Modifica di vettori di espressione di Baculovirus per produrre secreti proteine vegetali nelle cellule di insetto

JoVE Journal
Biochemistry

Your institution must subscribe to JoVE's Biochemistry section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Qui, presentiamo i protocolli per l'utilizzazione del insetto cella e baculovirus proteina espressione sistema per produrre grandi quantità di proteine vegetali secernuta per cristallizzazione della proteina. Un vettore di espressione di baculovirus è stato modificato con GP67 o insetto hemolin peptide di segnale per espressione di secrezione della proteina vegetale in cellule di insetto.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Chakraborty, S., Trihemasava, K., Xu, G. Modifying Baculovirus Expression Vectors to Produce Secreted Plant Proteins in Insect Cells. J. Vis. Exp. (138), e58283, doi:10.3791/58283 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

È stata una sfida per gli scienziati di esprimere proteine eucariotiche secretive ricombinanti per studi strutturali e biochimiche. Il sistema di espressione di baculovirus-mediata delle cellule di insetto è uno dei sistemi utilizzati per esprimere proteine secretorie eucariotiche ricombinante con alcune modificazioni post-traduzionali. Le proteine secretorie devono essere instradati attraverso le vie secretive per glicosilazione della proteina, la formazione di legami disolfuro e altre modificazioni post-traduzionali. Per migliorare l'espressione delle cellule dell'insetto esistente di proteine secretorie vegetali, un vettore di espressione di baculovirus viene modificato con l'aggiunta di sia un GP67 o una sequenza del peptide segnale hemolin tra il promotore e il multiplo-clonazione siti. Questo sistema di nuova concezione modificate vettoriale prodotto con successo una resa elevata di proteine recettori solubili ricombinante pianta secreta di Arabidopsis thaliana. Due delle proteine espresse pianta, domini extracellulari dei recettori di membrana plasmatica di Arabidopsis TDR e PRK3, sono state cristallizzate per studi cristallografici dei raggi x. Il sistema vector modificate è un strumento migliorato che potenzialmente può essere utilizzato per l'espressione di proteine ricombinanti secretive nel Regno animale pure.

Introduction

È indispensabile per un laboratorio di ricerca essere in grado di produrre grandi quantità di proteine ricombinanti omogenei per le caratterizzazioni biochimiche e biofisiche, soprattutto per studi cristallografici dei raggi x. Ci sono molti sistemi di espressione eterologa affermati quali Escherichia coli, lieviti, cellule di insetto, cellule di mammifero, cellule vegetali, ecc tra loro, il sistema di espressione di baculovirus-mediata delle cellule di insetto è uno dei più comunemente utilizzato tecniche per produrre grandi quantità di proteine eucariotiche ricombinanti grandi strutturalmente piegate per proteina cristallizzazione1.

I vettori di espressione del sistema di espressione di baculovirus sono progettati per contenere una forte polyhedrin o promotore di P10 per produrre un rendimento elevato di proteine intracellulari ricombinanti2,3. Per rendere un baculovirus ricombinanti, il gene di interesse è clonato in un insetto vettore contenente il locus polyhedrin (polh) del genoma di multi-nucleopolyhedroviral Autographa californica . Il costrutto risultante è quindi sequenziato e verificato il suo telaio di lettura aperto corretta (ORF). Il costrutto corretto è quindi introdotto nella cellula ospite dell'insetto attraverso il processo di trasfezione. Il gene di interesse viene inserito nel genoma virale di ricombinazione omologa. Questo evento provoca la produzione del genoma virale ricombinante, che poi replicati per produrre ricombinante germogliato virus particelle1.

Le cellule di insetto che sono più comunemente utilizzate nel sistema di espressione sono Sf9 e alta cinque celle (Hi5). SF9 cellule sono un isolato clonale di Sf21, derivati dalle cellule ovariche pupale di Spodoptera frugiperda, e Hi5 cellule sono un isolato clonale derivato da parentale Trichoplusia ni ovarico delle cellule linea TN-3684,5. Co-transfezioni, amplificazione di virus e le analisi di placca sono condotto su cellule Sf9, mentre le cellule Hi5 in genere sono selezionate per produrre maggiori quantità di proteine ricombinanti6. Vale la pena notare che le cellule di Hi5 non sono adatte per la generazione e l'amplificazione della progenie di virus a causa della loro tendenza a produrre virus mutante. Tradizionalmente, una gamma di temperatura di 25-30 ° C è considerata di essere buono per la coltivazione di cellule di insetto. Tuttavia, è stato segnalato che il 27-28 ° C è la temperatura ottimale per l'insetto cella crescita e infezione7,8.

L'introduzione di una sequenza di segnale forte precede il gene è necessario per l'alta espressione di proteine secrete. La sequenza del segnale in modo efficiente guiderebbe la proteina ricombinante tradotta in reticolo endoplasmico per la secrezione della proteina e modificazioni post-traduzionali necessarie per il corretto ripiegamento e stabilizzazione3. Sequenze di peptide segnale, come il baculovirus avvolgono proteina GP64/67, honeybee melittin e altri, sono stati scelti per facilitare l'espressione di proteine ricombinanti secretive in baculovirus-mediata espressione sistemi3. L'introduzione del peptide segnale di GP67 ha dimostrato di migliorare la resa di espressione di una proteina ricombinante secreta, in confronto con il peptide di segnale intrinseco del gene bersaglio9. Hemolin è una proteina di emolinfa della falena gigante seta Hyalophora cecropia, indotta a seguito di infezione di batteri10. A causa del relativamente alto livello di espressione indotta, la sequenza del peptide di segnale del gene utilizzabile per mediare l'espressione di secrezione delle proteine ricombinanti nel sistema di cellule di insetto baculovirus.

Il a. thaliana Tracheary elemento di differenziazione inibitorio fattore recettore (TDR) e polline del ricevitore della chinasi 3 (PRK3) entrambi appartengono alla famiglia pianta Leucine-rich Repeat Kinase Receptor-like (LRR-RLK) di proteine11,12 . Al fine di studiare la struttura e la funzione di questa famiglia di recettori proteine vegetali, nonché per facilitare la caratterizzazione biochimica e strutturale di altre proteine vegetali secernuta, il sistema di espressione di baculovirus-insetto cella è stato modificato per migliorare la resa di qualità e produzione di proteina. I domini extracellulari di TDR e di PRK3 sono state espresse con successo utilizzando due vettori di espressione modificata nel sistema di espressione di baculovirus-insetto cellule. Entrambi i domini extracellulari delle proteine TDR e PRK3 sono stati cristallizzati. Questo articolo segnala l'espressione e purificazione di grandi quantità di proteine ricombinanti vegetali secrete con vettori di espressione di baculovirus modificate due incorporando un GP67 o una sequenza di segnale hemolin tra il promotore e clonazione più siti.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Nota: Viene utilizzato un sistema di insetto cella/baculovirus con vettori di espressione modificate per l'espressione della proteina secretoria pianta e cristallizzazione.

1. modifica di un vettore di espressione di Baculovirus con il Peptide di segnale GP67 per espressione di secrezione della proteina vegetale

  1. Sintetizzare un frammento di DNA contenente un 5' BglII taglio sito13, la sequenza di segnale di secrezione GP67 e un sito multi-clonazione con NotI, BamHI, EcoRI, StuI, SalI, SpeI, XbaI, PstI e XhoI (Figura 1A).
    Nota: Poiché sia BglII e BamHI digerito DNA ha provocato la stessa estremità adesive, il vettore linearizzato può legare per il frammento di DNA digerito, mentre BglII sia BamHI siti nella sequenza di legatura ricotto saranno mutati ad una sequenza che non è spaccabili da BglII o BamHI14.
  2. Digest 4 µ g di DNA con BglII e XhoI e 4 µ g di un vettore di espressione del DNA con BamHI e XhoI14. Mescolare 10 unità di ciascun enzima di restrizione con il DNA in un 1 x concentrazione tampone di reazione (acetato di potassio 50 mM, 20 mM Tris-acetato, acetato di magnesio 10 mM e 100 µ g/mL BSA, pH 7.9 a 25 ° C) e incubare la miscela a 37 ° C per 4 h.
    1. Purificare il frammento di DNA asportato e il vettore linearizzato DNA da un DNA estrazione gel kit15.
  3. Mix 100 ng del vettore linearizzato DNA con 400 ng di DNA digerito frammento in una miscela di reazione di legatura 10-µ l contenente 1x tampone di reazione T4 DNA ligasi (50 mM Tris-HCl 10 mM MgCl2, ATP di 1 mM e 10 mM DTT, pH 7.5 a 25 ° C) e 5 unità di T4 DNA ligasi. Incubare la miscela di reazione a 16 ° C per 16 h.
  4. Trasformare 5 µ l di miscela la legatura in 100 µ l di cellule competenti DH5α seguendo un protocollo standard di trasformazione e selezionare le colonie risultante su una piastra di agar ampicillina-LB16. Prendere 5-10 colonie e crescere ogni colonia in 2 mL di terreno LB contenente 100 ampicillina µ g/mL a 220 giri/min e 37 ° C in un incubatore d'agitazione per 16 h.
  5. Estrarre ogni DNA plasmidico con un DNA miniprep kit17 e confermare i cloni di sequenziamento del DNA con un primer AGTATTTTACTGTTTTCGTAACAG.
  6. PCR-amplificare il gene TDR di a. thaliana frammento codifica residui 30-642 da un gene sintetico TDR costruire (forward primer: CATG GCGGCCGC CTCAAGTTTTCACCTCAACTCTTGTC, reverse primer: GC GGATCC CTA GTG GTG ATG GTG GTG GTG ACCGTCTATATCTGCATTTCCGGC). Amplificare il DNA per 30 cicli in un buffer di reazione della polimerasi del DNA che contiene una miscela del dNTP 0,5 mM, 0,2 µ m di primer, 0.1 µ g di DNA campione, 0,4 mM MgCl2e 1 unità di reazione della polimerasi del DNA.
    1. Per i passaggi del ciclo PCR, impostare la denaturazione iniziale a 95 ° C per 30 s e poi 30 cicli di denaturazione a 95 ° C per 30 s, ricottura a 55 ° C per 30 s e l'estensione a 72 ° C per 1 min, con un'estensione finale a 72 ° C per 5 min.
  7. Digerire il frammento della PCR sia il vettore modificato con gli enzimi di endonucleasi di restrizione NotI e BamHI. Legare il frammento genico con il vettore linearizzato. Mix 100 ng del vettore linearizzato DNA con 400 ng di DNA digerito frammento in una miscela di reazione di legatura 10-µ l contenente tampone di reazione di T4 DNA ligasi e 5 unità di T4 DNA ligasi. Incubare la miscela di reazione a 16 ° C per 16 h.
  8. Trasformare 5 µ l di miscela la legatura in 100 µ l di cellule competenti DH5α seguendo un protocollo standard di trasformazione e selezionare le colonie risultante su una piastra di agar ampicillina-LB16. Confermare il corretti cloni di sequenziamento del DNA.

