Met behulp van In Vitro fluorescentie Resonance Energy Transfer te bestuderen van de dynamiek van eiwitcomplexen op de tijdschaal van een milliseconde

Biochemistry

Your institution must subscribe to JoVE's Biochemistry section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

Eiwit-eiwitinteractie zijn kritisch voor biologische systemen, en studies over de bindende kinetiek inzicht verwerven in de dynamiek en de functie van eiwitcomplexen. Beschrijven we een methode die kwantificeert de kinetische parameters van een eiwit complex met behulp van fluorescentie resonantie-energie-overdracht en de techniek gestopt-flow.

Cite this Article

Copy Citation | Download Citations

Garsamo, M., Zhou, Y., Liu, X. Using In Vitro Fluorescence Resonance Energy Transfer to Study the Dynamics Of Protein Complexes at a Millisecond Time Scale. J. Vis. Exp. (145), e59038, doi:10.3791/59038 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Eiwitten zijn de primaire operatoren van biologische systemen, en ze meestal in combinatie met andere macro- of kleine moleculen hun biologische functies te vervullen. Dergelijke interacties kunnen zeer dynamisch, wat betekent dat de interactie subeenheden zijn voortdurend gekoppeld aan en losgekoppeld op bepaalde tarieven. Terwijl de bindende affiniteit met behulp van technieken zoals kwantitatieve pull-down onthult de sterkte van de interactie, de bindende kinetiek studeren biedt u inzichten over hoe snel de interactie plaatsvindt en hoe lang elke complex kan bestaan. Bovendien meten de kinetiek van een interactie in de aanwezigheid van een bijkomende factor, zoals een eiwit uitwisseling factor of een drug, helpt het onthullen van het mechanisme waarmee de interactie wordt geregeld door de andere factor, die belangrijke kennis ten behoeve van de bevordering van de biologische en medisch onderzoek. Hier beschrijven we een protocol voor het meten van de kinetiek van de binding van een eiwit complex dat kent een hoge intrinsieke vereniging en kan snel worden losgekoppeld door een ander eiwit. De methode fluorescentie resonantie energieoverdracht gebruikt om het verslag van de vorming van het eiwit complex in vitro, en hiermee is controle op de snelle associatie en dissociatie van het complex in real time op een fluorimeter gestopt-flow. Met behulp van deze test, worden de snelheidsconstanten associatie en dissociatie van het eiwit complex gekwantificeerd.

Introduction

Biologische activiteit worden uiteindelijk uitgevoerd door eiwitten, meest waarvan communiceren met anderen voor goede biologische functies. Met behulp van een rekenkundige benadering, de totale hoeveelheid eiwit-eiwitinteractie in mens wordt geschat op ~ 650.0001en verstoring van deze interacties vaak leidt tot ziekten2. Als gevolg van hun essentiële rol bij het beheersen van cellulaire en organisch processen, zijn tal van methoden ontwikkeld om te bestuderen van eiwit-eiwitinteractie, zoals gist-twee-hybride, bimolecular fluorescentie complementatie, split-luciferase complementatie en co-immunoprecipitation assay3. Terwijl deze methoden goed zijn in het ontdekken en bevestiging van eiwit-eiwitinteractie, ze zijn meestal niet-kwantitatieve en dus beperkte informatie verstrekken over de verwantschap tussen de interactie eiwit-partners. Kwantitatieve pull-downs kunnen worden gebruikt voor het meten van de bindende affiniteit (bijvoorbeeld de dissociatieconstante Kd), maar het niet meet de kinetiek van de binding, noch kan het worden toegepast wanneer de Kd erg laag als gevolg van een ontoereikende is Signal-to-noise verhouding4. Oppervlakte plasmon (SPR) resonantie spectroscopie kwantificeert de kinetiek van bindende, maar het vereist een specifieke oppervlakte en immobilisatie van een reactieve op het oppervlak, die de bindende eigenschap van het reactieve5kan wijzigen. Bovendien is het moeilijk voor SPR voor het meten van de snelle associatie en dissociatie tarieven5, en het is niet gepast gebruik van SPR te karakteriseren van de gebeurtenis van het uitwisselen van eiwit subeenheden in een eiwit complex. Hier beschrijven we een methode waarmee het meten van de tarieven van eiwit complex montage en demontage op de tijdschaal van een milliseconde. Deze methode was essentieel voor het bepalen van de rol van Cullin -eenssociated -Nedd8 -oissociated eiwit 1 (Cand1) als de F-doos eiwit uitwisseling factor6,7.

Cand1 regelt de dynamiek van Skp1•Cul1•F-box eiwit (SCF) E3 ligases, die tot de grote familie van Cullin-RING ubiquitin ligases behoren. SCF bestaan uit de cullin Cul1, die de RING domein proteïne Rbx1 bindt, en een verwisselbare F-doos-eiwit, dat werft substraten en bindt Cul1 via de adapter proteïne Skp18. Als een ligase E3, SCF katalyseert de vervoeging van ubiquitin aan de ondergrond, en het wordt geactiveerd wanneer het substraat is aangeworven door de F-doos-eiwit, en als Cul1 door de ubiquitin-achtige eiwitten Nedd89wordt gewijzigd. Cand1 bindt ongewijzigde Cul1, en op bindende, het verstoort zowel de vereniging van Skp1•F-box eiwit met Cul1 en de vervoeging van Nedd8 naar Cul110,11,12,13. Dientengevolge, Cand1 leek, moet een inhibitor van de omwenteling van het SCF-activiteit in vitro, maar Cand1 deficiëntie in organismen veroorzaakt gebreken dat suggereert een positieve rol van Cand1 bij het reguleren van de SCF activiteiten in vivo14,15,16 , 17. deze paradox werd eindelijk verklaard door een kwantitatieve studie waaruit bleek de dynamische interacties tussen Cul1, Cand1 en Skp1•F-box eiwit. Met behulp van fluorescentie resonantie energie transfer (FRET) testen die de vorming van de Cul1•Cand1 en Financieringsmiddelen complexen detecteren, de associatie en dissociatie stem constanten (kop en kuit, respectievelijk) werden individueel gemeten. De metingen bleek dat zowel Cand1 als Skp1•F-box eiwit vorm uiterst krap complex met Cul1, maar de kaf van SCF dramatisch door de Cand1 toegenomen is en de kaf van Cul1•Cand1 is sterk toegenomen door Skp1•F-vak eiwit6,7. Deze resultaten verlenen de initiële en kritische steun voor het definiëren van de rol van Cand1 als een eiwit uitwisseling factor, die de vorming van nieuwe SCF complexen via recycling van Cul1 uit de oude SCF complexen katalyseert.

