En Oligonucleotide-baserte Tandem RNA isolasjon prosedyre å gjenopprette eukaryote mRNA Protein komplekser

* These authors contributed equally
Biochemistry
JoVE Journal
Biochemistry
AccessviaTrial
 

Summary

En tandem RNA isolasjon prosedyre (tur) for utvinning av endogenously dannet mRNA protein komplekser er beskrevet. Spesielt RNA-protein komplekser er krysskoblet i vivo, polyadenylated RNAs er isolert fra ekstrakter med oligo(dT) perler og bestemte mRNAs er tatt med endrede RNA antisense oligonucleotides. Proteiner bundet til mRNAs gjenkjennes av immunoblot analyse.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Iadevaia, V., Matia-González, A. M., Gerber, A. P. An Oligonucleotide-based Tandem RNA Isolation Procedure to Recover Eukaryotic mRNA-Protein Complexes. J. Vis. Exp. (138), e58223, doi:10.3791/58223 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

RNA-bindende proteiner (RBPs) spiller nøkkelroller i kontrollen post-transcriptional av genuttrykk. Derfor er biokjemiske karakteristikk av mRNA protein komplekser nødvendig for å forstå mRNA regulering utledes ved samspill proteiner eller ikke-koding RNAs. Her beskriver vi en tandem RNA isolasjon prosedyre (tur) som gjør rensing av endogenously dannet mRNA protein komplekser fra mobilnettet ekstrakter. I two-step protokollen omfatter isolering av polyadenylated mRNAs med antisense oligo(dT) perler og påfølgende erobringen av en mRNA rundt med 3-biotinylated 2-O-denaturert antisense RNA oligonucleotides, som deretter kan være isolert med streptavidin perler. TUREN ble brukt til å gjenopprette i vivo krysskoblet mRNA-ribonucleoprotein (mRNP) komplekser fra gjær og nematoder menneskelige celler for videre RNA og protein analyse. Dermed er tur en allsidig tilnærming som kan tilpasses til alle typer polyadenylated RNAs over organismer å studere dynamisk nytt arrangement av mRNPs pålagt av intracellulær eller miljømessige signaler.

Introduction

Post-transcriptional gene regulering drives gjennom samspillet mellom RNA-bindende proteiner (RBPs) ikke-RNAs (ncRNAs) og mRNAs, som direkte behandling, lokalisering, oversettelse og forfallet av hver utskrift i celler1 , 2. identifikasjon av RBPs og ncRNA samspill med bestemte mRNAs, etablere det som kalles ribonucleoprotein komplekser/partikler (RNPs), er derfor nøkkelen til å forstå skjebnen til mRNAs og gene expression kontroll. Supplerende tiltak er gjennomført for biokjemiske karakterisering av RNP komplekser3,4: mens "protein-sentrisk" tilnærmingen er basert på rensing av spesifikke RBPs, "RNA-sentrisk" tilnærmingen innebærer den isolering av subpopulasjoner eller personlige RNAs og påfølgende analyse av samspill proteiner eller RNAs. Nylig en RNA-tilnærming til å identifisere RBP repertoaret samspill med polyadenylated (poly(A)) RNAs5 har blitt stadig mer populært ved å innlemme en ultrafiolett (UV) lys crosslinking skritt for å stabilisere protein-RNA interaksjoner før isolering av mRNAs, som dramatisk utvidet katalogen RBPs i menneskeceller6,7,8,9,10,11, Caenorhabditis elegans 12og saccharomyces cerevisiae12,13,14andre organismer15,16,17,18, 19,20. Tilordningen av proteiner og/eller ncRNAs montert på bestemt transkripsjoner er imidlertid fortsatt en stor utfordring. Dette brukes for tiden to hovedfremgangsmåter: på den ene siden, RNA aptamer koder er smeltet til RNA rundt aktivere affinitet rensing. Dermed binde RNA aptamers med høy affinitet aminoglycoside antibiotika inkludert tobramycin og streptomycin21,22,23,24eller for pels protein fra den R17/MS2 bacteriophage eller bakteriell streptavidin S1,25,,26,,27,,28,,29. Selv om denne tilnærmingen viste seg å være relativt robust og allsidig, det krever kloning design av RNA under etterforskning, og dermed kan ikke brukes til å fange naturlig mRNAs. På den annen side, antisense oligonucleotides (ASOs) ble brukt tidlig for gjenvinning og karakterisering av svært uttrykt innfødt RNPs30,31 og viral RNAs32. Flere nylig, ASOs ble brukt til å fange lang ikke koding RNAs33,34,35 og i vitro dannet mRNPs36. En større begrensende faktor med alle RNA sentriske tilnærminger er kopien antall RNA av interesse, noe som gjør utvinning av lav-uttrykt mRNAs mer problematisk. Denne begrensningen kan overvinnes ved oppskalering reaksjonen; Dette kan imidlertid føre til øke bakgrunnen.

Her beskriver vi vår nylig utviklede ASO-baserte tandem RNA isolasjon prosedyre (tur) for å isolere innfødt mRNA protein komplekser med høy selektivitet37 (figur 1). Protokollen inneholder to sammenhengende ASO-baserte rensing trinn, nemlig isolering av poly(A) mRNAs med kommersielt tilgjengelig oligo(dT) kombinert perler etterfulgt av fangst av bestemte mRNAs bruker spesielt utformet kort biotinylated 2-methoxy RNA ASOs. Denne to-trinns fremgangsmåten hjelper eliminere skadelige proteiner og gir muligheter for tilpasning og optimalisering. I dette tilfellet tur ble installert på valgte mRNAs gjær, nematoder, og menneskelige celler å bekrefte i vivo dannet mRNA protein komplekser.

Protocol

1. design Antisense Oligonucleotides (ASOs)

  1. Analysere sekundære strukturen i mRNA eller et fragment av bruker tilgjengelig online verktøy38. Derfor angi nukleotid (nt) sekvensen i den tomme boksen. Velg Minimum fri energi (MFE) og partition-funksjonen og unngå isolerte base parenei grunnleggende Alternativer-boksen. I boksen utgang Alternativer Velg interaktiv RNA sekundær plot og til slutt klikker du på Fortsett -knappen. Et nytt vindu vil popup-vindu som viser sekundære oppbygning mRNA rundt.
  2. Velg minst tre forskjellige 21-24 nts lang sekvenser fra mRNA av interesse, fortrinnsvis i regioner mangler synlig sekundære strukturer (f.eks., i ustrukturert ledd) og i 3 uoversatt regioner (UTR).
    Merk: Det har blitt observert at ASOs annealing til sekvenser i 3' uoversatt regioner (UTR) gir best. En mulighet er at ribosomer bundet til koding sekvensen (CDS) kan noen ganger hindre annealing på ASOs. ASOs annealing til 5' UTRs ble ikke testet.
    1. Velg områdene med en guanidine/cytosine nær 50% og mangler nukleotid tandem gjentas for å unngå potensielle hårnåler eller selv avspenning.
  3. Manuelt design 2-methoxy endret RNA oligonucleotides bærer en biotin moiety på den 3', helt utfyllende til valgte områdene (trinn 1.2) i ønsket mål mRNA.
    Merk: 2-methoxy modifikasjoner gjengi RNA motstandsdyktig mot mobilnettet RNases og øker duplex smelter temperatur, hvilke innrømmer for strenge vask. Biotin moiety kreves for fanger ASOs med streptavidin.
    1. Justere Smeltetemperaturen for de RNA hybrider ~ 60-65 ° C og sørge for at den har en høy språklige sekvens kompleksitet (> 60%) som med egnet nettverktøy39.
    2. Bruke grunnleggende lokale justering søkeverktøy40 søke etter potensielle ASO kryss-hybridisering med andre mRNAs i transcriptome. Velg Nucleotide BLAST, sette inn sekvenser i den tomme boksen og velg organismen rundt. Holde de gjenværende parameterne som standard, og klikk BLAST.
      Merk: Selv delvis kontinuerlig justering av 8-10 nts kan føre til kryss-hybridisering og utvinning av denne mRNA.