2. modifica di un vettore di espressione di Baculovirus con il Peptide di segnale Hemolin insetto per espressione di secrezione della proteina vegetale

  1. Sintetizzare un frammento di DNA contenente un 5' BglII taglio sito13, la sequenza di segnale di secrezione dell'insetto hemolin e un sito multi-clonazione con NotI, BamHI, EcoRI, StuI, SalI, SpeI, XbaI, PstI e XhoI (Figura 1B).
  2. Digest 4 µ g di DNA con BglII e XhoI e 4 µ g di un vettore di espressione del DNA con BamHI e XhoI14. Mescolare 10 unità di ciascun enzima di restrizione con il DNA in un 1 x concentrazione tampone di reazione (acetato di potassio 50 mM, 20 mM Tris-acetato, acetato di magnesio 10 mM e 100 µ g/mL BSA, pH 7.9 a 25 ° C) e incubare la miscela a 37 ° C per 4 h.
    1. Purificare il frammento di DNA asportato e il vettore linearizzato DNA da un DNA estrazione gel kit15.
  3. Mix 100 ng del vettore linearizzato DNA con 400 ng di DNA digerito frammento in una miscela di reazione di legatura 10-µ l contenente 1x tampone di reazione T4 DNA ligasi (50 mM Tris-HCl 10 mM MgCl2, ATP di 1 mM e 10 mM DTT, pH 7.5 a 25 ° C) e 5 unità di T4 DNA ligasi. Incubare la miscela di reazione a 16 ° C per 16 h.
  4. Trasformare 5 µ l di miscela la legatura in 100 µ l di cellule competenti DH5α e selezionare le colonie su una piastra di agar di ampicillina-LB. Prendere 5-10 colonie e crescere ogni colonia in un medium LB 2 mL contenente 100 µ g/mL di ampicillina a 220 giri/min e 37 ° C in un incubatore d'agitazione per 16 h.
  5. Estrarre il DNA plasmidico con un DNA miniprep kit17 e confermare i cloni di sequenziamento del DNA con un primer AGTATTTTACTGTTTTCGTAACAG.
  6. PCR-amplificare a. thaliana polline del ricevitore della chinasi 3 (PRK3) gene frammento di codifica residui 20-237 da una costruzione di gene PRK3 sintetica (forward primer: CATG GCGGCCGC CTACAAAACGTTAGTGAATCGGAACC, reverse primer: CGC GGATCC CTA GTG GTG ATG GTG GTG GTG TGAAGGTTTCTCATCGCATTCTATATTC). Amplificare il DNA per 30 cicli in un buffer di reazione della polimerasi del DNA che contiene una miscela del dNTP 0,5 mM, 0,2 µ m di primer, 0.1 µ g di DNA campione, 0,4 mM MgCl2e 1 unità di reazione della polimerasi del DNA.
    1. Per i passaggi del ciclo PCR, impostare la denaturazione iniziale a 95 ° C per 30 s e poi 30 cicli di denaturazione a 95 ° C per 30 s, ricottura a 55 ° C per 30 s e l'estensione a 72 ° C per 30 s all'interno di ogni ciclo e l'estensione finale a 72 ° C per 5 min.
  7. Digerire il frammento della PCR sia il vettore modificato con gli enzimi di endonucleasi di restrizione NotI e BamHI. Legare il frammento genico con il vettore linearizzato. Mix 100 ng del vettore linearizzato DNA con 400 ng di DNA digerito frammento in una miscela di reazione di legatura 10-µ l contenente tampone di reazione di T4 DNA ligasi e 5 unità di T4 DNA ligasi. Incubare la miscela di reazione a 16 ° C per 16 h.
  8. Trasformare 5 µ l di miscela la legatura in 100 µ l di cellule competenti DH5α seguendo un protocollo standard di trasformazione e selezionare le colonie risultante su una piastra di agar ampicillina-LB16. Confermare il corretti cloni di sequenziamento del DNA.

3. produzione e amplificazione di Baculovirus costruisce Harboring la cassetta di espressione di proteine ricombinanti

  1. Uso 100 ng di plasmide costrutto per trasformare 40 µ l di cellule competenti di DH10Bac seguendo il protocollo del baculovirus espressione sistema1. Incubare le piastre di trasformazione a 37 ° C per 48 h.
  2. Prendi due colonie bianchi da ogni piatto di trasformazione, inoculare ogni colonia in 2 mL di terreno LB contenente kanamicina di 50 µ g/mL, 7 µ g/mL Gentamicina e la tetraciclina di 10 µ g/mL. Seguire il protocollo del baculovirus espressione sistema1 per estrarre e verificare la bacmid del DNA. Aliquotare ogni DNA in due tubi con 20 µ l ciascuna e conservare i capillari a-20 ° C.
    Nota: Le operazioni seguenti richiedono un'operazione asettica.
  3. Crescere un monostrato di cellule Sf9 in terreni di coltura con 10% siero bovino fetale (FBS) e 100 µ g/mL (o 100 I.U./mL) antibiotici penicillina-streptomicina a 27 ° C a 80% confluenza in una piastra a 6 pozzetti. Una stima della percentuale di confluenza sulla base della percentuale di area coperta sulla piastra di coltura del tessuto.
  4. Preparare le seguenti soluzioni in due provette da 1,5 mL sterile.
    1. Filmato 1: Per ogni trasfezione, diluire 20 µ l di bacmid DNA in 100 µ l di terreno di coltura cellulare Sf9 senza aggiunte senza antibiotici. Mescolare delicatamente la diluizione, spostando il lato del tubo.
    2. Filmato 2: Per ogni trasfezione, diluire 8 µ l di reagente di transfezione di lipidi in 100 µ l di terreno di coltura cellulare Sf9 senza aggiunte senza antibiotici. Mescolare accuratamente la diluizione pipettando su e giù per 6 x.
  5. Combinare le due soluzioni, mescolarle delicatamente pipettando lentamente su e giù per 3 volte e li Incubare per 20-40 min a temperatura ambiente.
  6. Lavare ogni pozzetto di strato monomolecolare Sf9 cellule 2x con 3 mL di terreno di coltura cellulare Sf9 senza aggiunte senza antibiotici. Per ogni trasfezione, aggiungere 0,8 mL di mezzo di coltura cellulare Sf9 senza aggiunte senza antibiotici in ogni provetta contenente la miscela di lipidi-DNA. Mescolare delicatamente il contenuto delle provette pipettando lentamente su e giù per 3 volte. Aspirare i media di lavaggio dalle piastre e i campioni con la miscela di transfezione di sovrapposizione.
  7. Dopo l'aggiunta della miscela di transfezione, incubare la piastra trasfettata per 5 ore a 27 ° C. Sostituire il supporto di transfezione con il mezzo di coltura cellulare Sf9 completo contenente 10% FBS e 100 µ g/mL (o 100 I.U./mL) antibiotici penicillina-streptomicina. Incubare la piastra trasfettata a 27 ° C per 4 d.
  8. Raccogliere e amplificare il baculovirus ricombinanti.
    1. Raccogliere il surnatante della piastra infetto in una provetta conica sterile di 15 mL dopo 4D di incubazione. Girare il supernatante a 1010 x g per 5 min rimuovere i detriti cellulari. Scartare il pellet e decantare il supernatante in una provetta pulita e conservarla a 4 ° C fino a 1 anno.
      Nota: Questo è il virus di P0. Può essere aliquotati e conservati a-80 ° C per un periodo di tempo più lungo.
    2. Per amplificare ogni virus ricombinante, crescere un monostrato di cellule Sf9 su una zolla di 150 mm fino a 80% confluenza. Aspirare i media dalla piastra, aggiungere 2 mL di virus P0 per l'aderente di cellule alla piastra e incubare la piastra per 1h in un'incubatrice di 27 ° C. Per mescolare il mezzo con le cellule della roccia la piastra ogni 15 min.
      1. Aggiungere 25 mL di media di Grace completo contenente 10% FBS e 100 µ g/mL (o 100 I.U./mL) antibiotici penicillina-streptomicina. Incubare la piastra per 3 d in un'incubatrice di 27 ° C per ottenere il virus di passaggio P1.
    3. Raccogliere il surnatante della piastra infetto in una provetta conica sterile da 50 mL e spin a 1010 x g per 5 min rimuovere i detriti cellulari. Decantare il supernatante in una provetta pulita e conservarla a 4 ° C fino a 1 anno.
      Nota: Il virus P1 può essere aliquotati e conservati a-80 ° C per un periodo di tempo più lungo.
    4. Per amplificare il virus da P1 a P2 passaggio, crescere un monostrato di cellule Sf9 su una zolla di 150 mm fino a 90% confluenza, aspirare il supporto della piastra, aggiungere 2 mL di virus P1 alla piastra e incubare per 1 h in un'incubatrice di 27 ° C.
    5. Ripetere i passaggi da 3.8.2 e 3.8.3 per ottenere i passaggi P2 e P3 dei virus. Non conservare il virus P3 per più di 2 mesi.

4. protein Expression, purificazione con NiNTA e cristallizzazione

  1. Coltura in 1 L di cellule di insetto Hi5 in terreni di coltura con 100 µ g/mL (o 100 I.U./mL) antibiotici penicillina-streptomicina ad una densità di 2 x 106 a 100 giri/min in uno shaker incubatore di 27 ° C. Rotazione verso il basso le cellule a 570 x g per 5 min, decantare il supernatante, risospendere le cellule in 20 mL di recente prodotte P3 virus e tenerlo a temperatura ambiente per 1 h. Agitare delicatamente la bottiglia di spin per risospendere le cellule 1 x ogni 15 min.
  2. Trasferire le cellule a 1 L di antibiotici penicillina-streptomicina cultura media con 100 µ g/mL (o 100 I.U./mL), coltura le cellule a 100 giri/min in uno shaker incubatore di 27 ° C per 72 h. Spin giù le cellule a 1.010 x g per 5 min e raccogliere il surnatante.
  3. Strisce indicatrici di pH di uso regolare il pH del surnatante a 8.0 aggiungendo 0.1 M HCl o NaOH M 0.1 e aggiungere buffer di associazione ad una concentrazione finale, contenente 20 mM di tampone Tris pH 8.0, NaCl 100 mM e imidazolo di 5 mM. Aggiungere una certa quantità di resina NiNTA (10-40 mL) basata sul rendimento stimato della proteina ricombinante His-tag espressa.
    1. Miscelare la soluzione su scalpore magnetico con bassa velocità a 4 ° C per 1 h. lavare la resina ed eluire la proteina associata seguendo la norma NiNTA purificazione protocollo18.
  4. Sottoporre la proteina purificata a scambio ionico e gel cromatografia di filtrazione, così come altri metodi di purificazione di proteine, per ottenere un campione omogeneo.
    Nota: Per il ectodomain TDR, 20 mM Tris, pH 8, NaCl 100 mM sono stati usati come buffer di gel filtrazione. Per il ectodomain di PRK3, 20 mM bis-Tris, pH 6, NaCl 100 mM sono stati usati come il buffer di comodo gel filtrazione.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Come illustrato nella Figura 1, due vettori di espressione del baculovirus pFastBac1 modificate sono stati utilizzati per esprimere le proteine secrete con la GP67 o la sequenza segnale hemolin per sostituire la sequenza segnale intrinseco del gene target. il GP67 virale ed i geni di hemolin dell'insetto sono stati dimostrati per avere i livelli di espressione di alta secrezione nelle cellule. Proteine di fusione con uno di questi due sequenze di segnale si pensano che hanno notevolmente migliorato i livelli di espressione di secrezione. Più siti clonazione (MCS) sono stati costruiti in questi due vettori modificati identici. Un sito di NotI era posto deliberatamente più 5'-lato di MCS, perché NotI ha una sequenza di otto-nucleotide, piuttosto che la sequenza di sei-nucleotide più comune presente in molti altri siti di restrizione. Come tale, un sito di NotI è meno presente nei geni bersaglio rispetto maggior parte altri siti di restrizione, rendendo la digestione di limitazione e la clonazione della maggior parte dei geni bersaglio più fattibili rispetto ad altri siti di restrizione. Clonazione del gene target tra i NotI e un sito di restrizione a valle introdurrà solo tre residui dell'amminoacido, GGR, precede il gene dell'obiettivo.

Il pBac1-GP67 e pBac1-orlo sono stati utilizzati con successo per esprimere i domini extracellulari dei recettori a. thaliana TDR e PRK3, rispettivamente (Figura 2). Dopo le proteine ricombinanti sono state purificate dal NiNTA utilizzando un tag di 6-istidina ingegneria C-terminale, la resa media di proteine era costante intorno a 20 mg/L di cellule di Hi5. La purezza di ogni proteina è vicino o superiore al 50%, esaminato con SDS-PAGE e macchiatura Coomassie.

Le proteine ricombinanti di domini extracellulari di TDR e PRK3 sono stati ulteriormente purificate mediante cromatografia di esclusione di formato (Figura 2). La proteina purificata è stata concentrata a 5 mg/mL e poi sottoposti ad uno screening di cristallizzazione. Le condizioni, che ha prodotto cristalli preliminare di ogni proteina, sono state ottimizzate fino a cristalli proteici con dimensioni maggiori di 20 µm sono stati osservati (Figura 3). Le strutture di cristallo di entrambe le proteine sono stati segnalati11,12.

Figure 1
Figura 1: mappe dei vettori modificate pFastBac1. Le sequenze di DNA mostrate in questi pannelli sono state inserite a valle del promotore polyhedrin del vettore pFastBac1, possedere la sequenza del peptide segnale e i siti clonazione multiple (MCS) per i geni bersaglio. Entrambi i vettori contengono lo stesso MCS. (A), questo pannello mostra una sequenza dei siti clonazione a valle del promotore polyhedrin nel vettore pBac1-GP67. La sequenza di amminoacido del peptide di segnale GP67 tradotta è colorata in rosso. Ogni sito di restrizione unici in MCS è sottolineato, con il nome del sito con l'etichetta sopra. (B), questo pannello mostra una sequenza dei siti clonazione a valle del promotore polyhedrin nel vettore pBac1-Hem. La sequenza di amminoacido del peptide di segnale hemolin tradotta è colorata in rosso. Ogni sito di restrizione unici in MCS è sottolineato, con il nome del sito con l'etichetta sopra. Clicca qui per visualizzare una versione più grande di questa figura.

Figure 2
Figura 2: espressione della proteina con i vettori pFastBac1 modificate nel sistema di cellule di insetto baculovirus. (A) il ectodomain di TDR è stato espresso in cellule di insetto Hi5, purificato mediante cromatografia di esclusione di nichel-affinità e dimensioni (S) e risolto il gel di SDS-PAGE. La resina di nichel è stata lavata una volta con un buffer contenente imidazolo 5mm (lavaggio 1) e una seconda volta con imidazolo 20mm (lavaggio 2). (B) Questa è un'analisi di SDS-PAGE mostrando l'espressione e purificazione di affinità di nichel (NiNTA), così come la cromatografia di esclusione di dimensione del ectodomain di PRK3. Marcatori di peso molecolare (MW) con le dimensioni del corrispondente sono etichettati. Le frecce rosse in ogni pannello denotano le espressioni e le dimensioni previsti di ricombinante TDR e PRK3 ectodomain proteine. Le nature di multi-banda delle proteine espresse sono probabilmente dovuto la glicosilazione eterogenea. Clicca qui per visualizzare una versione più grande di questa figura.

Figure 3
Figura 3: Cristalli di proteine dei domini extracellulari di Arabidopsis thaliana TDR e PRK3. (A), questo pannello mostra i cristalli della proteina dei domini extracellulari di a. thaliana TDR. (B) questo pannello mostra i cristalli della proteina dei domini extracellulari di a. thaliana PRK3. Sotto ogni immagine viene visualizzata una barra di scala. Clicca qui per visualizzare una versione più grande di questa figura.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

L'eterogeneità nella dimensione e nella stabilità delle migliaia di proteine presenti nei sistemi biologici, è spesso empirico per una ricerca di laboratorio per decidere quale sistema di espressione eterologa deve essere scelto per l'espressione di una proteina specifica. Il sistema di espressione di e. coli è spesso la prima scelta per l'espressione della proteina a causa del breve ciclo di vita dei batteri, basso costi dei terreni di coltura e relativa facilità di scalare fino19. Per l'espressione di grandi proteine eucariotiche con dimensioni più di 60 kDa, tuttavia, utilizzando il e. coli sistema si traduce spesso in proteine insolubili nel corpo di inclusione o aggregazione20. Per l'espressione di quelle proteine difficile e per altre proteine secrete, il sistema di espressione di baculovirus-insetto cella può essere più vantaggioso di E. coli. Soprattutto quando esprimere proteine eucariotiche secrete, questo sistema di espressione delle cellule modificate di baculovirus-insetto potrebbe essere una scelta preferita.

Molte proteine eucariotiche secrete, comprese proteine vegetali secreto, bisogno complessa glicosilazione, la formazione di disolfuro e altre modificazioni post-traduzionali durante il protein folding e secrezione21. Sistemi di e. coli non hanno il macchinario cellulare per elaborare le modifiche complesse necessarie per molte delle proteine eucariotiche22. Lievito è un sistema relativamente più avanzata glicosilazione oltre Escherichia coli23. Tuttavia, per l'espressione delle proteine secrete in piante e specie negli eucarioti superiori, il sistema di baculovirus-insetto cella presenta un vantaggio significativo. Poiché glicosilazione colpisce il protein folding e stabilità24, molte delle proteine secrete ricombinante espressa nei sistemi di e. coli e di lievito hanno una bassa resa e tendono ad aggregare, presumibilmente a causa della piegatura della proteina non corretta. Il sistema di baculovirus-insetto è stato modificato per migliorare la glicosilazione della proteina, che lo rende un sistema ideale per l'espressione di proteine eucariotiche secrete25. In questo studio, sia la GP67 e la hemolin segnale peptidi sono stati utilizzati con successo per guidare l'espressione di secrezione di due proteine recettori di pianta per la cristallizzazione di proteine. Con questi studi in mente, però, la scelta di entrambi peptide di segnale è un passo fondamentale, e ha bisogno di più sistematici studi comparativi con un set di geni bersaglio di diversi organismi.

L'idea di usando i peptidi di segnale sia GP67 e hemolin per migliorare l'espressione della proteina secrezione era guidato dai rendimenti di alta espressione di entrambi i geni. Tuttavia, se la secrezione della proteina e la modificazione post traduzionale macchinari dell'host espressione sono sovraccaricati con proteine ricombinanti espresse, le proteine ricombinanti secrete non siano adeguate modifiche, soprattutto glicosilazione. Entrambi i vettori modificati sono stati utilizzati per esprimere con successo numerosi pianta proteine secretorie11,12,26, molti dei quali tendono ad aggregare, che è probabilmente dovuto la glicosilazione errata o inadeguata. Pertanto, per l'espressione di quelle proteine difficile, entrambe sequenze peptidiche forte e debole segnale devono essere testati e la qualità delle proteine ricombinanti espresse deve essere confrontato. Tenete a mente che una sequenza del peptide di segnale debole si abbassa il rendimento complessivo della proteina; Tuttavia, può dare il macchinario di secrezione dell'host espressione di capacità sufficiente per elaborare la secrezione della proteina e modifiche.

Oltre l'espressione di proteine eterologhe secrete in cellule di insetto, le cellule di mammifero e sistemi di espressione delle cellule vegetali sono stati utilizzati con successo nella sovraespressione di ricombinante mammifero e proteine vegetali, rispettivamente27, 28,29. In confronto i sistemi eterologhi, l'espressione endogena vicino condizione di cellula umana o le proteine vegetali secreto avrà i machineries modifica quasi nativa in cellule dell'ospite per produrre proteine ben piegati. L'avvertenza di utilizzare il sistema di espressione quasi nativa è che le proteine ricombinanti espresse possono interferire con la funzione fisiologica delle cellule, che possono potenzialmente avere effetti negativi sulla resa finale espressione delle proteine.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Gli autori non hanno nulla a rivelare.

Acknowledgments

Questo lavoro è stato supportato dai nuovi fondi avvio facoltà da North Carolina State University per Guozhou Xu.

Materials

Name Company Catalog Number Comments
Incubator shaker VWR Model Excella E25 27 oC
Incubator VWR Model 2005 27 oC
Centrifuge BECKMAN Model J-6 with a swing bucket rotor
Herculase II Fusion DNA Polymerase Agilent 600677-51 For PCR amplification of DNA
Thermal Cycler BIO-RAD Model C1000 Touch For PCR amplification of DNA
Incubator shaker New Brunswick Scientific Model I 24 For growing baceria culture
Customer DNA synthesis GENSCRIPT
BamHI (HF) New England Biolabs R3136S Restriction Endonuclease
BglII New England Biolabs R0144S Restriction Endonuclease
NotI (HF) New England Biolabs R3189S Restriction Endonuclease
XhoI New England Biolabs R0146S Restriction Endonuclease
T4 DNA ligase New England Biolabs M0202T DNA ligation
QIAquick Gel Extraction Kit Qiagen 28704 DNA purification from Agorase gel
QIAprep Spin Miniprep Kit Qiagen 27104 Plasmid DNA purification from bacteria culture
Agarose Thermo Fisher Scientific 15510-019 For DNA gel electropherosis
MAX Efficiency DH5α competen cell Invitrogen 18-258-012 For transformation of DNA ligation mixture
Lennox L LB Broth Research Product International Corp. L24066-5000.0 For making bacteria culture
Ampicillin sodium salt Thermo Fisher Scientific 11593-019 Antibiotics
Kanamycin Sulfate Thermo Fisher Scientific 15160-054 Antibiotics
Tetracycline Thermo Fisher Scientific 64-75-5 Antibiotics
Gentamicin Thermo Fisher Scientific 15710-064 Antibiotics
MAX Efficiency DH10Bac competent cells Thermo Fisher Scientific 10361-012 For making bacmid DNA
S.O.C. Medium Thermo Fisher Scientific 15544-034 For DNA transformation
CellFECTIN II Reagent Thermo Fisher Scientific 10362-101 Insect cell transfection reagent
Bac-to-Bac Expression System Thermo Fisher Scientific 10359-016 Baculovirus-insect cells expression kit
Bluo-gal Thermo Fisher Scientific 15519-028 For isolation of recominant Bacmid DNA
IPTG Thermo Fisher Scientific 15529-019 For isolation of recominant Bacmid DNA
pFastBac1 Thermo Fisher Scientific 10360014 Baculorirus expression vector
Sf9 cells Thermo Fisher Scientific 11496015 Sf9 monolayer cells
Hi5 cells Thermo Fisher Scientific B85502 High Five insect cells
Grace’s insect medium, unsupplemented Thermo Fisher Scientific 11595030 Sf9 cell transfection minimum medium
Grace’s insect medium, supplemented Thermo Fisher Scientific 11605102 Sf9 monolayer cell culture complete medium
Sf-900 II SFM Thermo Fisher Scientific 10902104 Sf9 suspension cell culture medium without FBS
Express Five SFM Thermo Fisher Scientific 10486025 Hi5 cell culture medium
Penicillin-Streptomycin Thermo Fisher Scientific 15140122 100 ml (10,000 I.U./ml)
L-Glutamine (200 mM) Thermo Fisher Scientific 25030081 100 ml
FBS Certified Thermo Fisher Scientific 16000-044 500 ml
6-well plates Thermo Fisher Scientific 08-772-1B Flat-bottom
150 mm plates Thermo Fisher Scientific 353025 100/case
1.5 ml Microcentrifuge Tubes USA Scientific 1415-2500 500 tubes/bag
15 ml conical screw cap centrifuge tubes USA Scientific 1475-0511 25 tubes/bag
50 ml conical screw cap centrifuge tubes USA Scientific 1500-1211 25 tubes/bag
Ni-NTA Superflow Qiagen 30430 NiNTA resin
pH-indicator strips EMD Millipore Corporation 1.09535.0001 pH 0 - 14

DOWNLOAD MATERIALS LIST

References

  1. Contreras-Gomez, A., Sanchez-Miron, A., Garcia-Camacho, F., Molina-Grima, E., Chisti, Y. Protein production using the baculovirus-insect cell expression system. Biotechnology Progress. 30, 1-18 (2014).
  2. Khan, S., Ng, M. L., Tan, Y. J. Expression of the severe acute respiratory syndrome coronavirus 3a protein and the assembly of coronavirus-like particles in the baculovirus expression system. Methods in Molecular Biology. 379, 35-50 (2007).
  3. Possee, R. D., King, L. A. Baculovirus Transfer Vectors. Methods in Molecular Biology. 1350, 51-71 (2016).
  4. Vaughn, J. L., Goodwin, R. H., Tompkins, G. J., McCawley, P. The establishment of two cell lines from the insect Spodoptera frugiperda (Lepidoptera; Noctuidae). In Vitro. 13, 213-217 (1977).
  5. Hink, W. F. Established insect cell line from the cabbage looper, Trichoplusia ni. Nature. 226, 466-467 (1970).
  6. Davis, T. R., et al. Comparative recombinant protein production of eight insect cell lines. In Vitro Cellular & Development Biology - Animal. 29A, 388-390 (1993).
  7. Wickham, T. J., Nemerow, G. R. Optimization of growth methods and recombinant protein production in BTI-Tn-5B1-4 insect cells using the baculovirus expression system. Biotechnology Progress. 9, 25-30 (1993).
  8. Davis, T. R., Trotter, K. M., Granados, R. R., Wood, H. A. Baculovirus expression of alkaline phosphatase as a reporter gene for evaluation of production, glycosylation and secretion. Nature Biotechnology. 10, 1148-1150 (1992).
  9. Murphy, C. I., et al. Enhanced expression, secretion, and large-scale purification of recombinant HIV-1 gp120 in insect cell using the baculovirus egt and p67 signal peptides. Protein Expression and Purification. 4, 349-357 (1993).
  10. Sun, S. C., Lindstrom, I., Boman, H. G., Faye, I., Schmidt, O. Hemolin: an insect-immune protein belonging to the immunoglobulin superfamily. Science. 250, 1729-1732 (1990).
  11. Li, Z., Chakraborty, S., Xu, G. Differential CLE peptide perception by plant receptors implicated from structural and functional analyses of TDIF-TDR interactions. PLoS One. 12, e0175317 (2017).
  12. Chakraborty, S., Pan, H., Tang, Q., Woolard, C., Xu, G. The Extracellular Domain of Pollen Receptor Kinase 3 is structurally similar to the SERK family of co-receptors. Scientific Reports. 8, 2796 (2018).
  13. Khorana, H. G. Total synthesis of a gene. Science. 203, 614-625 (1979).
  14. Bahl, C. P., Marians, K. J., Wu, R. A general method for inserting specific DNA sequences into cloning vehicles. Gene. 1, 81-92 (1976).
  15. Xu, W., Zhang, Y. Isolation and Characterization of Vaccine-Derived Polioviruses, Relevance for the Global Polio Eradication Initiative. Methods in Molecular Biology. 1387, 213-226 (2016).
  16. Hanahan, D. Studies on transformation of Escherichia coli with plasmids. Journal of Molecular Biology. 166, 557-580 (1983).
  17. Zhang, S., Cahalan, M. D. Purifying plasmid DNA from bacterial colonies using the QIAGEN Miniprep Kit. Journal of Visualized Experiments. (6), 247 (2007).
  18. Reddy, B. G., et al. Expression and purification of the alpha subunit of the epithelial sodium channel, ENaC. Protein Expression and Purification. 117, 67-75 (2016).
  19. Harris, T. J., Emtage, J. S. Expression of heterologous genes in E. coli. Microbiological Sciences. 3, 28-31 (1986).
  20. Kaur, J., Kumar, A., Kaur, J. Strategies for optimization of heterologous protein expression in E. coli: Roadblocks and reinforcements. International Journal of BIological Macromolecules. 106, 803-822 (2018).
  21. Guo, Y., Yang, F., Tang, X. An Overview of Protein Secretion in Yeast and Animal Cells. Methods in Molecular Biology. 1662, 1-17 (2017).
  22. Blight, M. A., Chervaux, C., Holland, I. B. Protein secretion pathway in Escherichia coli. Current Opinion in Biotechnology. 5, 468-474 (1994).
  23. Idiris, A., Tohda, H., Kumagai, H., Takegawa, K. Engineering of protein secretion in yeast: strategies and impact on protein production. Applied Microbiology and Biotechnology. 86, 403-417 (2010).
  24. Wormald, M. R., Dwek, R. A. Glycoproteins: glycan presentation and protein-fold stability. Structure. 7, R155-R160 (1999).
  25. Geisler, C., Mabashi-Asazuma, H., Jarvis, D. L. An Overview and History of Glyco-Engineering in Insect Expression Systems. Methods in Molecular Biology. 1321, 131-152 (2015).
  26. Li, Z., Chakraborty, S., Xu, G. X-ray crystallographic studies of the extracellular domain of the first plant ATP receptor, DORN1, and the orthologous protein from Camelina sativa. Acta Crystallographica Section F: Structural BIology and Crystallization Communications. 72, 782-787 (2016).
  27. Aricescu, A. R., Owens, R. J. Expression of recombinant glycoproteins in mammalian cells: towards an integrative approach to structural biology. Current Opinion in Structural Biology. 23, 345-356 (2013).
  28. Reuter, L. J., Bailey, M. J., Joensuu, J. J., Ritala, A. Scale-up of hydrophobin-assisted recombinant protein production in tobacco BY-2 suspension cells. Plant Biotechnology Journal. 12, 402-410 (2014).
  29. Dohi, K., et al. Inducible virus-mediated expression of a foreign protein in suspension-cultured plant cells. Archives of Virology. 151, 1075-1084 (2006).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please sign in or create an account.

    Usage Statistics