Hier presenteren we de procedure voor de ontwikkeling en het gebruik van de FRET bepaling te bestuderen van de dynamiek van de Cul1•Cand1 complexe7, en hetzelfde principe kan worden toegepast om te bestuderen van de dynamiek van verschillende biomoleculen. FRET treedt op wanneer een donor enthousiast met de juiste golflengte is, en een accepteerder met excitatie spectrum overlapt het emissiespectrum van de donor aanwezig binnen een afstand van 10-100 is Å. De geëxciteerde toestand wordt overgebracht naar de acceptor, waardoor verminderen de intensiteit van de donor en de acceptor intensiteit18verhogen. De efficiëntie van de FRET (E) is afhankelijk van zowel de Förster straal (R0) en de afstand tussen de donor en acceptor fluorophores (r), en wordt bepaald door: E = R06/ (R0 6 + r6). De Förster straal (R0) hangt af van enkele factoren, waaronder de dipool hoekige oriëntatie, de spectrale overlap tussen het donor-acceptor paar, en de oplossing gebruikt19. Toe te passen van de bepaling van de FRET op een fluorimeter gestopt-stroom, die de verandering van de emissie van de donor in real-time monitoren en metingen van snelle kop en kuitkunt, is het noodzakelijk om efficiënte FRET die resulteert in een aanzienlijke vermindering van de uitstoot van de donor. Daarom ontwerpen van efficiënte FRET door het kiezen van het juiste paar fluorescente kleurstoffen en sites op de doel-eiwitten te hechten de kleurstoffen is belangrijk en zal worden besproken in dit protocol.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. het ontwerp van de FRET assay.

  1. Download het bestand van de structuur van de complexe Cul1•Cand1 van de Protein Data Bank (bestand 1U6G).
  2. De structuur van de Cul1•Cand1 complexe in PyMOL weergeven.
  3. Met de functie van de meting onder het menu van de Wizard voor PyMOL schatting maken van de afstand tussen de eerste aminozuur van de Cand1 en het laatste aminozuur van Cul1 (Figuur 1).
  4. Laden van de viewer online spectra (Zie Tabel van materialen) en de excitatie en emissie spectra van 7-amino-4-methylcoumarin (AMC) en FlAsH gelijktijdig bekijken (Figuur 2). Merk op dat AMC de FRET donor en de flitser is de FRET acceptor.

Figure 1
Figuur 1: de kristalstructuur van Cul1•Cand1 en meting van de afstand tussen potentieel sites te labelen. Het kristal structuur bestand werd gedownload van Protein Data Bank (bestand 1U6G), en bekeken in PyMOL. Metingen tussen geselecteerde atomen werden gedaan door PyMOL. Klik hier voor een grotere versie van dit cijfer.

Figure 2
Figuur 2: de excitatie en emissie spectra van de fluorescente kleurstoffen voor FRET. Spectra van AMC (7-amino-4-methylcoumarin) en FlAsH worden weergegeven. Excitatie spectra als stippellijnen en ononderbroken lijnen geven emissie spectra. Het beeld werd oorspronkelijk zijn gegenereerd door de fluorescentie-SpectraViewer en is bewerkt voor betere duidelijkheid. Klik hier voor een grotere versie van dit cijfer.

2. bereiding van Cul1AMC•Rbx1, de FRET donor eiwit

  1. Construeren van plasmiden voor het uitdrukken van menselijke •Rbx1 van desortasevan de Cul1 in cellen van E. coli . Merk op dat de twee plasmiden mede uiting van menselijke Cul1•Rbx1 in cellen van E. coli in detail in een vorige verslag20 beschreven zijn.
    1. Een DNA-sequentie "LPETGGHHHHHH" (sortase-Hsi6 tag) codering toevoegen aan het einde 3' van de codering reeks Cul1 door Standaardpcr en klonen methoden21,22.
    2. Het volgnummer van het nieuwe plasmide om te bevestigen de gene invoegen klopt.
  2. Co express Cul1sortase•Rbx1 in cellen van E. coli . De methode is afgeleid van een eerdere verslag20.
    1. Mix 100 ng, elk van de twee plasmiden met BL21 (DE3) chemisch bevoegde cellen voor co transformatie met behulp van de warmte schok methode23. Het groeien van cellen op LB agarplaat met 100 µg/mL ampicilline en 34 µg/mL chlooramfenicol bij 37 ° C's nachts.
    2. Inoculeer 50 mL LB cultuur met vers getransformeerde kolonies en 's nachts groeien bij 37 ° C met 250 rpm schudden. Dit geeft een starter cultuur.
    3. Kolven worden geënt 6, elk met 1 L van LB medium, met 5 mL starter cultuur elke en groeien bij 37 ° C met 250 t/min schudden tot de OD600 ~ 1.0. Koel de cultuur tot 16 ° C en isopropyl-β-D-thiogalactoside (IPTG) toevoegen aan 0,4 mM. Houd de cultuur bij 16 ° C's nachts met 250 rpm schudden.
    4. Oogsten van de cellen van E. coli door middel van centrifugeren bij 5.000 x g gedurende 15 minuten en het verzamelen van cel pellets in 50 mL conische buisjes.
      Opmerking: De cel pellets voor eiwitreiniging kunnen worden verwerkt of worden bevroren bij-80 ° C voordat u verdergaat met de stappen van eiwit zuivering.
  3. Zuivering van de Cul1sortase•Rbx1 complex. Deze methode is afgeleid van een eerdere verslag20.
    1. Voeg 50 mL lysisbuffermengsel (30 mM Tris-HCl, 200 mM NaCl, 5 mM DTT, 10% glycerol, 1 tablet van de proteaseinhibitor cocktail, pH 7,6) aan de pellet van E. coli cellen uiten van Cul1sortase•Rbx1.
    2. Lyse de cellen op ijs met ultrasoonapparaat bij 50% amplitude. Afwisselend 1 seconde aan / 1 seconde uit en voer voor 3 min.
    3. Herhaal stap 2.3.2 2-3 x.
    4. De cel lysate overboeken naar een tube van 50 mL centrifugeren en verwijderen van het puin van de cel door centrifugeren bij 25.000 x g gedurende 45 min.
    5. Incubeer de cel wissen lysate met 5 mL van glutathion kralen bij 4 ° C gedurende 2 uur.
    6. Centrifugeer het kralen-lysate mengsel bij 1.500 x g gedurende 2 min bij 4 ° C. Verwijder het supernatant.
    7. Wassen van de kralen met 5 mL lysisbuffermengsel (met geen proteaseinhibitors) en verwijderen van het supernatans dat na het centrifugeren bij 1.500 x g gedurende 2 min bij 4 ° C.
    8. Herhaal stap 2.3.7 2 x.
    9. Voeg 3 mL lysis-buffermengsel tot de gewassen kralen en breng de kraal drijfmest in een lege kolom.
    10. Voeg 5 mL van de elutie buffer (50 mM Tris-HCl, 200 mM NaCl, 10 mM gereduceerd glutathion, pH 8.0) in de kolom. Incubeer gedurende 10 min en het verzamelen van het eluaat.
    11. Herhaal stap 2.3.10 3-4 x.
    12. Voeg 200 µL van trombine van 5 mg/mL (Zie Tabel van materialen) aan het eluaat uit de glutathion kralen en na een nacht bebroeden bij 4 ° C.
      Opmerking: Het protocol kan hier worden gepauzeerd.
    13. Verdun de eiwitSteekproef met Buffer A (25 mM HEPES, 1 mM DTT, 5% glycerol, pH 6,5) verdrievoudigd.
    14. Een chromatografie catie wisselingskolom equilibreer (Zie Tabel van materialen) op een FPLC systeem met Buffer A.
    15. Laad de eiwitSteekproef naar de kolom-chromatografie geëquilibreerd cation exchange op een debiet van 0,5 mL/min.
    16. Het eiwit met een helling van NaCl in 40 mL Elueer door het mengen van Buffer A en van 0 tot en met 50% Buffer B (25 mM HEPES, 1 M NaCl, 1 mM DTT, 5% glycerol, pH 6,5) bij een debiet van 1 mL/min.
    17. Controleer de eluted proteïne in de verschillende fracties met behulp van SDS-pagina24.
      Opmerking: Het protocol kan hier worden gepauzeerd.
    18. Het zwembad van het eluaat breuken met Cul1sortase•Rbx1.
    19. Het gepoolde monster van het •Rbx1 van desortasevan de Cul1 tot 2,5 mL concentreren door het passeren van de buffer door een membraan van ultrafiltratie (30 cutoff kDa).
  4. AMC toevoegen aan de C-terminus van Cul1 via sortase-gemedieerde transpeptidation21,22.
    1. De buffer in de steekproef van Cul1sortase•Rbx1 aan de sortase buffer (50 mM Tris-HCl, 150 mM NaCl, 10 mM CaCl2, pH 7.5) wijzigen met behulp van een demineralisatie kolom (Zie Tabel van materialen).
      1. Equilibreer een demineralisatie kolom met 25 mL van sortase buffer.
      2. Laad 2,5 mL van Cul1sortase•Rbx1 monster in de kolom. Gooi de doorstroming.
      3. Elueer het monster met 3,5 mL sortase buffer. Verzamel de doorstroming.
    2. Voeg 100 µL van 600 µM gezuiverd sortase A oplossing en 10 µL van 25 mM GGGGAMC peptide in 900 µL van de Cul1sortase•Rbx1 oplossing in de buffer van de sortase. Incubeer het reactiemengsel bij 30 ° C in het donker 's nachts. Opmerking dat deze stap Cul1 genereren zalAMC•Rbx1.
      Let op: Fluorescente kleurstoffen zijn gevoelig voor licht, dus voorkomen dat zij worden blootgesteld aan omgevingslicht tijdens de eiwit en sample voorbereiding zoveel mogelijk.
      Opmerking: Het protocol kan hier worden gepauzeerd.
    3. Voeg 50 µL van Ni-NTA agarose parels aan het reactiemengsel en Incubeer bij kamertemperatuur gedurende 30 minuten.
    4. De Ni-NTA agarose kralen pellet door centrifugeren bij 5.000 x g gedurende 2 min en het verzamelen van de bovendrijvende substantie.
    5. Een kolom grootte uitsluiting chromatografie equilibreer (Zie Tabel van materialen) met buffer (30 mM Tris-HCl, 100 mM NaCl, 1 mM DTT, 10% glycerol) op het FPLC-systeem.
    6. Laden van alle de Cul1AMC•Rbx1 monster op de kolom grootte uitsluiting chromatografie. Elueer met 1,5 x kolom hoeveelheid buffer.
    7. Controleer het eluaat breuken door SDS-pagina24.
    8. Zwembad van het eluaat breuken met Cul1AMC•Rbx1.
    9. Meten van de eiwitconcentratie met behulp van de extinctie op 280 nm met een spectrofotometer.
    10. Aliquot de eiwit-oplossing en winkel bij-80 ° C.
      Opmerking: Het protocol kan hier worden gepauzeerd.

3. voorbereiding van de FlAsHCand1, de FRET acceptor eiwit

Opmerking: De meeste stappen in dit deel zijn hetzelfde als stap 2. Voorwaarden die verschillen worden hieronder in detail beschreven.

  1. Construeer de plasmide voor het uitdrukken van menselijke TetraCysCand1 in cellen van E. coli .
    1. DNA-sequentie "CCPGCCGSG" (tetracysteine/TetraCys-tag) codering toevoegen voordat het 15th aminozuur van Cand1 door middel van regelmatige PCR25 (primer reeksen: TGCTGTCCGGGCTGCTGCGGCAGCGGCATGACATCCAGCGACAAGGACTTTAG; CTAACTAGTGTCCATTGATTCCAAG).
    2. Het PCR-product invoegen in een vector pGEX-4T-2. Het volgnummer van de plasmide om te bevestigen de gene invoegen is accuraat en in frame.
  2. Express TetraCysCand1in E. coli cellen op dezelfde manier als stap 2.2, behalve dat het plasmide is omgevormd tot Rosetta bevoegde cellen.
  3. Zuivering van TetraCysCand1 uit de cellen van E. coli .
    1. Lyse van de E. coli cel pellets en uittreksel TetraCysCand1using glutathion kralen. Deze stappen zijn hetzelfde als de stappen 2.3.1–2.3.12.
    2. Verdun het eluaat eiwit uit de glutathion kralen met Buffer C (50 mM Tris-HCl, 1 mM DTT, 5% glycerol, pH 7.5) door drie plooien. Equilibreer een anion wisselingskolom chromatografie (Zie Tabel van materialen) op het FPLC-systeem met Buffer C en load het monster van de verdunde eiwit bij een debiet van 0,5 mL/min.
    3. Het eiwit met een helling van NaCl in 40 mL Elueer door het mengen van Buffer C en 0 tot en met 50% Buffer D (50 mM Tris-HCl, 1 M NaCl, 1 mM DTT, 5% glycerol, pH 7.5) op een debiet van 1 mL/min. Controleer de eluted proteïne in de verschillende fracties met behulp van SDS-pagina24, en pool van de breuken met TetraCysCand1. Merk op dat TetraCysCand1 een grotere retentievolume dan gratis GST heeft.
    4. Concentreren de gebundelde TetraCysCand1 monster door het passeren van de buffer door een membraan van ultrafiltratie (30 cutoff kDa).
    5. De kolom grootte uitsluiting chromatografie met labeling buffer (20 mM Tris-HCl, 100 mM NaCl, 2 mM TCEP, 1 mM EDTA, 5% glycerol) equilibreer op het FPLC-systeem. TetraCysCand1 monster (500 µL telkens) laden en controleer het eluaat breuken door SDS-pagina24.
    6. Bundelen alle breuken met TetraCysCand1 en het eiwit tot ~ 40 µM concentreren door het passeren van de buffer door een membraan van ultrafiltratie (30 cutoff kDa). Schatten van de eiwitconcentratie met behulp van de extinctie op 280 nm. Het eiwit opslaat als 50 µL aliquots bij-80 ° C.
      Opmerking: Het protocol kan hier worden gepauzeerd.
  4. Voorbereiding van FlAsHCand1.
    1. Voeg 1 µL van FlAsH oplossing (Zie Tabel van materialen) tot 50 µL TetraCysCand1 oplossing.
    2. Meng goed en Incubeer het mengsel bij kamertemperatuur in het donker voor 1-2 h om FlAsHCand1.
      Opmerking: Het protocol kan hier worden gepauzeerd.

4. bereiding van Cand1, de FRET chase eiwit

Opmerking: Het eiwit voorbereiding protocol is vergelijkbaar met de stap 3 met de volgende wijzigingen.

  1. De codering opeenvolging van full-length Cand1 invoegen door de vector pGEX-4T-2.
  2. Het wijzigen van de buffer die wordt gebruikt in stap 3.3.5 naar een buffer met 30 mM Tris-HCl, 100 mM NaCl, 1 mM DTT, 10% glycerol.
  3. Elimineer stappen 3.3.7 en 3.3.8.

5. testen en bevestig de FRET assay

  1. De buffer van de FRET met 30 mM Tris-HCl, 100 mM NaCl, 0.5 mM DTT, 1 mg/mL ovoalbumine, pH 7,6, bereiden en gebruiken bij kamertemperatuur.
  2. Testen van de FRET tussen Cul1AMC•Rbx1 en FlAsHCand1 op een fluorimeter.
    1. In 300 µL van FRET buffer, toevoegen Cul1AMC•Rbx1 (FRET donor) aan een eindconcentratie van 70 nM. Breng de oplossing kwantitatief over in een cuvet.
    2. Plaats de cuvette, in de monsterhouder van een fluorimeter. Wekken van het monster met 350 nm excitatie licht en scannen van de signalen van de emissie van 400 nm tot 600 nm bij 1 nm stappen.
    3. Herhaal stap 5.2.1 maar verandering Cul1AMC•Rbx1 naar FlAsHCand1 (FRET acceptor). Scan het FlAsHCand1 monster gebruikend de zelfde methode zoals in stap 5.2.2.
    4. (Optioneel) Wekken van de FlAsHCand1 met 510 nm excitatie licht, en scan het signaal van de emissie van 500 nm tot 650 nm.
    5. Voeg beide Cul1 in 300 µL FRET buffer,AMC•Rbx1 en FlAsHCand1 om een eindconcentratie van 70 nM. Het analyseren van het monster in de dezelfde manier als in stap 5.2.2.
  3. Bevestigen van de FRET tussen Cul1AMC•Rbx1 en FlAsHCand1 door toevoeging van de chase (labelloze Cand1) proteïne (Figuur 3 c).
    1. In 300 µL van FRET buffer, voeg 70 nM Cul1AMC•Rbx1 en 700 nM Cand1. Scan de uitstoot monster zoals in stap 5.2.2.
    2. In 300 µL van FRET buffer, voeg 70 nM FlAsHCand1 en 700 nM Cand1. Scan de uitstoot monster zoals in stap 5.2.2.
    3. In 300 µL van FRET buffer, voeg 70 nM Cul1AMC•Rbx1 en 70 nM FlAsHCand1, en Incubeer het monster bij kamertemperatuur gedurende 5 minuten. Voeg vervolgens 700 nM Cand1, en onmiddellijk na de toevoeging, scan de uitstoot monster zoals in stap 5.2.2). Merk op dat deze stap vergelijkbaar met stap 5.2.5 is.
    4. In 300 µL FRET buffer, opeenvolgend toevoegen 70 nM Cul1AMC•Rbx1, 700 nM Cand1 en 70 nM FlAsHCand1. Incubeer het monster bij kamertemperatuur gedurende 5 minuten, en de uitstoot van monster zoals in stap 5.2.2 scannen. Merk op dat dit het monster chase (groene lijn in Figuur 3 c).

6. het meten van de vereniging constant (kop) van Cul1•Cand1

Opmerking: Details van operationele een gestopt-flow fluorimeter is beschreven in een vorige verslag26.

  1. Stel de gestopt-flow fluorimeter voor meting.
    1. Zet de gestopt-flow fluorimeter volgens de instructie van de fabrikant.
    2. De excitatie lichte vastgesteldop van 350 nm en gebruik een band-pass-filter waarmee 450 nm uitstoot licht te geven en 500-650 nm uitstoot licht blokkeert.
    3. Houden van de kleppen van het monster op de positie te vullen , en sluit een 3 mL spuit gevuld met water. De twee monster spuiten (A en B) wassen met water door het bewegen van het monster spuit station op en neer meerdere malen. Gooi al het water in deze stap gebruikt.
    4. Houden van de kleppen van het monster op de positie te vullen , en sluit een 3 mL spuit gevuld met FRET buffer. Wassen van de twee spuiten van het monster met de FRET buffer door het bewegen van het monster spuit station op en neer de verschillende tijd. Gooi alle de FRET buffer die wordt gebruikt in deze stap.
  2. Neem een controle meting (figuur 4C).
    1. Sluit een 3 mL spuit en spuit A laden met 100 nM Cul1AMC•Rbx1 in de buffer van de FRET. Draai het ventiel van het monster naar de positie rijden .
    2. Sluit een 3 mL spuit en spuit B laden met de FRET buffer. Draai het ventiel van het monster naar de positie rijden .
    3. Gebruik het Configuratiescherm onder verwerven in de software om vijf schoten (meng gelijke hoeveelheid monsters uit spuit A en B van de spuit) op de gestopt-flow fluorimeter zonder te registreren van de resultaten.
    4. Open het Configuratiescherm onder verwerven in de software, en het programma voor het opnemen van de uitstoot van Cul1AMC meer dan 60 s. Neem dan een enkel schot.
    5. Herhaal stap 6.2.4 2 x.
    6. Draai het ventiel van het monster naar de positie te vullen . Lege spuit B en wassen met de FRET buffer.
  3. Maatregel waargenomen vereniging snelheidsconstanten (kobs) van Cul1•Cand1 (figuur 4B).
    1. Houden van het monster in de injectiespuit A gelijk aan stap 6.2.1.
    2. Verbinding maken met een spuit met 3 mL en laad spuit B met 100 nM FlAsHCand1 in de buffer van de FRET. Draai het ventiel van het monster naar de positie rijden .
    3. Gebruik het Configuratiescherm onder verwerven in de software om vijf schoten zonder te registreren van de resultaten.
    4. Open het Configuratiescherm onder verwerven in de software, en het programma voor het opnemen van de uitstoot van Cul1AMC meer dan 60 s. Neem dan een enkel schot.
    5. Herhaal stap 6.3.4 2 x.
    6. Lege spuit B en wassen met de FRET buffer.
    7. Herhaal stappen 6.3.1–6.3.6 verschillende malen met toenemende concentraties van FlAsHCand1 in de buffer van de FRET.
    8. Passen de verandering (afname) in fluorescerende signalen gemeten na verloop van tijd van elk schot aan een enkele exponentiële curve. Dit zal kobsin elke meting en de eenheid is s-1. Merk op dat de basis van deze berekening in een vorige verslag27goed is besproken.
  4. Bereken de gemiddelde en de standaarddeviatie van kobsvoor elke FlAsHCand1 concentratie gebruikt. Uitzetten van de gemiddelde kobstegen Cand1 concentratie (Figuur 4 d), en de helling van de lijn vertegenwoordigt de kop van Cul1•Cand1, met een eenheid van M-1 s-1.

7. meet het tarief dissociatieconstante (kuit) van Cul1•Cand1 in de aanwezigheid van eiwitten van de Skp1•F-box.

Opmerking: Deze stap is vergelijkbaar met de stap 6, met de volgende wijzigingen.

  1. In de injectiespuit A, onder de positie te vullen het laden van een oplossing van 100 nM Cul1AMC•Rbx1 en 100 nM FlAsHCand1 in de buffer van de FRET. Draai het ventiel van het monster naar de "DRIVE" positie.
  2. Laden in spuit de B, onder de vullen positie, een oplossing van Skp1•Skp2 (opgesteld naar aanleiding van een eerdere verslag20). Draai het ventiel van het monster naar de "DRIVE" positie.
  3. Open het Configuratiescherm onder verwerven in de software, en het programma voor het opnemen van de uitstoot van Cul1AMC meer dan 30 s. Neem dan een enkel schot. De fluorescerende signalen toenemen in de tijd na het mengen van oplossingen uit spuit A en B van de spuit (Figuur 5).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Voor het testen van de FRET tussen Cul1AMC en FlAsHCand1, we eerst bepaald de emissie-intensiteit van 70 nM Cul1AMC (de donor) en 70 nM FlAsHCand1 (de acceptor), respectievelijk (figuur 3A-C, blauwe lijnen). In elke analyse slechts één uitstoot piek aanwezig, en de uitstoot van FlAsHCand1 was was (de acceptor) laag. Wanneer 70 nM elke van Cul1AMC en FlAsHCand1 waren gemengd voor het genereren van de FRET, twee pieken van de emissie waren aanwezig in de spectra van de emissie, de piek van Cul1AMC werd lager en het hoogtepunt van FlAsHCand1 werd hoger (figuur 3A -C, rode lijnen). Wanneer de volledige Cand1 werd gebruikt voor FRET, de donor piek toonde een korting van 10% in intensiteit (figuur 3A, rode lijn), en Cand1 met haar eerste helix afgekapt werd gebruikt, werd de vermindering van de donor piek intensiteit verhoogd tot 30% (figuur 3B -D, rode lijnen), suggereren hogere efficiëntie van de FRET. Om te bevestigen dat de signaal wijzigingen werden gevolg van FRET tussen Cul1AMC en FlAsHCand1, 70 nM Cul1AMC (de donor) werd gemengd met 700 nM ongelabelde Cand1 (de jacht) en 70 nM FlAsHCand1 (de acceptor). Dientengevolge, is volledig gerenoveerd met de piek van de donor en de acceptor piek werd verlaagd (Figuur 3 c, groene lijn), die bevestigd dat de waargenomen FRET afhankelijk is van de vorming van de Cul1AMCFlAsHCand1 complex. Het toevoegen van 700 nM Skp1•Skp2 tot de 70 nM Cul1AMCFlAsHCand1 ook volledig gerestaureerd de donor piek (figuur 3D, groene lijn), wat suggereert dat het Cul1•Cand1-complex werd volledig verstoord door Skp1•Skp2 bij evenwicht.

Figure 3
Figuur 3: vertegenwoordiger FRET assay voor Cul1•Cand1 complexvorming. Monsters in de FRET buffer (30 mM Tris-HCl, 100 mM NaCl, 0.5 mM DTT, 1 mg/mL ovoalbumine, pH 7,6) waren enthousiast bij 350 nm, en de emissies werden gescand vanaf 400 nm tot 650 nm. (A) emissie spectra van 70 nM Cul1AMC, 70 nM FlAsHCand1 (volledige), en een mengsel van de twee (FRET). Cand1 (volledige) staat voor volledige lengte Cand1. (B) emissie spectra van 70 nM Cul1AMC, 70 nM FlAsHCand1, en een mengsel van de twee (FRET). Cand1 met haar eerste helix verwijderd werd gebruikt in dit experiment en daarna. (C) emissie spectra van 70 nM Cul1AMC, 70 nM FlAsHCand1, een mengsel van de twee (FRET), en controle te achtervolgen voor FRET (Chase). Het monster chase bevatte 70 nM Cul1AMC, 700 nM Cand1 en 70 nM FlAsHCand1. (D) emissie spectra van 70 nM Cul1AMC, een mengsel van 70 nM Cul1AMC en 70 nM FlAsHCand1 (FRET) en 700 nM Skp1•Skp2 toegevoegd aan de 70 nM Cul1AMCFlAsHCand1 complex. In elk perceel, de emissie signalen waren genormaliseerd naar de uitstoot van 70 nM Cul1AMC bij 450 nm. Klik hier voor een grotere versie van dit cijfer.

Voor het meten van het kop van Cul1•Cand1 met behulp van de gevestigde FRET bepaling door het toezicht op de vermindering van het signaal van de donor na verloop van tijd op de gestopt-flow fluorimeter, we eerst getest en bepaald de concentratie van het eiwit moet worden gebruikt. Wanneer 5 nM elke van Cul1AMC en FlAsHCand1 werden gebruikt, te weinig signaal verandering werd waargenomen (figuur 4A), overwegende dat, wanneer de concentratie van elke proteïne werd verhoogd tot 50 nM, de verlaging van het signaal na verloop van tijd werd waargenomen ( Figuur 4B) en deze wijziging werd afgeschaft als buffer zonder FlAsHCand1 was toegevoegd (figuur 4C). Daarom 50 nM Cul1AMC werd gebruikt voor verdere analyses, en een aantal waargenomen vereniging snelheidsconstanten (kobs) werden gemeten door het mengen van 50 nM Cul1AMC met toenemende concentraties van FlAsHCand1. De k-obs voor elk experiment werd berekend door het aanbrengen van de punten aan een enkele exponentiële curve, en de k-obs de dezelfde concentratie van de FlAsHCand1 verkregen werden gemiddeld. Door het uitzetten van de gemiddelde kobs met de Cand1 concentratie en uitvoeren van een lineaire regressie (Figuur 4 d), was de kop vastbesloten7,27.

Figure 4
Figuur 4: representatieve meting van vereniging tarief-constante. (A) de fluorescentie van 5 nM Cul1AMC werd bewaakt door een gestopt-flow fluorimeter na verloop van tijd na toevoeging van 5 nM FlAsHCand1. (B) de fluorescentie van 50 nM Cul1AMC werd bewaakt door een gestopt-flow fluorimeter na verloop van tijd op de toevoeging van 50 nM FlAsHCand1. (C) de fluorescentie van 50 nM Cul1AMC werd bewaakt door een gestopt-flow fluorimeter na verloop van tijd op de toevoeging van de FRET buffer. (D) kop voor Cand1 binding aan Cul1. kobs van Cul1•Cand1 in verschillende concentraties van Cand1 worden uitgezet. Lineaire helling geeft kop voor 1.8 x 107 M-1 s-1. Foutbalken vertegenwoordigen ±SEM; n = 4. Alle monsters werden voorbereid in de buffer van de FRET en enthousiast op 350 nm. Een band-pass filter werd gebruikt om signalen van AMC verzamelen en uitsluiten van signalen van FlAsH. Geen gegevens werden genormaliseerd. Klik hier voor een grotere versie van dit cijfer.

Vergelijkbaar met de meting van kop, we gemeten de waargenomen dissociatie constant van Cul1•Cand1 door het toezicht op de verhoging (terugzetten) van het signaal van de donor na verloop van tijd op de fluorimeter gestopt-flow. Cul1AMC en FlAsHCand1 waren eerst gemengd, en vervolgens Skp1•Skp2 is toegevoegd aan de voorgemonteerd Cul1AMCFlAsHCand1 op de fluorimeter gestopt-flow. Het signaal van de donor snel meer en bleek een kobs van 0,4 s-1 (Figuur 5). In tegenstelling, waarop buffer is toegevoegd aan de voorgemonteerd Cul1AMCFlAsHCand1, geen signaal toename werd waargenomen, suggereren de snelle dissociatie van Cul1•Cand1 werd veroorzaakt door Skp1•Skp2.

Figure 5
Figuur 5: representatieve meting van tarief dissociatieconstante. De verandering in de donor fluorescentie versus tijd werd gemeten na toevoeging van 150 nM Skp1•Skp2 of de buffer van de FRET naar 50 nM Cul1AMCFlAsHCand1 complex. Signaal veranderingen aan een enkele exponentiële curve geschikt waren, en het geeft waargenomen dissociatieconstante tarief van 0,4 s-1. De experimentele omstandigheden waren vergelijkbaar met die beschreven in Figuur 4. Klik hier voor een grotere versie van dit cijfer.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

FRET is een fysieke fenomeen dat is van groot belang voor het bestuderen en begrijpen van biologische systemen19. Hier presenteren we een protocol voor het testen en het gebruik van de FRET te bestuderen van de bindende kinetiek van twee interacterende eiwitten. Bij het ontwerpen van FRET, vonden wij drie belangrijke factoren: de spectrale overlap tussen donor emissie en acceptor excitatie, de afstand tussen de twee fluorophores, en de oriëntatie van de dipool van de fluorophores28. Als u wilt kiezen de fluorophores voor FRET, we bedekt de excitatie en emissie spectra van de fluorophores, en zocht naar fluorophores waarvan emissie pieken goed gescheiden zijn terwijl het emissiespectrum van de donor aanzienlijk met de excitatie overlapt spectrum van de acceptor (Figuur 2). Voor het optimaliseren van de afstand van de interfluorophore en de afdrukstand, gebruikten we de kristalstructuur voor hulp, en wij vonden vooral fluorophores aan het eiwit termini, voornamelijk te wijten aan de lagere risico verstoren de eiwitstructuur en activiteit verbonden. Omdat de afstand tussen de N-terminus van Cand1 (Cand1NTD) en de C-terminus van Cul1 (Cul1CTD) korter is dan de afstand tussen de C-terminus van Cand1 en de N-terminus van Cul1 (Figuur 1), hebben we besloten om het label Cand1NTD en Cul1CTD. Omdat wij kunnen labeling efficiëntie van 80%-90% van de N-terminus van een eiwit met behulp van de tag tetracysteine25te bereiken hadden, wij hebben gekozen voor het label Cand1NTD met flits door de tetracysteine-tag. We in eerste instantie de Cul1 gelabeldCTD met cyaan fluorescente proteïne (GVB), die een paar voordelen ten opzichte van AMC heeft. De eerste, is een genetisch gecodeerde TL-tag, zodat het niet nodig aanvullende labeling CMYK, noch stappen die de gelabelde fluorescent proteïne uit haar labelloze voorloper zuiveren. Ten tweede, GVB is helderder dan AMC, en daarom biedt hogere gevoeligheid van de test (zie bespreking hieronder). Ten derde, GVB heeft een groter spectrum overlappen met FlAsH, potentieel opbrengst efficiënter FRET met FlAsH. Ondanks deze voordelen echter GVB eiwit veel groter dan de AMC-tag, die met de eiwit bevleesdheid en de Inter moleculaire interactie interfereren kan. Inderdaad, hebben we niet waarnemen FRET tussen Cul1GVB en FlAsHCand1 in onze test, die waarschijnlijk te wijten aan onvoldoende dipool geaardheid, of verstoring van de Cul1-Cand1-interactie door de GVB-tag is. We vervolgens gelabeld de Cul1CTD met AMC, en we waargenomen FRET tussen Cul1AMC en FlAsH-Cand1. De aanvankelijke FRET met behulp van de full-length Cand1 leidde tot de 10% vermindering van de uitstoot van de donor (figuur 3A). Verder vonden we dat door het schrappen van de eerste helix van Cand1, de afstand tussen Cul1 en Cand1 is verkort van 26,8 Å naar 15,5 Å (Figuur 1), en Cand1 ontbreekt het eerste helix leverde een veel sterkere FRET met Cul1, tonen van 30% reductie van de uitstoot van de donor piek (figuur 3B). Daarnaast kan een de FRET efficiëntie verbeteren door kiezen van een donor fluorophore met hogere quantumrendement en een acceptor-fluorophore met een grotere uitsterven coëfficiënt.

Kenmerkend voor FRET is dat wanneer de FRET optreedt, de uitstoot van de dalingen van de donor en de emissie van de acceptor toeneemt (figuur 3B). Echter fluorophores gevoeligheid aan hun omgeving kunnen worden weergegeven, en dus de emissie-intensiteit kan veranderen wanneer een ander eiwit aanwezig, zelfs in de afwezigheid van FRET29 is. Om te bevestigen dat de gewijzigde emissie we waargenomen te wijten aan de FRET tussen Cul1 isAMC en FlAsHCand1, we 10 x overtollige hoeveelheid labelloze acceptor eiwit (Cand1) hebt toegevoegd als een achtervolging. De achtervolging converteert de uitstoot van de donor en de acceptor terug op het normale niveau (Figuur 3 c), waardoor ondersteunt dat de gewijzigde emissies van Cul1AMC en FlAsHCand1 afhankelijk van eiwit-eiwit interactie, en daarom dit resultaat bevestigt dat we een FRET assay die de associatie en dissociatie van Cul1•Cand1 rapporteert vastgesteld. Bovendien, we Skp1•Skp2 toegevoegd aan de voorgemonteerd Cul1AMCFlAsHCand1 complex, en Skp1•Skp2 staat bekend om het verstoren van de Cul1-Cand1 interactie6te kunnen. We vonden dat de FRET tussen Cul1AMC en FlAsHCand1 verdwenen (figuur 3D, groene lijn) en het emissiespectrum werd vergelijkbaar met de emissie spectrum van het monster chase (Figuur 3 c, groene lijn), suggereren Cul1AMCFlAsHCand1 is losgekoppeld van Skp1•Skp2 en Cul1AMC toont geen abnormale emissie wanneer Skp1•Skp2 aanwezig is.

Door de wijziging in de emissie van de donor, kunnen we direct zien de associatie en dissociatie van Cul1AMCFlAsHCand1 op een fluorimeter gestopt-flow. Het gestopt-stroomsysteem werkt door het injecteren van de reactanten aan een mengkamer te snel mengen de reactanten, en de stroom te stoppen zodra de gemengde reactanten worden bewogen in een kamer observatie5. De signaal detectie begint meestal 1-2 milliseconden (ms) na het mengen, waarmee bestuderen van interacties die op de tijdschaal milliseconde plaatsvinden. Echter wanneer de halveringstijd van de waargenomen reactie korter dan de benodigde tijd is voor het mengen van de reactanten op een bepaald apparaat en deze aanpak is niet gevoelig genoeg zijn en is niet langer passende30. Gestopt-flow analyses werden gebruikt om te bepalen van de snelheidsconstanten variërend van 10-6–106 s-1 voor de eerste-orde reacties en 1 – 109 M-1 s-1 voor de tweede-orde reacties5. Met het oog op een betrouwbare meting van de kinetische parameters met behulp van de fluorimeter gestopt-stroom, is een belangrijke wijziging van het fluorescerende signaal tussen de begin- en evenwicht punten nodig. We gebruikten de Cand1 FlAsHontbreekt de eerste helix als de acceptor, want het levert betere FRET met Cul1AMC, en we getest de concentratie van de eiwitten worden gebruikt voor het meten. Wanneer 5 nM elke van Cul1AMC en FlAsHCand1 waren gemengd, Geenverandering in Cul1AMC signaal werd waargenomen (figuur 4A), suggereert deze concentratie is onvoldoende voor de meting. Wanneer de eiwit-concentraties waren verhoogd tot 50 nM, de afname van de Cul1AMC signaal na verloop van tijd werd duidelijk (figuur 4B), en deze wijziging treedt niet op wanneer de acceptor eiwit afwezig (figuur 4C) was. Op basis van dit resultaat, gebruikten we Cul1AMC op 50 nM overleg om te meten de kop voor Cul1•Cand1. De concentratie van het eiwit van de donor voor het meten kan afwijken wanneer verschillende fluorophores worden gebruikt. Bijvoorbeeld, wanneer Cul1 wordt aangeduid met GVB, 5 nM van GVBCul1 volstaat voor de meting van kop6. Daarom de optimale concentratie van het eiwit moet worden getest voor elk paar van de FRET, en in principe helderder fluorophores toestaan van het gebruik van lagere concentraties van eiwit en bieden betere signaal-/ ruisverhouding31.

Studie eiwit-eiwitinteractie door FRET, vereist het koppelen van fluorophores aan eiwitten op juiste posities zonder het verstoren van de eiwitstructuur en activiteit, waardoor potentieel het gebruik van de FRET beperkt. In dit protocol, we de N-terminus van Cand1 met behulp van een tetracysteine-label, dat specifiek de FlAsH kleurstof bindt gelabeld en de FlAsH kleurstof wordt fluorescerende pas nadat het bindt de doelgroep eiwit32. We Cul1 gelabeld met behulp van sortase-gemedieerde transpeptidation, die hecht een korte peptide uitvoering van een fluorophore aan de sortase tag op de C-terminus van Cul121,22. De labeling efficiëntie is > 80% met de tag tetracysteine, en bijna 100% met de tag sortase-Hsi6 na het verwijderen van de spoorverontreiniging eiwit met Ni-NTA kralen (stappen 2.4.3–2.4.4). Beide methoden toevoegen een paar aminozuren aan het doel-eiwit, invoering van minimale wijzigingen in de eiwitstructuur. Soortgelijke benaderingen, zoals de transglutaminase erkenning sequentie (Q-tag)33 en de ybbR tag34, kunnen ook worden gebruikt om het doel eiwit label op een specifieke wijze. Bovendien kan fotostabiliteit van de fluorescente kleurstoffen ook beperkt het gebruik van de FRET. Herhaalde of langdurige blootstelling aan excitatie licht kan leiden tot photobleaching van de fluorophore, wat resulteert in onjuiste kwantificering resultaten35. Daarom moeten de donor en acceptor eiwitten worden beschermd tegen licht tijdens de bereiding en opslag stappen. Bij het gebruik van de FRET te meten gebeurtenissen die zich geleidelijk voltrekken in plaats van voortdurend toezicht op de verandering in de donor emissie na verloop van tijd, korte lezingen van de donor-emissie met langere tussenpozen moeten worden genomen en het monster moet in het donker worden bewaard tijdens de gehele experiment6.

Omdat de FRET is gevoelig en kwantitatieve, is het een belangrijk instrument voor de studie van de interactie tussen macromoleculen geworden. Dit protocol biedt een voorbeeld van het gebruik van de FRET te bestuderen van de dynamiek van een eiwit complex in oplossing. FRET is ook gebruikt samen met levende cel imaging om te bestuderen van de moleculaire interacties in levende cellen36, die is krachtig in het onthullen van de dynamiek van eiwitcomplexen onder fysiologische omstandigheden. FRET kan bovendien ook worden gebruikt op het niveau van de single-molecuul te bestuderen van de real-time dynamiek van macromoleculaire complexen37,38, bieden inzicht in de conformationele verandering van het complex. Ter verbetering van de efficiëntie en de opsporing van de FRET, fluorophores en biosensoren met verbeterde helderheid en fotostabiliteit zijn van groot belang, die actief zijn ontworpen en studeerde28,39.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

De auteurs hebben niets te onthullen.

Acknowledgments

Wij danken Shu-Ou Shan (California Institute of Technology) voor inzichtelijke discussie over de ontwikkeling van de FRET assay. M.G., Y.Z. en X.L. werden gefinancierd door fondsen van het opstarten van Purdue University te Y.Z. en X.L.This werk gedeeltelijk werd gesteund door een subsidie van zaad van Purdue University Center voor plantenbiologie.

Materials

Name Company Catalog Number Comments
Anion exchange chromatography column GE Healthcare 17505301 HiTrap Q FF anion exchange chromatography column
Benchtop refrigerated centrifuge Eppendorf 2231000511
BL21 (DE3) Competent Cells ThermoFisher Scientific C600003
Calcium Chloride Fisher Scientific C78-500
Cation exchange chromatography column GE Healthcare 17505401 HiTrap SP Sepharose FF
Desalting Column GE Healthcare 17085101
Floor model centrifuge (high speed) Beckman Coulter J2-MC
Floor model centrifuge (low speed) Beckman Coulter J6-MI
Fluorescence SpectraViewer ThermoFisher Scientific https://www.thermofisher.com/us/en/home/life-science/cell-analysis/labeling-chemistry/fluorescence-spectraviewer.html
FluoroMax fluorimeter HORIBA FluoroMax-3
FPLC GE Healthcare 29018224
GGGGAMC peptide New England Peptide custom synthesis
Glutathione beads GE Healthcare 17075605
Glycerol Fisher Scientific G33-500
HEPES Fisher Scientific BP310-100
Isopropyl-β-D-thiogalactoside (IPTG) Fisher Scientific 15-529-019
LB Broth Fisher Scientific BP1426-500
Ni-NTA agarose Qiagen 30210
Ovalbumin MilliporeSigma A2512
pGEX-4T-2 vector GE Healthcare 28954550
Protease inhibitor cocktail MilliporeSigma 4693132001
Reduced glutathione Fisher Scientific BP25211
Refrigerated shaker Eppendorf M1282-0004
Rosetta Competent Cells MilliporeSigma 70953-3
Size exclusion chromatography column GE Healthcare 28990944 Superdex 200 10/300 GL column
Sodium Chloride (NaCl) Fisher Scientific S271-500
Stopped-flow fluorimeter Hi-Tech Scientific SF-61 DX2
TCEP·HCl Fisher Scientific PI20490
Thrombin MilliporeSigma T4648
Tris Base Fisher Scientific BP152-500
Ultrafiltration membrane MilliporeSigma UFC903008 Amicon Ultra-15 Centrifugal Filter Units, Ultra-15, 30,000 NMWL

DOWNLOAD MATERIALS LIST

References

  1. Stumpf, M. P. H., et al. Estimating the size of the human interactome. Proceedings of the National Academy of Sciences of the United States of America. 105, (19), 6959-6964 (2008).
  2. Kuzmanov, U., Emili, A. Protein-protein interaction networks: probing disease mechanisms using model systems. Genome Medicine. 5, (4), 37 (2013).
  3. Titeca, K., Lemmens, I., Tavernier, J., Eyckerman, S. Discovering cellular protein-protein interactions: Technological strategies and opportunities. Mass Spectrometry Reviews. 1-33 (2018).
  4. Lapetina, S., Gil-Henn, H. A guide to simple, direct, and quantitative in vitro binding assays. Journal of Biological Methods. 4, (1), 62 (2017).
  5. Zheng, X., Bi, C., Li, Z., Podariu, M., Hage, D. S. Analytical methods for kinetic studies of biological interactions: A review. Journal of Pharmaceutical and Biomedical Analysis. 113, 163-180 (2015).
  6. Pierce, N. W., et al. Cand1 promotes assembly of new SCF complexes through dynamic exchange of F box proteins. Cell. 153, (1), 206-215 (2013).
  7. Liu, X., Reitsma, J. M., Mamrosh, J. L., Zhang, Y., Straube, R., Deshaies, R. J. Cand1-Mediated Adaptive Exchange Mechanism Enables Variation in F-Box Protein Expression. Molecular Cell. 69, (5), 773-786 (2018).
  8. Zheng, N., et al. Structure of the Cul1-Rbx1-Skp1-F boxSkp2 SCF ubiquitin ligase complex. Nature. 416, (6882), 703-709 (2002).
  9. Kleiger, G., Deshaies, R. Tag Team Ubiquitin Ligases. Cell. 166, (5), 1080-1081 (2016).
  10. Zheng, J., et al. CAND1 binds to unneddylated CUL1 and regulates the formation of SCF ubiquitin E3 ligase complex. Molecular Cell. 10, (6), 1519-1526 (2002).
  11. Hwang, J. W., Min, K. W., Tamura, T. A., Yoon, J. B. TIP120A associates with unneddylated cullin 1 and regulates its neddylation. FEBS Letters. 541, (1-3), 102-108 (2003).
  12. Min, K. W., Hwang, J. W., Lee, J. S., Park, Y., Tamura, T., Yoon, J. B. TIP120A associates with cullins and modulates ubiquitin ligase activity. Journal of Biological Chemistry. 278, (18), 15905-15910 (2003).
  13. Goldenberg, S. J., et al. Structure of the Cand1-Cul1-Roc1 complex reveals regulatory mechanisms for the assembly of the multisubunit cullin-dependent ubiquitin ligases. Cell. 119, (4), 517-528 (2004).
  14. Chuang, H. W., Zhang, W., Gray, W. M. Arabidopsis ETA2, an apparent ortholog of the human cullin-interacting protein CAND1, is required for auxin responses mediated by the SCF(TIR1) ubiquitin ligase. Plant Cell. 16, (7), 1883-1897 (2004).
  15. Feng, S., et al. Arabidopsis CAND1, an Unmodified CUL1-Interacting Protein, Is Involved in Multiple Developmental Pathways Controlled by Ubiquitin/Proteasome-Mediated Protein Degradation. the Plant Cell Online. 16, (7), 1870-1882 (2004).
  16. Cheng, Y., Dai, X., Zhao, Y. AtCAND1, a HEAT-repeat protein that participates in auxin signaling in Arabidopsis. Plant Physiology. 135, (June), 1020-1026 (2004).
  17. Lo, S. -C., Hannink, M. CAND1-Mediated Substrate Adaptor Recycling Is Required for Efficient Repression of Nrf2 by Keap1. Molecular and Cellular Biology. 26, (4), 1235-1244 (2006).
  18. Okamoto, K., Sako, Y. Recent advances in FRET for the study of protein interactions and dynamics. Current Opinion in Structural Biology. 46, 16-23 (2017).
  19. Hussain, S. A. An introduction to fluorescence resonance energy transfer (FRET). arXiv preprint. (2009).
  20. Li, T., Pavletich, N. P., Schulman, B. A., Zheng, N. High-level expression and purification of recombinant SCF ubiquitin ligases. Methods in Enzymology. 398, (1996), 125-142 (2005).
  21. Popp, M. W., Antos, J. M., Grotenbreg, G. M., Spooner, E., Ploegh, H. L. Sortagging: A versatile method for protein labeling. Nature Chemical Biology. 3, (11), 707-708 (2007).
  22. Antos, J. M., Ingram, J., Fang, T., Pishesha, N., Truttmann, M. C., Ploegh, H. L. Site-Specific Protein Labeling via Sortase-Mediated Transpeptidation. Current Protocols in Protein Science. 89, (2017).
  23. Froger, A., Hall, J. E. Transformation of Plasmid DNA into E. coli Using the Heat Shock Method. Journal of Visualized Experiments. (2007).
  24. Simpson, R. J. SDS-PAGE of Proteins. Cold Spring Harbor Protocols. 2006, (1), (2006).
  25. Kleiger, G., Saha, A., Lewis, S., Kuhlman, B., Deshaies, R. J. Rapid E2-E3 Assembly and Disassembly Enable Processive Ubiquitylation of Cullin-RING Ubiquitin Ligase Substrates. Cell. 139, (5), 957-968 (2009).
  26. Biro, F. N., Zhai, J., Doucette, C. W., Hingorani, M. M. Application of Stopped-flow Kinetics Methods to Investigate the Mechanism of Action of a DNA Repair Protein. Journal of Visualized Experiments. (37), 2-8 (2010).
  27. Patel, J. T., Belsham, H. R., Rathbone, A. J., Friel, C. T. Use of Stopped-Flow Fluorescence and Labeled Nucleotides to Analyze the ATP Turnover Cycle of Kinesins. Journal of Visualized Experiments. (92), 1-6 (2014).
  28. Bajar, B. T., Wang, E. S., Zhang, S., Lin, M. Z., Chu, J. A guide to fluorescent protein FRET pairs. Sensors (Switzerland). 16, (9), 1-24 (2016).
  29. Chen, A. K., Cheng, Z., Behlke, M. A., Tsourkas, A. Assessing the sensitivity of commercially available fluorophores to the intracellular environment. Analytical Chemistry. 80, (19), 7437-7444 (2008).
  30. Lin, C. T., Rorabacher, D. B. Mathematical approach for stopped-flow kinetics of fast second-order reactions involving inhomogeneity in the reaction cell. Journal of Physical Chemistry. 78, (3), 305-308 (1974).
  31. Toseland, C. P., Geeves, M. A. Rapid Reaction Kinetic Techniques. Fluorescent Methods for Molecular Motors. 49-65 (2014).
  32. Adams, S. R., et al. New biarsenical ligands and tetracysteine motifs for protein labeling in vitro and in vivo: Synthesis and biological applications. Journal of the American Chemical Society. 124, (21), 6063-6076 (2002).
  33. Lin, C. W., Ting, A. Y. Transglutaminase-catalyzed site-specific conjugation of small-molecule probes to proteins in vitro and on the surface of living cells. Journal of the American Chemical Society. 128, (14), 4542-4543 (2006).
  34. Yin, J., et al. Genetically encoded short peptide tag for versatile protein labeling by Sfp phosphopantetheinyl transferase. Proceedings of the National Academy of Sciences of the United States of America. 102, (44), 15815-15820 (2005).
  35. Diaspro, A., Chirico, G., Usai, C., Ramoino, P., Dobrucki, J. Photobleaching. Handbook Of Biological Confocal Microscopy. 690-702 (2006).
  36. Aoki, K., Kamioka, Y., Matsuda, M. Fluorescence resonance energy transfer imaging of cell signaling from in vitro to in vivo: Basis of biosensor construction, live imaging, and image processing. Development, Growth & Differentiation. 55, (4), 515-522 (2013).
  37. Kilic, S., et al. Single-molecule FRET reveals multiscale chromatin dynamics modulated by HP1α. Nature Communications. 9, (1), (2018).
  38. Shen, K., Arslan, S., Akopian, D., Ha, T., Shan, S. O. Activated GTPase movement on an RNA scaffold drives co-translational protein targeting. Nature. 492, (7428), 271-275 (2012).
  39. Bajar, B. T., et al. Improving brightness and photostability of green and red fluorescent proteins for live cell imaging and FRET reporting. Scientific Reports. 6, (February), 1-12 (2016).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics