morphologie de tige et de la prolifération continue. La différenciation doit être instaurée lorsque les colonies serrées des cellules souches atteignent > confluence de 90 % (Figure 2B). Si la différenciation est engagée avant la confluence optimale, la mort cellulaire est renforcée et efficacité de différenciation peut refuser (Figure 2C). De même, les cultures envahies interprétera mal (Figure 2D).

Génération du premier coeur cardiaque comme champ progéniteurs (CPs FHF-L) de hPSCs ID1
Jour 1 (initiation de différenciation 24h post), les cellules doivent être surveillés afin d’observer la perte de la morphologie de souches (cellules apparaissent plus plat et plus sombre que les cellules souches). Notez que la mort cellulaire est fréquente au cours de la première journée de la différenciation, mais confluence cellulaire devrait être maintenu à > 75 % (Figure 2E). Si après 24h de différenciation, 50 % ou plus de la surface couverte sont perdue, les cellules doivent être jetés.

Le jour 3, différenciation des cellules devraient rester en cluster et permettent de combler les lacunes créées durant les première 24 h période (Figure 2F). Piles plates de plus en plus indépendamment sont révélateurs des conditions sous-optimales de différenciation.

Jour 4, différentiation optimale devrait montrer une expansion continue et la couverture de la plaque.

Le jour 5, les cellules sont récoltées et cryoconservés. Différenciations optimales devraient se traduire par des amas de cellules étroitement connecté avec apparition de morphologie homogène (Figure 2G). Notez que les grappes de faible densité de cellules aplaties marquent un résultat de différenciation sous-optimale. Voir le tableau 2 pour le rendement moyen du jour 5 progéniteurs cardiaques / puits dans divers formats de la culture.

Génération des Cardiomyocytes ventriculaires ressemblant de CPs FHF-L
Jour 5 FHF-L CPs sont décongelés à plaque format dépendant des densités décrites dans le tableau 2, afin de maximiser leur potentiel de différenciation cardiaque (Figure 3A et tableau 2). La viabilité après décongélation doit être surveillée. Généralement, la viabilité varie de 70 à 80 %. Si la viabilité est inférieur à 60 %, le rendement des cardiomyocytes serait touché.

Jour 6 (24 h après la reprise de différenciation), FHF-L CPs devrait couvrir > 90 % de la surface habitable et apparaissent comme une seule couche homogène de cellules (Figure 3B). Confluence basse le jour 6 réduira une différenciation FHF-L CPs cardiomyocytes.

Résultant des cardiomyocytes commencer à battre par jour 11 – 13 de différenciation (Figure 3C et 1 film). Au cours du processus de replating jour 14 – 16, voir le tableau 2 pour le rendement moyen des cardiomyocytes par puits dans différents formats de la culture. Efficacité de différenciation est généralement évaluée par immunofluorescence pour cardiaque (ACTC1), fibroblastes (TAGLN) et les marqueurs endothéliales vasculaires (CDH5) et nucléaire (DAPI). Quantification de la lignée est effectuée en utilisant la quantification d’imagerie et de fluorescence automatisée, comme dans Cunningham et al. (2017) 5 (figure 3D-E). Sous-type de caractérisation des cardiomyocytes qui en résulte est interprétée par qRT-PCR (Figure 3F) et l’analyse transitoire de potentiel d’action à l’aide de la cinétique d’imagerie et de détection des sondes (Figure 3G et le film 2) de la tension. Quantification de la fluorescence pour la sonde de tension et l’analyse de trace de potentiel d’action qui en résulte (Figure 3H) est effectuée comme décrit dans McKeithan et al. (2017) 7.