2. celle kultur, UV bestråling og celle Lysis

Merk: Nedenfor er fremgangsmåten beskrevet for spirende gjær S. cerevisiae, nematoder C. elegansog menneskelige embryonale nyreceller (HEK293). Likevel kan det være tilpasset andre organismer, men det ikke var eksplisitt testet ennå.

  1. S. cerevisiae
    1. Vokse gjærceller (f.eks., belastning BY4743 derivate; MATa/α his3Δ1/his3Δ1 leu2Δ0/leu2Δ0 LYS2/lys2Δ0 met15Δ0/MET15 ura3Δ0/ura3Δ0 PFK2:TAP / PFK2) i 500 mL YPD medier (1% gjærekstrakt, 2% pepton 2% D-glukose) på 30 ° C med konstant rister på 220 rpm.
    2. Samle cellene i midten av Logg fase (optisk tetthet på 600 nm (OD)600 ~ 0,6) ved filtrering bruker 0,45 µm nylon filtre eller sentrifugering 3000 × g i 2 minutter ved romtemperatur (RT). Kast gjennomflytsenhet eller nedbryting, henholdsvis.
    3. Vask cellene tre ganger med 25 mL fosfat-bufret-saltoppløsning (PBS) bruker 0,45 µm nylon filteret eller samle med sentrifugering 3000 × g i 2 minutter på RT og forkaste nedbryting. Samle cellene så raskt som mulig pålagt stress kan ha betydning på RNA-protein interaksjoner.
    4. Resuspend cellene i 25 mL PBS og så helle suspensjon i en 15 cm Petriskål. Plasser rett på is, Fjern lokket og utsette cellene tre ganger med 400 mJ cm-2 254 nm UV lys i en UV-crosslinker 2-min pauser på is mellom hver eksponering syklus med mild miksing.
    5. Overføre cellene til en 50 mL tube og samle celler med sentrifugering 3000 × g i 3 minutter på 4 ° C. Forkaste nedbryting og holde pellet.
      Merk: Celler kan være snapin frosset i flytende nitrogen og lagret på-80 ° C.
    6. Resuspend cellene i 4 mL kjølt lyseringsbuffer A (LB-A; 100 mM Tris-HCl, pH 7.5 500 mM LiCl, 10 mM EDTA, 1% Triton X-100, 5 mM DTT, 20 U ml-1 DNase jeg, 100 U ml-1 RNasin, fullføre EDTA-fri protease-hemmer cocktail).
    7. Overføre cellene til to 2 mL rør. Legg til maks. ⅔ mengder kjølt glassperler og forstyrre cellene i en vev lyser på 30 Hz i 10 min på 4 ° C.
    8. Slå et hull i bunnen av røret med en varm nål og overføre de lysate til en frisk 1,5 mL tube med sentrifugering 600 × g for 30 s.
    9. Fjern lysate av tre sammenhengende centrifugations på 4 ° C på 3000 × g i 3 minutter, deretter 5000 × g og 10.000 × g i 5 min.
      Merk: Ekstrakter kan snapin-frosset i flytende nitrogen og lagret på-80 ° C.
  2. C. elegans
    1. Kultur Bristol N2 ormer ved 20 ° C på Rundormer vekst Medium (NGM) plater (0,3% NaCl 1,7% agar 0,25% pepton, 1 mM CaCl2, 5 µg/mL kolesterol, 1 mM MgSO4, 25 mM KPO4 buffer, pH 6.0) plantet med OP50 Escherichia coli belastningen 41 .
    2. Legge til 5 mL av M9 buffer41 (0,3% KH2PO4, 0,6% Na2HPO4, 0,5% NaCl, 1 mM MgSO4) hver plate, riste platen resuspend ormer og overføre ormer slik 15 mL. Plasser 2 µL av suspensjon i et lysbilde og telle ormer i suspensjon med et mikroskop. Deretter bruke faktoren for å beregne hvor mange ormer per plate.
    3. Samle ~ 120.000 ormer med sentrifugering ved romtemperatur (400 × g, 2 min, RT) og kast nedbryting.
    4. Vask ormer tre ganger. Derfor legge til 10 mL av M9 buffer, blande av inversjon og samle ormer med sentrifugering 400 × g i 2 minutter på RT.
    5. Legge til 15 mL av M9 buffer ormer og plasser på et rotatory hjul i 15 min på RT.
    6. Overføre ormer til NGM plater (~ 4000 ormer per plate) og utsette å UV-lys (254 nm) på 300 mJ cm-2 i en UV-crosslinker.
    7. Legg til 5 mL av M9 bufferen direkte til platen og riste plate å resuspend ormer i bufferen. Overføre suspensjon med en pipette til en 15 mL tube og samle ormer med sentrifugering 400 × g i 2 minutter på RT.
    8. Resuspend ormer i 2 mL lyseringsbuffer B (LB-B, 100 mM Tris-HCl, pH 8.0, 150 mM NaCl, 1 mM EDTA, 0,75% IGEPAL, 1 mM DTT, 20 U mL-1 DNase jeg, 100 U mL-1 RNasin, fullføre EDTA-fri protease-hemmer cocktail).
    9. Grind ormer i en morter fylt med flytende nitrogen. Samle pulver i en 50 mL tube og tine på RT.
      Merk: Flytende nitrogen må håndteres i henhold til prosedyrer (f.eks fume hette og sikkerhet hansker)
    10. Fjern lysate inkludert fett laget med sentrifugering 14.000 × g i 10 min og deretter sende den avklart lysate gjennom et 0,45 μm filter med en sprøyte.
  3. Kultivert menneskeceller
    Merk: Følgende beskrivelse er basert på forbigående transfection av HEK293 celler med pGL3-CDKN1B-3'UTR reporter plasmider som uttrykker 3′UTR CDKN1B/27 nedstrøms av firefly luciferase gene42.
    1. Kultur HEK293 celler i Dulbeccos endret Eagle's Medium (DMEM) som inneholder 25 mM glukose og 1 mM natrium pyruvate, supplert med 100 U mL-1 penicillin, 100 µg mL-1 streptomycin og 10% fosterets bovin serum (FBS) og ruge på 37 ° C i en fuktet kammer (inkubator) som inneholder 5% CO2.
    2. Frø ~ 3 × 106 HEK293 celler i en standard 10 cm vev kultur parabol dagen før transfection. Telle celler med en hemocytometer.
    3. Bland 2 µg av reporteren genet (f.eks., pGL3-p27-3'UTR) med 20 µL av transfection reagensen og transfect cellene på 70% confluency (~ 7 × 106 celler).
    4. Plasser cellene i en inkubator på 37 ° C for videre 48 timer før høstingen.
    5. Fjerne mediet med en serologisk pipette og raskt vask cellene to ganger med 10 mL PBS pre varmet på 37 ° C. Fjerne PBS med en serologisk pipette.
    6. Legge til 6 mL av PBS parabolen, plassere på is og dermed eksponere cellene for UV-lys (254 nm) på 100 mJ cm-2 i en UV-crosslinker.
      Merk: Platen må holdes på is under UV-lys eksponering.
    7. Skrape av cellene (i totale ~ 107 celler) i PBS og overføre til en 15 mL tube.
    8. Nedspinning cellene på 250 × g i 10 min på 4 ° C, og deretter fjerne nedbryting med en pipette.
      Merk: Cellen pellets kan snapin-frosset i flytende nitrogen og lagret ved-80 ° C før bruk.
    9. Resuspend cellene i 2 mL pre kjølt lyseringsbuffer (LB-A) av pipettering opp og ned 5 - 6 ganger, mens du holder røret på is.
    10. Overføre lysate med en pipette til en 5 mL tube plassert på is.
    11. Underlagt lysate tre runder med sonication bestående av 20 s støt ved 10 μm amplituden med 30 s avkjøling perioder på is.
      Merk: Sonication er anbefalt som den fullfører lysis av celler og fragmenter av DNA.
    12. Overføring av lysate til 2 mL rør og sentrifuge 15.000 × g for 10 min på 4 ° C. Samle nedbryting (= ekstrakt) og overføre til en ny tube. Fjerne en analytisk prøve (5-10%) for ytterligere protein og RNA analyse.
      Merk: Dette trinnet er svært viktig å fjern gjenværende celle rusk og kan gjentas.

3. første trinn: Poly(A) RNA isolasjon

  1. Equilibrate 1 mg oligo(dT)25-kombinert magnetiske perler i 500 µL av respektive lyseringsbuffer.
  2. Kombiner 5 mg, 10 mg eller 4 mg (protein) S. cerevisiae, C. elegans eller HEK293 ekstrakter, henholdsvis med 1 mg oligo(dT)25 -kombinert magnetiske perler. Bland prøvene kraftig i 10 min ved 25 ° C i en mikser.
    Merk: Protein konsentrasjoner av ekstrakter kan fastsettes med Bradford analysen med bovin serum albumin (BSA) som en referanse standard. Kraftig risting av prøver hindrer sedimentering av perler. For å evaluere spesifisitet mRNA isolasjon, kan en kontroll eksperiment utføres parallelt ved å legge til et overskudd (20 µg) av polyadenylic syrer (pA).
  3. Plassere rør på en magnetisk stå for 10 s og fjern nedbryting. Holde nedbryting på is påfølgende rundene av utvinning (trinn 3.7).
  4. Legge til 500 µL vask buffer A (10 mM Tris-HCl, pH 7.5 600 mM LiCl, 1 mM EDTA, 0,1% Triton X-100) til perler og vortex 5 s.
    Merk: Konsentrasjonen av LiCl i vaskebuffere kan variere. 600 mM LiCl anbefales men lave konsentrasjoner ble også testet (500 mM for C. elegans, 300 mM for HEK293).
  5. Samle perler med en magnet, og deretter vaske perlene to ganger med 500 µL av vaskebuffer B (WB, 10 mM Tris-HCl, pH 7.5 600 mM LiCl, 1 mM EDTA).
  6. Elute RNA i 30 µL av 10 mM Tris-HCl, pH 7.5 på 80 ° C i 2 minutter med kontinuerlig skjelvende (1000 rpm) på et blandebatteri. Umiddelbart sett røret i magnetiske stå og samle eluate etter 10 s. lagre perler for flere runder av rensing.
    Merk: Samle eluate så raskt som mulig å hindre potensielle rebinding av mRNAs til perlene ved lavere temperaturer.
  7. Legge perler fra forrige trinn til nedbryting samlet på trinn 3.3 gjenta fangst, vask og elueringsrør av mRNAs to ganger (trinn 3.3-3.6). Eluates fra gjentatte runder kombineres deretter og kan lagres på-80 ° C.

4. andre trinn: fange av bestemte mRNAs med 3-Biotinylated 2-Methoxy endret Antisense RNA Oligonucleotides

Merk: For å teste hensiktsmessigheten av ASOs, fremgangsmåten kan utføres med totalt RNAs isolert fra celler.

  1. Equilibrate 30 µL av streptavidin-kombinert magnetiske perler i 1 mL av bindende og vaske bufferen (B & W buffer, 10 mM Tris-HCl, pH 7.5 150 mM NaCl, 0,5 mM EDTA, pH 8.0) som inneholder 0,1 mg mL-1Escherichia coli overføring RNA (tRNA) på et rotator 1t på RT.
    1. Vask perlene tre ganger med 750 µL av B & W buffer.
    2. Resuspend perler i 30 µL av B & W buffer og holde på is til bruk.
  2. Fortynne ~ 35 µg totale protein fra tidligere poly(A) isolasjon (se 3) i 100 µL av B & W buffer i en 1,5 mL tube.
    Merk: For å teste spesifisiteten av ASOs med totalt RNA, legge til 600 ng av renset totalt til 100 µL av B & W buffer.
  3. Legg til 200 pmol av respektive ASO og ruge ved 70 ° C i 5 minutter.
    Merk: Hevet temperaturen løser sekundære strukturer i RNA tilrettelegge annealing av ASO.
  4. Fjerne hele varme-blokk fra enheten, og plasser den på RT for 10 min å kjøle ned sakte.
  5. Legge til 30 µL av equilibrated streptavidin-kombinert magnetiske perler fra trinn 4.1 prøven.
  6. Inkuber blandingen for 30 min ved 25 ° C med konstant rister på 950 rpm på et blandebatteri.
    Merk: Det anbefales å bla rør hvert 10 min for å forhindre sedimentering av perler.
  7. Plassere rør på magnetiske stativ, fjerne nedbryting og vask perlene tre ganger med 750 µL forvarmes B & W bufferen på 55 ° C.
    Merk: Optimal vask temperaturen litt forskjellig/variere mellom forskjellige ASOs. Det anbefales å justere dette med ikke-krysskoblet totale RNA før utføre eksperimentet med cellen ekstrakter.
  8. Elute RNA i 20 µL av 10 mM Tris-HCl, pH 7.5 ved 90 ° C i 10 min med konstant rister på 950 rpm på et blandebatteri. Plassere rør i magnetiske stå og umiddelbart samle eluate.
    Merk: For protein analyse, legge til 20 µL av 1 × Laemmli buffer perler og ruge på 95 ° C for 5 min. proteiner overvåkes av immunoblot analyse etter standard laboratorium protokoller.

Representative Results

Vi utviklet en ASO-baserte RNA isolasjon strategi, kalt tur, å fange bestemt mRNAs med sine bundet proteiner fra tre ulike organismer37. I hovedsak RNA-protein komplekser var krysskoblet i vivo av UV-bestråling av celler på 254 nm og poly(A) RNAs ble gjenopprettet med kommersielt tilgjengelig oligo (dT) kombinert-magnetiske perler, så mRNA rundt ble isolert med 3-biotinylated 2-0-methoxy endret antisense RNA oligonucleotides (figur 1). Vi derfor utviklet flere 21-24 nts endret ASOs med full-komplementaritet til områder i den valgte mRNAs fra gjær, C. elegans og menneske, og testet deres egnethet for å gjenopprette mRNA rundt (en liste over primere og ASOs er gitt i tabell 1). effektivitet og spesifisitet av personlige ASOs ble først vurdert med ikke-krysskoblet totale RNA isolert fra de respektive organismen. I disse eksperimentene, RNA ASOs koblet til streptavidin-konjugerte spinn perler og inkubert med ikke-krysskoblet totale RNA forberedt fra tilsvarende organismen. Etter utgivelsen av fanget mRNAs fra perler, tilstedeværelse av mRNA mål så vel som urelaterte kontroll mRNAs ble overvåket av omvendt transkripsjon (RT)-polymerase kjedereaksjon (PCR)37. Vi la merke til at to variabler, saltkonsentrasjon og temperaturen på vaskebuffere, spilte avgjørende roller i effektiviteten av erobringen av PFK2 mRNA fra gjær som ble testet med tre forskjellige ASOs (figur 2A). Redusere salt (NaCl) konsentrasjonen til 25 mM redusert utvinning av negative kontroll mRNA (PFK1) til ikke-Detektbart nivåer med alle ASOs, men det også redusert utvinning av ønsket mål mRNA PFK2 (10-15% av skriving). Omvendt, en økning på salt konsentrasjonen til fysiologiske nivåer (150 mM NaCl) økt utvinning av PFK2 mRNAs opp til 75% med ASO PFK2-2, overstiger det i kontrollen PFK1 mRNA av minst 5-fold (figur 2A). Videre merke viste de ulike ASOs stor variasjon av mRNA målet fange efficacies i fysiologiske salt-konsentrasjoner understreker behovet for empiriske valideringen av ASOs. Avhengigheten av mRNA utvinning temperaturen på vaskebuffer er eksemplifisert for C. elegans cep-1 og gjær RPS20 mRNAs, med respektive ASOs (tabell 1). Vi observerte at optimal vask temperaturen var mellom 50 ° C og 55 ° C, som tydelig fra lav bakgrunnen med urelaterte mRNAs og effektiv utvinning av mRNAs mål (figur 2B). På dette punktet ønsker vi å understreke at kryss-blanding av ASOs med andre mRNAs. For eksempel DNM1 ASO er fullt komplementær til en sekvens innenfor DNM1 koding sekvens, men det også delvis anneals med ACT1 mRNA. DNM1 ASOs gjenopprettet både mRNAs uansett vask temperatur, viser sterk tilbøyelighet for kryss-hybridisering (figur 2C). Til slutt, vi har brukt ovenfor beskrevet testene og optimaliseringer velge tre ASOs som var egnet for gjenvinning av respektive målet mRNAs fra totalt RNA isolert fra S. cerevisiae, C. elegans og menneskelige celler (figur 2D ).

Etter valg av egnet ASOs i vitro, utført vi tur med cellen ekstrakter fra UV-krysskoblet organismer/celler (figur 1). Spesielt vi testet utvinning av tre forskjellige mRNAs fra tre ulike organismer: PFK2 mRNA fra gjær S. cerevisiae, cep-1 Rundormer C. elegans, og en reporter mRNA (pGL3-CDKN1B-3'UTR) bærer den 3' UTR sekvensen av menneskelig CDKN1B/p27 mRNA smeltet sammen til en luciferase (luc) reporter for forbigående uttrykk i menneskeceller HEK293. For å kontrollere spesifisiteten av RNA isolasjon, siden vi utvinning av flere urelaterte mRNAs, og vi utført konkurranse eksperimenter med tillegg av et overskudd av pA til celle ekstrakter, som konkurrerer med binding av mobilnettet mRNAs å oligo(dT)25 perler i steg for steg-rensing. Tidligere sett med ikke-krysskoblet totale RNA prøver (figur 2), RT PCR bekreftet anriking av de respektive mRNAs målrette mRNA under tur, mens flere ikke-relaterte kontroll mRNAs ikke var beriket (figur 3A). Videre ingen mRNAs ble funnet på perler uten ASOs, som angir passende blokkerer prosedyrer som unngår uspesifikke bindende. På denne linjen, kan urelaterte/scrambled ASOs også brukes som kontroll, selv om potensialet for kryss-hybridisering med visse mRNAs og tiltenkt erobringen av bundet proteiner må deretter tas i betraktning. Siden proteiner i den endelige eluate kan neppe bli visualisert på sølv-farget polyakrylamid gels (data ikke vist), ble tilstedeværelse av tidligere kjent mRNA samspill proteiner ytterligere vurdert av immunoblot analyse. Dette inkluderer Pfk2p fra S. cerevisiae, som binder selektivt til PFK2 mRNA i en ribosom uavhengig måte12; C. elegans GLD-1, en kanoniske RBP som binder til 3 UTR sekvenser av cep-1 mRNA for translasjonsforskning regulering43; og HuR, en RBP som regulerer mRNA stabilitet og oversettelse av p27/CDKN1B mRNA44. Som forventet, ble alle av disse proteinene identifisert i tur eluates av respektive mRNAs ved Western Blot analyse (figur 3B).

Figure 1
Figur 1. Skjematisk fremstilling av tur. Proteiner er krysskoblet RNA i vivo av UV-bestråling. I det første trinnet (lys grønn boks) gjenopprettes poly(A) RNA-protein komplekser med oligo(dT)25 perler å bruke strenge vask forhold fjerne ubundet proteiner. I det andre trinnet (rosa boksen), mRNP mål er trukket ut med biotinylated antisense RNA oligonucleotides og streptavidin perler. De renset mRNPs analyseres deretter av RT PCR og immunoblot /-massespektrometri (MS) for å identifisere RNAs og proteiner samarbeidsstil mRNA interesse, henholdsvis. Figuren ble endret fra forrige publikasjonen37 med tillatelse. Klikk her for å se en større versjon av dette tallet.

Figure 2
Figur 2. Isolering av valgte mRNAs fra totalt RNA av ikke-krysskoblet celler/organismer bruker endret antisense RNA fange sonder. (A) virkningen av salt konsentrasjoner på fanger effektiviteten av gjær PFK2 mRNA med ASOs. Totalt RNA fra gjærceller ble kombinert med de angitte ASOs og vasket med buffer som inneholder den angitte (NaCl) saltkonsentrasjon på 55 ° C. Grønn, blå og oransje linjene representerer PFK2 mRNA gjenoppretting med forskjellige ASOs som bestemmes av RT PCR37: PFK2-1 og PFK2 -2 anneal i de 3' UTR, PFK2-4 i CDS. PFK1 er en negativ kontroll mRNA. PCR ble utført med 32 forsterkning sykluser og kvantifisert som beskrevet tidligere37. (B) brøkdel av C. eleganscep-1 og gjær RPS20 ASO bundet mRNAs på ulike vask temperaturer, representert i svarte og røde linjene, henholdsvis. C. eleganspgk-1 og gjær ACT1 er ikke mål (kontroll) mRNAs. 30 og 32 PCR sykluser ble brukt for påvisning av gjær og C. elegans mRNAs, henholdsvis. (C) skjematisk fremstilling av hybridization av DNM1 ASO (rød) med sekvenser i DNM1 mRNA samt potensielle kryss-hybridisering med ACT1 mRNA vises til venstre. En agarose gel viser produkter fra RT PCR reaksjoner (30 sykluser) for påvisning av gjær DNM1 og ACT1 mRNAs elut fra perler vises til høyre. Inngang, totalt RNA; Sn, nedbryting etter inkubasjon med ASOs; E eluates fra perler vasket på angitt temperaturer tidligere elueringsrør (40 ° C, 50 ° C og 60 ° C). En kontroll eksperiment (Ctrl) ble utført i parallell uten å legge ASO. (D) Agarose gel viser RT PCR produkter for påvisning av mRNAs (høyre) tatt fra total RNA gjær S. cerevisiae, C. elegansog menneskelige HEK293 celler (H. sapiens). Inngang, totalt RNA; Sn, supernatant; E, eluates fra perler. PCR ble utført av 30 forsterkning sykluser gjær mRNAs, 32 sykluser C. elegans mRNAs, og 28 og 30 sykluser for menneskelig tubulin og p27 mRNAs, henholdsvis. Figuren ble endret fra forrige publikasjonen37 med tillatelse. Klikk her for å se en større versjon av dette tallet.

Figure 3
Figur 3. Erobringen av bestemt mRNA-protein komplekser fra ekstrakter avledet fra UV krysskoblet celler med tur. (A) Agarose gels for påvisning av mRNAs (høyre) med RT PCR på fange med oligo(dT) og indikerte ASOs fra S. cerevisiae, C. elegans og menneskelige (H. sapiens) cellen ekstrakter. Inngang, totalt RNA fra krysskoblet celler/organismer; CTRL, kontroll uten ASO. Poly(A), konkurranse med poly(A). RT PCR ble utført som beskrevet37 med 35 forsterkning sykluser for LUC, 32 sykluser for p27, og 29 sykluser for tubulin. (B) Immunoblot analyse av mRNA-bundet proteiner med angitte antistoffer (høyre). Lastet fraksjoner er som følger: 0,1%, 2,5% og 1% for gjær, Rundormer og menneskelig inndata; 10%, 10% og 5% for gjær, Rundormer og menneskelig oligo(dT) baner; og 66% for alle ASOs kjørefelt. Molekylvekt (MW) er angitt i kilodaltons (kDa). Figur publiseres med tillatelse37. Klikk her for å se en større versjon av dette tallet.

Primer navn Sekvens Mål Størrelse
Pfk2_Fwd GTGTTAAGGGTTCACATGTCG PFK2 S. cerevisiae 133 bp
Pfk2_Rev CTTCCAACCAAATGGTCAGC PFK2 S. cerevisiae 133 bp
Pfk1_Fwd GGTGATTCTCCAGGTATGAATG PFK1 S. cerevisiae 97 bp
Pfk1_Rev CTTCGTAACCTTCGTAAACAGC PFK1 S. cerevisiae 97 bp
Act1_Fwd GTCTGGATTGGTGGTTCTATC ACT1 S. cerevisiae 85 bp
Act1_Rev GGACCACTTTCGTCGTATTC ACT1 S. cerevisiae 85 bp
Dnm1_Fwd CTGTGTTCGATGCATCAGAC DNM1 S. cerevisiae 156 bp
Dnm1_Rev CGCACTCCAATTCTTCTCTC DNM1 S. cerevisiae 156 bp
Rps20_Fwd CGCTGAACAACACAACTTGG RPS20 S. cerevisiae 228 bp
Rps20_Rev GGAAGCAACAACAACTTCGAC RPS20 S. cerevisiae 228 bp
Cep1_Fwd CGATGAAGAGAAGTCGCTGT Cep-1 C. elegans 110 bp
Cep1_Rev ATCTGGGAACTTTTGCTTCG Cep-1 C. elegans 110 bp
Pgk1_Fwd GCGATATTTATGTCAATGATGCTTTC pgk-1 C. elegans 74 bp
Pgk1_Rev TGAGTGCTCGACTCCAACCA pgk-1 C. elegans 74 bp
Mpk1_Fwd TGCTCAGTAATCGGCCATTG modellene-1 C. elegans 74 bp
Mpk1_Rev TCCAACAACTGCCAAAATCAAA modellene-1 C. elegans 74 bp
p27_Fwd TTTAAAAATACATATCGCTGACTTCATGG p27 homo sapiens 212 bp
p27_Rev CAAAGTTTATGTGCTACATAAAAGGTAAAAA p27 homo sapiens 212 bp
Luc_Fwd AATGGCTCATATCGCTCCTGGAT Luciferase P. pγralis 117 bp
Luc_Rev TGGACGATGGCCTTGATCTTGTCT Luciferase P. pγralis 117 bp
Β-TUBULIN_Fwd CTGAACCACCTTGTCTCAGC Β-TUBULIN homo sapiens 136 bp
Β-TUBULIN_Rev AGCCAGGCATAAAGAAATGG Β-TUBULIN homo sapiens 136 bp
PFK2-1 ASO AAUAGAAAGUGUAAUAAAAGGUCAU 3' UTR PFK2 S. cerevisiae -
PFK2-2 ASO GUUUCAUGGGGUAGUACUUGU 3' UTR PFK2 S. cerevisiae -
PFK2-4 ASO CUUGAAGAGGAGCGUUCAUA ORF PFK2 S. cerevisiae -
DNM1 ASO UCGGUCAGUGGAGGUUCAGCGUUU ORF DNM1 S. cerevisiae -
RPS20 ASO GUCGGUAAUAGCCUUCUCAUUCUUG ORF RPS20 S. cerevisiae -
Cep-1 ASO GUGAGAAAUGCGGUGCUUUGAAA 3 UTR cep-1 C. elegans -
p27 ASO UCAUACCCCGCUCCACGUCAGUU 3 UTR p27 homo sapiens -

Tabell 1. Oligonucleotide sekvenser. Liste over PCR primere og ASOs brukt i dette arbeidet, primer sekvens, genet målrette og forventet fragment størrelse etter forsterkning.

Discussion

TUR tillater analyse av proteiner bundet til bestemte mRNAs i vivo med biokjemiske betyr. Mens vi har brukt metoden for å validere samspillet av bestemt RBPs med mRNA mål fra andre organismer/celler, kan turen også være aktuelt å studere andre typer poly(A) RNAs, som cytoplasmatiske lang ncRNAs. Videre oppnås systematisk analyse av bundet proteiner og/eller RNAs med MS eller RNA sekvensering ved en opp-skalering av prosedyren. I denne forbindelse indikerer våre foreløpige data at 1 L gjær kulturer og minst 100 millioner av HEK293 menneskeceller kunne gi tilstrekkelig starter materiale for å få pålitelige MS data for godt uttrykt mRNAs (upublisert resultater).

Beskrevet tur protokollen inneholder bestråling av celler med UV-lys på 254 nm til krysskobling RNA-protein interaksjoner. Dette gjør gjennomføringen av strenge vask under renselsen. Likevel, selv om ikke eksplisitt testet, ønsker vi å crosslinking er valgfritt og aktive RNPs kan også gjenopprettes med fysiologiske buffere. Men i dette tilfellet bør potensielle nytt arrangement av proteiner og eller RNAs på målet RNA i lysates tas i betraktning. Omvendt, hvis UV eller andre crosslinking prosedyrer er anvendt (f.eksformaldehyd), integriteten av det bør vurderes som RNA fornedrelse kan føre til redusert utvinning av mRNPs. Dessuten UV-crosslinking er ganske ineffektivt (~ 5%) og enda mindre for proteiner samarbeidsstil double-strandet RNA, som kunne introdusere bias for påvisning av visse klasser av RBPs12. Til slutt, UV bestråling kan også indusere protein-protein og protein-DNA krysskoblinger som bør vurderes for data tolkning45,46. Derfor kan alternativ crosslinking prosedyrer, for eksempel med formaldehyd, også være av spesiell interesse å fange større protein samlinger på mRNAs.

En viktig funksjon av turen er i two-step ASO-baserte rensing prosedyren for å gjenopprette bestemt RNAs, og dermed øke selektivitet og redusere sannsynligheten for rensing co forurensninger. For eksempel, gjelder en bekymring legge biotinylated ASOs direkte til cellen ekstrakter, som kan føre til co rensing av biotin bindende proteiner. Dette er circumvented i tur ved å implementere en første runde med rensing av poly(A) RNAs med covalently kombinert oligo-(dT)25 magnetiske perler, hvilke innrømmer for strenge rensing forhold som RNA-protein interactome fange. Videre poly(A) RNA utvalg fjerner svært rike ncRNAs, for eksempel ribosomal RNAs og tRNAs, og dermed reduserer kompleksiteten i eksempelet og potensielle kilder for kryss-hybridisering og forurensning. I det andre trinnet, bestemt mRNAs gjenopprettes med biotinylated og endret ASOs som anneal med områder på mRNA målene. Eventuelt kan endrede ASOs også være direkte covalently knyttet til magnetiske perler via et Amin-linker, redusere tilbøyelighet til å fange biotin bindende proteiner. Men i vår erfaring gjenopprettet inkubasjonstiden for poly(A) RNA brøken med ASOs før tilsetning av streptavidin perler mRNPs mer effektivt enn direkte tillegg av ASO-kombinert perler. Gratis oligos er muligens kinetically favoriserte bedre tilgang til sekvenser i strukturerte RNA i forhold til immobilisert oligos. Derfor kovalente koblingen av ASOs til perler før inkubering med prøven kan være skadelig for utvinning av RNA målet og må testes empirisk.

En ulempe med ASO basert metoder er ineffektiv utvinning av noen målet mRNAs. Vi anbefaler derfor evalueringen av flere ASOs som anneal til forskjellige regioner i transkripsjon. Spesielt foreslår vi utformingen av 2-3 ASOs som anneal med sekvenser i 3-UTR eller CDS av mRNA rundt. Hver ASO kan ha en annen effektivitet for gjenvinning av respektive mRNA målet og bør være empirisk testet (figur 2A, B, data ikke vist). På slutten fant vi at ASOs annealing til 3 UTRs utføres bedre sammenlignet med de annealing til CDer. Dette kan skyldes økt tilgjengelighet av bindende områder i UTRs på grunn av fravær av oversette ribosomer, mens ribosomer kan hindre effektiv hybridisering i CDer. Vi har også opplevd at kombinasjonen av flere ASOs kan føre til økt forurensning fra rikelig ikke mål mRNAs og redusert rullegardin effektivitet. I alle fall selektivitet av den valgte oligos styres av konkurransen eksperimenter (f.eks., tillegg av konkurrerende oligos).

Ytterligere bekymring er knyttet til potensielle kryss-hybridisering med urelaterte RNAs, som observerte vi at selv delvis hybridisering med andre mRNAs kan føre til utvinning av at mRNA (figur 2C). For å vurdere hensiktsmessigheten av de designet ASOs, anbefaler vi derfor utføre innledende i vitro testing med totalt RNAs å optimalisere saltkonsentrasjoner og vask temperatur av buffere. Vask av streptavidin-kombinert magnetiske perler i buffere som inneholder 150 mM NaCl ved 55 ° C gir best i våre hender, men vi anbefaler uavhengige tester av vilkårene for hver designet ASO. Merke, fant vi at alle ASOs valgt i vitro eksperimenter (figur 2D) var riktig for å fange den respektive mRNA mål krysskoblet celle ekstrakter (Figur 3), videre substantiating gyldigheten av på vitro testing. Foruten utformer egnet ASOs mRNA fangst, kan flere faktorer påvirke selektivitet. Derfor kan omfattende blokkerer prosedyrer med BSA og/eller tRNA i henhold til perle type spesifikasjonene hindre uspesifikke binding til perler. For ytterligere å redusere uspesifikke opptaket av proteiner, anbefaler vi også bruk av Lo-binde rør, spesielt når du arbeider med lave mengder prøver.

Vanligvis kan turen utfyller tidligere etablert tilnærminger til å fange RNAs med ASOs. For eksempel, ble ikke-koding RNA Xist isolert med bundet proteiner fra kjernefysiske ekstrakter avledet fra 200-800 millioner UV krysskoblet celler ved hjelp av en rekke lenge (90-mer) biotinylated DNA oligonucleotides som dekket hele utskrift 34,35. Imidlertid valgt fliser tilnærming kan bli problematisk i lys av det store potensialet for kryss-hybridisering med urelaterte RNAs, og den kan ikke brukes til å velge bestemte transkripsjon, f.eks., alternativt skjøtes skjemaer. Nylig utviklet låst nukleinsyre (LNA) eller DNA ASO mixmers ble covalently knyttet til en magnetisk harpiks gjenopprette i vitro transkripsjon eller svært uttrykt ribosomal RNAs fra celle-fri ekstrakter; men ble det ikke testet for gjenvinning av i vivo dannet mRNA protein komplekser36. I lys av økt anerkjennelse av post-transcriptional genet kontroll av RBPs og ncRNA tror vi at turen er en nyttig metode for å undersøke komposisjon og dynamikken i RNP komplekser i celler på intracellulær og miljømessige signaler og dens innvirkning i helse og sykdom.

Disclosures

Forfatterne ikke avsløre.

Acknowledgments

Vi er takknemlige til Dr. Jonathan Hall og Mauro Zimmermann (ETH Zürich) for syntese av PFK2 og cep-1 ASOs, Dr. Maikel Wouters for design av p27/CDKN1B ASOs og Dr. Rafal Ciosk (Friedrich Miescher Institute for biomedisinsk forskning, Basel) for anti-GLD-1 antistoffer. Dette arbeidet ble støttet av bioteknologi og Biological Sciences Research Council (BB/K009303/1) og en Royal Society Wolfson forskning Merit Award (WM170036) til A.P.G.

Materials

Name Company Catalog Number Comments
MaxQ 5000 Large Incubated and Refrigerated Orbital Shaker Thermo Fisher Scientific SHKE5000-8CE Floor shaker to grow yeast cells
BBD 6220 Thermo Fisher Scientific CO2 incubator to grow human cells
Sonicator Soniprep150 MSE MSS150.CX4.5 Sonicator/cell disruptor. Used to shear DNA in human cell lysates
Stratalinker 1800 Stratagene Stratalinker to expose cells to UV light at 254 nm
Tissue Lyser Qiagen RETSCH MM200 Device to mechanically disrupt yeast cells
Refrigerated Centrifuge Eppendorf 5810R Centrifuge to spin down cells, lysates
Shaking incubator, Thriller Peqlab Thermoshaker for 1.5 mL tubes
Glass beads 0.5mm Stratech Scientific Limited 11079105 Lysis of yeast cells
Nylon Filter, 0.41 μm Millipore NY4104700 Collection of yeast cells
Millex-HA Filter, 0.45 µm EMD Millipore SLHA02510 Filter to clear nematode lysate
Eppendorf LoBind microcentrifuge tubes Protein 1.5 mL Sigma-Aldrich 22431081 Minimise protein loss
2 mL microfuge tube Ambion AM12425 Yeast extract preparation and other applications
5 mL tube Thermo Fisher Scientific 129A Collection of HEK293 cell lysate
15 mL tube Sarstedt 62.547.254 Collection C. elegans
50 mL plastic tube Sarstedt 62.554.502 Collection yeast cells
DMEM, high glucose, pyruvate Thermo Fisher Scientific 41966 Media for culturing HEK293 cells
Penicillin-Streptomycin Sigma-Aldrich P4333 Used to supplement cell culture media to control bacterial contamination
Fetal Bovine Serum (FBS) Sigma-Aldrich F7524 Used to supplement cell culture media
Lipofectamine 2000 Thermo Fisher Scientific 11668027 Transfection reagent
RQ1 RNase-Free DNase Promega M6101 DNAse I to degrade DNA from cell lysate
RNasin Plus RNase Inhibitor Promega N2611 RNase inhibitor to avoid RNA degradation
cOmplete, Mini, EDTA-free Protease Inhibitor Cocktail Roche 11836170001 Protease inhibitor cocktail to avoid protein degradation
Dynabeads Oligo (dT)25 Thermo Fisher Scientific 61011 Magnetic beads required for the first step of mRNA-protein complex purification
Dynabeads M-280 Streptavidin Thermo Fisher Scientific 11205D Magnetic beads required for the second step of mRNA-protein complex purification
E. coli tRNA Sigma-Aldrich 10109550001 transfer RNA from E. coli used for blocking streptavidin beads and avoid unsepecific interactions
Quick Start Bradford 1x Dye Reagent BioRad 5000205 To determine protein concentration within lysates, using BSA as reference
Bovine Serum Albumin Sigma A7906-100G Used to perform the standard curve that will be used as reference for protein concentration determination
mouse anti-Act1 MP Biomedicals 869100 Antibody for detection of yeast actin in Western blot (1:2,500)
mouse anti-Act1 Sigma A1978 Antibody for detection of human actin in Western blot (1:2,000)
mouse anti-HuR Santa Cruz sc-5261 Antibody for detection of HuR in Western blot (1:500)
mouse anti–CYC-1 Invitrogen 456100 Antibody for detection of Cyc-1 in Western blot (1:1,000)
peroxidase anti-peroxidase soluble complex Sigma P1291 Detection of Pfk2:TAP in Western blot (1:5,000)
HRP-conjugated sheep anti-mouse IgG Amersham NXA931 HRP-coupled secondary antibody

DOWNLOAD MATERIALS LIST

References

  1. Mitchell, S. F., Parker, R. Principles and properties of eukaryotic mRNPs. Molecular Cell. 54, (4), 547-558 (2014).
  2. Iadevaia, V., Gerber, A. P. Combinatorial Control of mRNA Fates by RNA-Binding Proteins and Non-Coding RNAs. Biomolecules. 5, (4), 2207-2222 (2015).
  3. McHugh, C. A., Russell, P., Guttman, M. Methods for comprehensive experimental identification of RNA-protein interactions. Genome Biology. 15, (1), 203 (2014).
  4. Matia-González, A. M., Gerber, A. P. Ch. 14. Fungal RNA Biology. Sesma, A., von der Haar, T. Springer. 347-370 (2014).
  5. Tsvetanova, N. G., Klass, D. M., Salzman, J., Brown, P. O. Proteome-wide search reveals unexpected RNA-binding proteins in Saccharomyces cerevisiae. PLoS One. 5, (9), (2010).
  6. Castello, A., et al. Insights into RNA biology from an atlas of mammalian mRNA-binding proteins. Cell. 149, (6), 1393-1406 (2012).
  7. Baltz, A. G., et al. The mRNA-bound proteome and its global occupancy profile on protein-coding transcripts. Molecular Cell. 46, (5), 674-690 (2012).
  8. Castello, A., et al. System-wide identification of RNA-binding proteins by interactome capture. Nature Protocols. 8, (3), 491-500 (2013).
  9. Liao, Y., et al. The Cardiomyocyte RNA-Binding Proteome: Links to Intermediary Metabolism and Heart Disease. Cell Reports. 16, (5), 1456-1469 (2016).
  10. Liepelt, A., et al. Identification of RNA-binding Proteins in Macrophages by Interactome Capture. Molecular Cell Proteomics. 15, (8), 2699-2714 (2016).
  11. Conrad, T., et al. Serial interactome capture of the human cell nucleus. Nature Communications. 7, 11212 (2016).
  12. Matia-Gonzalez, A. M., Laing, E. E., Gerber, A. P. Conserved mRNA-binding proteomes in eukaryotic organisms. Nature Structural and Molecular Biology. 22, (12), 1027-1033 (2015).
  13. Mitchell, S. F., Jain, S., She, M., Parker, R. Global analysis of yeast mRNPs. Nature Structural and Molecular Biology. 20, (1), 127-133 (2013).
  14. Beckmann, B. M., et al. The RNA-binding proteomes from yeast to man harbour conserved enigmRBPs. Nature Communications. 6, 10127 (2015).
  15. Wessels, H. H., et al. The mRNA-bound proteome of the early fly embryo. Genome Research. 26, (7), 1000-1009 (2016).
  16. Sysoev, V. O., et al. Global changes of the RNA-bound proteome during the maternal-to-zygotic transition in Drosophila. Nature Communications. 7, 12128 (2016).
  17. Despic, V., et al. Dynamic RNA-protein interactions underlie the zebrafish maternal-to-zygotic transition. Genome Research. 27, (7), 1184-1194 (2017).
  18. Zhang, Z., et al. UV crosslinked mRNA-binding proteins captured from leaf mesophyll protoplasts. Plant Methods. 12, 42 (2016).
  19. Reichel, M., et al. In Planta Determination of the mRNA-Binding Proteome of Arabidopsis Etiolated Seedlings. Plant Cell. 28, (10), 2435-2452 (2016).
  20. Koster, T., Marondedze, C., Meyer, K., Staiger, D. RNA-Binding Proteins Revisited - The Emerging Arabidopsis mRNA Interactome. Trends Plant Sciences. 22, (6), 512-526 (2017).
  21. Hamasaki, K., Killian, J., Cho, J., Rando, R. R. Minimal RNA constructs that specifically bind aminoglycoside antibiotics with high affinities. Biochemistry. 37, (2), 656-663 (1998).
  22. Bachler, M., Schroeder, R., von Ahsen, U. StreptoTag: a novel method for the isolation of RNA-binding proteins. RNA. 5, (11), 1509-1516 (1999).
  23. Vazquez-Pianzola, P., Urlaub, H., Rivera-Pomar, R. Proteomic analysis of reaper 5' untranslated region-interacting factors isolated by tobramycin affinity-selection reveals a role for La antigen in reaper mRNA translation. Proteomics. 5, (6), 1645-1655 (2005).
  24. Hartmuth, K., Vornlocher, H. P., Luhrmann, R. Tobramycin affinity tag purification of spliceosomes. Methods Molecular Biology. 257, 47-64 (2004).
  25. Beach, D. L., Keene, J. D. Ribotrap : targeted purification of RNA-specific RNPs from cell lysates through immunoaffinity precipitation to identify regulatory proteins and RNAs. Methods Molecular Biology. 419, 69-91 (2008).
  26. Slobodin, B., Gerst, J. E. A novel mRNA affinity purification technique for the identification of interacting proteins and transcripts in ribonucleoprotein complexes. RNA. 16, (11), 2277-2290 (2010).
  27. Slobodin, B., Gerst, J. E. RaPID: an aptamer-based mRNA affinity purification technique for the identification of RNA and protein factors present in ribonucleoprotein complexes. Methods Molecular Biology. 714, 387-406 (2011).
  28. Yoon, J. H., Gorospe, M. Identification of mRNA-Interacting Factors by MS2-TRAP (MS2-Tagged RNA Affinity Purification). Methods Molecular Biology. 1421, 15-22 (2016).
  29. Leppek, K., Stoecklin, G. An optimized streptavidin-binding RNA aptamer for purification of ribonucleoprotein complexes identifies novel ARE-binding proteins. Nucleic Acids Research. 42, (2), 13 (2014).
  30. Blencowe, B. J., Sproat, B. S., Ryder, U., Barabino, S., Lamond, A. I. Antisense probing of the human U4/U6 snRNP with biotinylated 2'-OMe RNA oligonucleotides. Cell. 59, (3), 531-539 (1989).
  31. Lingner, J., Cech, T. R. Purification of telomerase from Euplotes aediculatus: requirement of a primer 3' overhang. Proceedings of the National Academy of Sciences U S A. 93, (20), 10712-10717 (1996).
  32. Upadhyay, A., Dixit, U., Manvar, D., Chaturvedi, N., Pandey, V. N. Affinity capture and identification of host cell factors associated with hepatitis C virus (+) strand subgenomic RNA. Molecular Cell Proteomics. 12, (6), 1539-1552 (2013).
  33. Imig, J., et al. miR-CLIP capture of a miRNA targetome uncovers a lincRNA H19-miR-106a interaction. Nature Chemical Biology. 11, (2), 107-114 (2015).
  34. Chu, C., et al. Systematic discovery of Xist RNA binding proteins. Cell. 161, (2), 404-416 (2015).
  35. McHugh, C. A., et al. The Xist lncRNA interacts directly with SHARP to silence transcription through HDAC3. Nature. 521, (7551), 232-236 (2015).
  36. Rogell, B., et al. Specific RNP capture with antisense LNA/DNA mixmers. RNA. 23, (8), 1290-1302 (2017).
  37. Matia-Gonzalez, A. M., Iadevaia, V., Gerber, A. P. A versatile tandem RNA isolation procedure to capture in vivo formed mRNA-protein complexes. Methods. 93-100 (2017).
  38. Gruber, A. R., Lorenz, R., Bernhart, S. H., Neubock, R., Hofacker, I. L. The Vienna RNA websuite. Nucleic Acids Research. 36, (Web Server issue), Available from: http://rna.tbi.univie.ac.at/cgi-bin/RNAWebSuite/RNAfold.cgi W70-W74 (2008).
  39. Kalendar, R., Khassenov, B., Ramankulov, Y., Samuilova, O., Ivanov, K. I. FastPCR: An in silico tool for fast primer and probe design and advanced sequence analysis. Genomics. 109, (3-4), Available from: http://primerdigital.com/tools/PrimerAnalyser.html 312-319 (2017).
  40. Altschul, S. F., Gish, W., Miller, W., Myers, E. W., Lipman, D. J. Basic local alignment search tool. Journal of Molecular Biology. 215, (3), 403-410 (1990).
  41. Stiernagle, T. Maintenance of C. elegans. WormBook. 1-11 (2006).
  42. Kedde, M., et al. A Pumilio-induced RNA structure switch in p27-3' UTR controls miR-221 and miR-222 accessibility. Nature Cell Biology. 12, (10), 1014-1020 (2010).
  43. Schumacher, B., et al. Translational repression of C. elegans p53 by GLD-1 regulates DNA damage-induced apoptosis. Cell. 120, (3), 357-368 (2005).
  44. Ziegeler, G., et al. Embryonic lethal abnormal vision-like HuR-dependent mRNA stability regulates post-transcriptional expression of cyclin-dependent kinase inhibitor p27Kip1. Journal of Biological Chemistry. 285, (20), 15408-15419 (2010).
  45. Itri, F., et al. Femtosecond UV-laser pulses to unveil protein-protein interactions in living cells. Cellular and Molecular Life Sciences. 73, (3), 637-648 (2016).
  46. Zhang, L., Zhang, K., Prandl, R., Schoffl, F. Detecting DNA-binding of proteins in vivo by UV-crosslinking and immunoprecipitation. Biochemical and Biophysical Research Communications. 322, (3), 705-711 (2004).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please sign in or create an account.

    Usage Statistics