Figure 1
Figure 1: génération de hPSCId1 lignes. (A) représentation schématique de la hPSCs protocole de générationId1 . (B) des exemples de résultats représentatifs Id1 ARNm généré par l’expression des gènes par l’intermédiaire de lignes distinctes de hPSCId1 , y compris une ligne de CSEh et deux lignes de hPSC lignes qRT-PCR. Ligne pointillée représente le seuil d’expression Id1 , au-dessous de laquelle hPSCId1 lignes doivent subir un cycle supplémentaire de l’infection Id1-lentivirus. « p » indique le nombre de passage. Le nombre dans la parenthèse indique le nombre de tours d’infection Id1-gènes. Barres d’erreur représentent déviation standard d’expériences réalisées en trois exemplaires. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 2
Figure 2: Génération du premier cœur Field-Like cardiaque progéniteurs (FHF-L CPs) différenciation de hPSCId1. (A) représentation schématique du protocole génération FHF-L CP. Photos représentant champ lumineux de hPSCId1 (jour 0) à optimale (B), Sub anastomosé (pointes de flèches jaunes indiquent les régions sub entre les cellules) densité (D) (C) et anastomosé excessive. Photos de lumineux-zone représentant de différencier hPSCId1 au jour 1, 3 et 5 respectivement (E), (F), (G). Echelle = 100 µm. s’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 3
Figure 3: génération de cardiomyocytes ventriculaires ressemblant de CPs FHF-L. (A) Représentation schématique du protocole génération cardiomyocytes ventriculaires-like. (B) champ lumineux image de cellules de différenciation de jour 6 (un jour après décongélation). (C) image de champ lumineux d’une culture de passage à tabac du jour 12. (D) les image d’immunofluorescence représentatifs des cultures de 15 jours (format de plaque 384 puits). ACTC1 marque cardiomyocytes, TAGLN : fibroblastes/smooth muscle, CDH5 : les cellules endothéliales vasculaires et DAPI : noyaux (illustrées dans le médaillon). Quantification de Lineage (E) des cultures de 15 jours. (F) données de qRT-PCR temps expression cours du jour 5 au jour 25 de marqueurs spécifiques ventriculaire (IRX4 et MYL2) et pan-cardiaque marqueur (MYL7). (G) les traces de potentiel d’action représentative de cardiomyocytes ventriculaires ressemblant au jour 25 de différenciation. Mesures durée (H) potentiel d’Action (APD de50 et APD90) de résultant des cardiomyocytes ventriculaires-comme (n = 12). Barres d’erreur représentent déviation standard d’expériences réalisées en quatre exemplaires (sauf indication contraire). Barreaux de l’échelle = 100 µm. RFU, unité de fluorescence relative. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Médium Milieu de base Additif
Médias de cellules souches mTesR1 n/a
Médias d’induction RPMI 1640 Medium B-27 supplément sans sérum sans insuline, 1 x
Médias d’induction RPMI 1640 Medium Puromycine, 6 µg/ml
Médias d’induction RPMI 1640 Medium Pénicilline-streptomycine, 1 x
Cardiogénique Media RPMI 1640 Medium B-27 supplément sans sérum, 1 x
Cardiogénique Media RPMI 1640 Medium Pénicilline-streptomycine, 1 x
Médias de maintenance RPMI 1640 Medium B-27 supplément sans sérum, 1 x
Médias de maintenance RPMI 1640 Medium KnockOut, remplacement du sérum, 2 %
Médias de maintenance RPMI 1640 Medium Pénicilline-streptomycine, 1 x

Tableau 1 : Composantes médiatiques (voir Table des matières pour les additifs et les médias de base).

384 puits 96 puits 12 puits 6 puits 100 mm 150 mm
Volume de revêtement (par puits) 10 ΜL 50 ΜL 500 ΜL 1 mL 5 mL 10 mL
Volume moyen
(par puits)
100 ΜL 300 ΜL 2 mL 5 mL 12 mL 30 mL
Différenciation jour 0 activin une concentration (ng/mL) 100 100 100 300
Progéniteurs cardiaques
rendement du jour 5
(cellules/puits)
1,0 à 1,2 x 105 2.5 – 3.0 x 105 1.0-1.5 x 107 2.0 – 3.0 x 107
Jour 5 de progéniteurs cardiaques peuvent ou le dégel densité (cellules/puits) 2.0 x 104 7,5 x 105 4,5 x 106 8,0 x 106 2.2 x 107
Cardiomyocyte ventriculaire-like
rendement de jour 14 – 16
(cellules/puits)
2,0 à 5,0 x 104 0,8 à 1,2 x 106 3,5 à 5,0 x 106 0,8 à 1,2 x 107 1,8 à 2,5 x 107
Cardiomyocyte ventriculaire semblables peuvent densité
(cellules/puits)
2,5 x 104 1,0 x 106 4,5 x 106 1,0 x 107 2.2 x 107

Tableau 2 : Paramètres de différenciation évolutive (volume de revêtement, volume moyen, concentration activine A, rendements, peuvent les densités).

Nom de gène Adhésion de la Banque de gènes Séquence
GAPDH NM_001256799 F: GGAGCGAGATCCCTCCAAAAT
R : GGCTGTTGTCATACTTCTCATGG
souris Id1 NM_010495 F: CCTAGCTGTTCGCTGAAGGC
R : CTCCGACAGACCAAGTACCAC
IRX4 NM_016358 F: GGCTCCCCAGTTCTTGATGG
R : TAGACCGGGCAGTAGACCG
MYL2 NM_000432 F: TTGGGCGAGTGAACGTGAAAA
R : CCGAACGTAATCAGCCTTCAG
MYL7 NM_021223 F: GCCCAACGTGGTTCTTCCAA
R : CTCCTCCTCTGGGACACTC

Tableau 3 : séquences d’amorces qRT-PCR.

Movie 1
Movie 1 : enregistrement sur le terrain lumineux (100 images/s) du jour 15 cardiomyocytes où l'on peuvent observer des contractions spontanées. S’il vous plaît cliquez ici pour voir cette vidéo. (Clic droit pour télécharger.)

Movie 2
Movie 2 : imagerie cinétique (100 images/s) de sonde fluorescente sensibles à la tension dans les cardiomyocytes ventriculaires-comme 25 – induite par l’id1 jour. S’il vous plaît cliquez ici pour voir cette vidéo. (Clic droit pour télécharger.)

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Pour les différenciations réussies, assurez-vous de suivre attentivement les instructions indiquées ci-dessus. En outre, ici nous mettons en évidence les paramètres clés qui influencent les résultats de la différenciation. Avant de commencer une différenciation, les trois paramètres morphologiques suivantes doivent être respectées : une morphologie de la tige de hPSCsId1, un compactage cellulaire élevé et une confluence élevée (> 90 %) de la culture au jour 0. À cet égard, des conditions optimales de différenciation sont mieux créées par électrodéposition dissociée hPSCsId1 comme cellules individuelles et leur permettant à la forme étroitement groupées monocouches qui poussent à la confluence de ~ 90 % au cours des 2 à 3 jours. À l’inverse, si hPSCId1 cultures montrent pauvre cellulaire et la morphologie des colonies, compactage de colonie faible et la présence de vastes superficies de différenciation au sein de la culture, la différenciation FHF-L CP réussie est peu probable.

Volume du média et concentrations activine A sont des paramètres essentiels de différenciation de la FHF-L CP et plaque format-dépendante (voir tableau 2). Notez également que des concentrations optimales activine A peuvent varier selon l’occasion hPSC ligne et peuvent exiger d’optimisation de la concentration.

Taux d’ARNm ID1 hPSCs est essentiels pour promouvoir efficacement FHF-L cf. sous-optimale Id1 niveaux échouera produire de la différenciation FHF-L CP robuste et on remarquera la mort cellulaire massive par jour 1 de différenciation. Le rapport de l’expression relative Id1- à -GAPDH doit dépasser 0,005 à promouvoir une différenciation efficace. Sélection continue en utilisant des doses plus élevées de la puromycine (6 à 10 µg/mL) est recommandée afin de maintenir de hauts niveaux d’expression de Id1 médiée par des gènes. Une évaluation des niveaux d’ARNm Id1 chaque 10 passages est recommandé.

Placage de densités de J5 FHF-L CPsis également un paramètre essentiel pour l’efficacité de la différenciation cardiaques. Si jour 5 CPs FHF-L sont plaqués aux faibles densités, diminuera le rendement cardiaque relatif. La densité optimale de placage est répertoriée dans le tableau 2 et est plaque format dépendant.

La principale limitation de ce protocole est l’utilisation de la surexpression de Id1 médiée par des gènes à la différenciation de CP promoteFHF-L susceptibles de restreindre l’utilisation thérapeutique des progéniteurs qui en résulte et les cardiomyocytes ventriculaires-like. Aussi, puisque les lentivirus peuvent s’intégrer aux sites que pouvait potentiellement affect hPSC maintenance et/ou potentiel développemental, stemness de hPSCsId1 colonies doivent être surveillé en évaluant la tige l’expression des gènes et en observant les signes morphologiques de différenciation. Notez que surexprimant Id1 à l’aide de vecteurs non intégratifs surmonterait cette limitation et est actuellement à l’étude dans notre laboratoire.

Une fonction pratique de cette méthode est la simplicité du protocole différenciation car elle nécessite seulement une cytokine, l’activine A, pour générer des CPs FHF-L de hPSCsId1. En comparaison, autres protocoles 9,10,11,12,13,14,15 nécessitent des séquences complexes de combinaisons de cytokines et/ou petites molécules afin de promouvoir et de maintenir la différenciation cardiaque. En outre, le présent protocole décrit de façon unique une étape de cryoconservation commode qui permet de découpler la génération FHF-L CP de production ultérieure cardiomyocyte. Cette fonction permet à des lots importants de biobanque de FHF-L CPs et générer rapidement des cardiomyocytes de progéniteurs congelés, comme différenciation cardiaque reprend du 5e après décongélation. Cette stratégie permet de gagner 1 à 2 semaines de temps par rapport à la différenciation cardiaque à partir hPSCs. En outre et surtout, ce protocole est le premier protocole à ce jour pour générer des progéniteurs cardiaques d’origine de champ défini de cœur, tandis que d’autres protocoles9,10,11,12 ,13,14,15 reste indéfini à cet égard.

En résumé, ce protocole décrit une méthode robuste et évolutive pour produire de grandes quantités (> 108– 109) de développemental pertinent FHF-L PC et de cardiomyocytes ventriculaires-like. À son tour, les cellules qui en résulte peuvent être utilisés pour identifier de nouvelles voies réglementaires contrôlant la différenciation cardiaque et la physiologie et régénérative et modélisation de la maladie.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Les auteurs n’ont rien à divulguer.

Acknowledgments

Nous remercions les membres du laboratoire Colas pour discussions utiles et critiques du manuscrit. Cette étude a été financée par le NIH/NIEHS R44ES023521-02 et CIRM DISC2-10110 accorde aux Dr Colas.

Materials

Name Company Catalog Number Comments
ACTC1 antibody Sigma A7811
Activin A Stem Cell Technologies Hu Recom Activin A
Antibiotic Antimycotic (Anti-Anti) Thermo Fisher Scientific 15240062
B27 supplement Thermo Fisher Scientific 17504044
B27 supplement w/o - insulin Thermo Fisher Scientific A1895601
B27 supplement w/o - vitamin A Thermo Fisher Scientific 12587001
CDH5 antibody R&D Systems AF938
CryoStor CS10 Stem Cell Technologies 7930 Cryopreservation reagent
DMEM high Glucose Mediatech 10-013-CV 
DPBS w/ Ca & Mg Corning 21-030-CV
EDTA Thermo Fisher Scientific 15575-038
FBS VWR 89510-186
FluoVolt membrane potential kit   Thermo Fisher Scientific F10488 For optical action potential acquisition, please refer to McKeithan et al. 2017
KnockOut Serum Replacement Gibco 10828010
Matrigel, Growth Factor Reduced Corning 356231 Coating reagent
mTeSR1 media kit Stem Cell Technologies 5850
PBS w/o Ca & Mg Corning 21-040-CV
Penicillin-Streptomycin Gibco
Puromycin  Acros 227422500
ReLeSR Stem Cell Technologies 5872 Enzyme-free dissociation reagent
RPMI 1640 Thermo Fisher Scientific 11875-093
TAGLN antibody Abcam ab14106
Thiazovivin Stem Cell Technologies 72254 RHO/ROCK pathway inhibitor
TrypLE Express Thermo Fisher Scientific 12605 -010 1X enzyme-containing dissociation reagent
Tyrodes solution mix packets   Sigma T2145-10X1L (For optical action potential acquisition, please refer to McKeithan et al. 2017)

DOWNLOAD MATERIALS LIST

References

  1. Chong, J. J., et al. Human embryonic-stem-cell-derived cardiomyocytes regenerate non-human primate hearts. Nature. 510, 273-277 (2014).
  2. Kodo, K., et al. iPSC-derived cardiomyocytes reveal abnormal TGF-beta signalling in left ventricular non-compaction cardiomyopathy. Nature cell biology. 18, 1031-1042 (2016).
  3. Kim, C., et al. Studying arrhythmogenic right ventricular dysplasia with patient-specific iPSCs. Nature. 494, 105-110 (2013).
  4. Colas, A. R., et al. Whole-genome microRNA screening identifies let-7 and mir-18 as regulators of germ layer formation during early embryogenesis. Genes & development. 26, 2567-2579 (2012).
  5. Cunningham, T. J., et al. Id genes are essential for early heart formation. Genes & development. (2017).
  6. McKeithan, W. L., Colas, A. R., Bushway, P. J., Ray, S., Mercola, M. Serum-free generation of multipotent mesoderm (Kdr+) progenitor cells in mouse embryonic stem cells for functional genomics screening. Current protocols in stem cell biology. Chapter 1, Unit 1F 13 (2012).
  7. McKeithan, W. L., et al. An automated platform for assessment of congenital and drug-induced arrhythmia with hipsc-derived cardiomyocytes. Frontiers in physiology. 8, 766 (2017).
  8. Sharma, A., et al. High-throughput screening of tyrosine kinase inhibitor cardiotoxicity with human induced pluripotent stem cells. Science translational medicine. 9, (2017).
  9. Burridge, P. W., et al. Chemically defined generation of human cardiomyocytes. Nature methods. 11, 855-860 (2014).
  10. Kattman, S. J., et al. Stage-specific optimization of activin/nodal and BMP signaling promotes cardiac differentiation of mouse and human pluripotent stem cell lines. Cell stem cell. 8, 228-240 (2011).
  11. Laflamme, M. A., et al. Cardiomyocytes derived from human embryonic stem cells in pro-survival factors enhance function of infarcted rat hearts. Nature biotechnology. 25, 1015-1024 (2007).
  12. Lian, X., et al. Robust cardiomyocyte differentiation from human pluripotent stem cells via temporal modulation of canonical Wnt signaling. Proceedings of the National Academy of Sciences of the United States of America. 109, 1848-1857 (2012).
  13. Willems, E., et al. Small molecule-mediated TGF-beta type II receptor degradation promotes cardiomyogenesis in embryonic stem cells. Cell stem cell. 11, 242-252 (2012).
  14. Yang, L., et al. Human cardiovascular progenitor cells develop from a KDR+ embryonic-stem-cell-derived population. Nature. 453, 524-528 (2008).
  15. Palpant, N. J., et al. Generating high-purity cardiac and endothelial derivatives from patterned mesoderm using human pluripotent stem cells. Nature protocols. 12, 15-31 (2017).
  16. DeLaughter, D. M., et al. Single-cell resolution of temporal gene expression during heart development. Developmental cell. 39, 480-490 (2016).
  17. Liu, X., et al. The complex genetics of hypoplastic left heart syndrome. Nature genetics. 49, 1152-1159 (2017).
  18. Corrado, D., Link, M. S., Calkins, H. Arrhythmogenic right ventricular cardiomyopathy. New England journal of medicine. 376, 1489-1490 (2017).
  19. Kitamura, T., et al. Retrovirus-mediated gene transfer and expression cloning: powerful tools in functional genomics. Experimental hematology. 31, 1007-1014 (2003).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics