Lentiviral Vector plattform for effektiv levering av Epigenome-redigeringsverktøy i Human indusert Pluripotent Stamcelle-avledet sykdom modeller

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Målrettet DNA epigenome redigering representerer en effektiv terapeutisk tilnærming. Denne protokollen beskriver produksjon, rensing og konsentrasjonen av alt-i-ett lentiviral vektorer skjuler CRISPR-dCas9-DNMT3A-transgene for epigenome-redigering programmer i menneskelig indusert pluripotent stilk cellen (hiPSC)-avledet neurons.

Cite this Article

Copy Citation | Download Citations

Tagliafierro, L., Ilich, E., Moncalvo, M., Gu, J., Sriskanda, A., Grenier, C., Murphy, S. K., Chiba-Falek, O., Kantor, B. Lentiviral Vector Platform for the Efficient Delivery of Epigenome-editing Tools into Human Induced Pluripotent Stem Cell-derived Disease Models. J. Vis. Exp. (145), e59241, doi:10.3791/59241 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Bruk av hiPSC-avledet celler representerer en verdifull tilnærming å studere human nevrodegenerative sykdommer. Her beskriver vi en optimalisert protokoll for differensiering av hiPSCs avledet fra en pasient med triplication av alpha-synuclein genet (SNCA) locus i Parkinsons sykdom (PD)-relevante dopaminergic neuronal populasjoner. Samler bevis har vist at høye nivåer av SNCA er forårsaker for utvikling av PD. gjenkjenne den udekket må etablere nye behandlingsmetoder for PD, særlig de målretting regulering av SNCA uttrykk, vi nylig utviklet en CRISPR/dCas9-DNA-metylering-basert system for å epigenetically modulerer SNCA transkripsjon av berikende metylering nivåene på SNCA intron 1 regulatoriske regionen. Å levere systemet, som består av en død (deaktivert) versjon av Cas9 (dCas9) smeltet sammen med katalytisk domenet til DNA methyltransferase enzym 3A (DNMT3A), en lentiviral vektor brukes. Dette systemet er brukt på celler med triplication av SNCA locus og reduserer SNCA-mRNA og protein nivå ved ca 30% gjennom de målrettede DNA-metylering av SNCA intron 1. Den finjusterte downregulation av SNCA redder sykdom-relaterte mobilnettet fenotyper. I gjeldende protokollen, vi tar sikte på å beskrive en fremgangsmåte for å skille hiPSCs i nevrale stamceller (NPC) og etablering og validering av pyrosequencing analyser for evaluering av metylering profilen i SNCA intron 1. Hvis du vil disponere nærmere lentivirus-CRISPR/dCas9 systemet brukes i disse eksperimentene, beskriver denne protokollen hvordan å produsere, rense og konsentrere lentiviral vektorer og markere deres egnethet for epigenome - og genomet-redigering programmer som bruker hiPSCs og NPCer. Protokollen er lett tilpasses og kan brukes til å produsere høy titer lentiviruses for i vitro og in vivo programmer.

Introduction

Flere epigenome-redigering plattformer er nylig utviklet for å målrette noen DNA-sekvenser i regioner som kontrollerer gene expression1,2. De opprettede epigenome-redigeringsverktøy er utformet for å (i) regulere transkripsjon, (ii) endre posttranslational histone modifikasjoner, (iii) endre DNA metylering og (iv) modulerer regulatorisk element interaksjoner. Tilnærming til anker transkripsjon/chromatin modifiseringen til en deaktivert (død) Cas9 (dCas9) hevet fra tidligere utviklet epigenome-redigering plattformer, for eksempel sink finger proteiner (ZFPs) og transkripsjon aktivator som effektor (eventyr), skjuler et potent transcriptional effektor domene smeltet (ED) designet DNA-bindende domenet (DBD)3. Resultatene av ønsket fenotypen som aktivisering eller undertrykkelse er definert av effektor molekylet forankret til de endogene loci (figur 1). Hvis du vil opprette programmerbare transcriptional aktivator, er dCas9/gRNA moduler knyttet til VP164,5,6 (figur 1A), en viral aktivisering domene som rekrutterer Pol II og generell transkripsjon maskiner. Endring av dette systemet har inkludert VP64, en tetramer av VP16 domener, gir en enda mer robust aktivisering rate5,6. Systemet har vært vellykket ansatt å aktivere koding og noncoding av målretting arrangører og regulatoriske elementer. Viktigere, selv om VP64 molekyler ikke direkte endre chromatin strukturen i regionen mål, det rekrutter chromatin modifikatorer som binder resultater i deponering av aktiv (euchromatin) merker, inkludert som H3/H4 acetylation og H3-K4 di / Tri-metylering5,6. I tillegg til VP64, har p65 delenhet i menneskelig NF-κB komplekset blitt bundet til dCas9/gRNA modul7. Interessant, deling av disse effektor til regionene oppstrøms transkripsjon start områder (TSSs) og arrangører resulterer i en sterk genet induksjon. Likevel, VP64 og p65 effektor kan også utøve activatory effekten mens knyttet til regionene ligger nedstrøms TSSs og distale enhancers7,8. For å lokke fram en mer robust transcriptional reaksjon, trenger flere dCas9-VP64 eller dCas9-p65 fusjoner å bli rekruttert til en enkelt mål locus9,10. Som sådan, har den siste utviklingen av neste generasjons aktivator, som rekrutterer effektor domenene av en enkelt dCas9-gRNA-komplekset, som SunTag, resultert i en sterkere aktivisering funksjonen sammenligne dCas9-VP64 fusion kolleger11 , 12. en forbedret transcriptional aktivisering er innhentet gjennom fusjon av VP64, p65 og Rta (VPR), et transactivation-domene fra gamma-herpesviruses, til C-terminus dCas913 (figur 1A). Lignende CRISPR/dCas9-systemer har blitt utviklet for mål-spesifikke undertrykkelse (figur 1B).

Endogene genet undertrykkelse kan oppnås med utviklet repressor fusjoner gjennom en rekke mekanismer (figur 1B). Det har vist at CRISPR/dCas9 systemer, knyttet til repressor DBD (selv uten en effektor domene/s), kan effektivt slå genuttrykk mens bundet til en formidler eller oppstrøms/nedstrøms-TSS regioner3,6 ,14. Virkningene på transkripsjon er forårsaket av steric forstyrrelser av transkripsjon faktor bindende og RNA polymerase behandling. Likevel er mer omfattende tilnærminger nødvendig, som gene undertrykkelse av steric hindring alene er ofte ikke tilstrekkelig for robust stanse. Den siste utviklingen av den neste generasjonen av lyddempere basert på CRISPR/dCas9 systemer bærer transcriptional repressor domener (TRDs), histone modifikatorer (H3-K9 di-/ tri-metylering, H3-K27 di-/ tri-metylering; H3-K36 di-/ tri-metylering, H3/H4 deacetylation), og DNA (CpG) metylering førte til byggingen epigenetic verktøyer som mer robust stanse effekter4,5,15,16, 17,18,19,20. Det har blitt demonstrert at rekruttering av disse epigenetic modifikatorer til DNA kan føre til dannelse av mer lukket og kondensert chromatin, som vanligvis genererer en mer potent stanse utfallet21,22. Oftest stanse domenet brukes med DBDs er Krüppel-assosiert boks (KRAB)4,5. Rekruttering av faktor har vist tilsvarer chromatin endringer; Likevel er mekanismer for disse endringene ennå å bli belyst16,17,18. Nylig har det vært vist at lokaliseringen av KRAB DNA kan fremme montering av histone methyltransferase SETDB1 og histone deacetylation (HDAC) NuRD komplekser, antyder muligheten for at disse interaksjoner megle dannelsen av chromatin kondens og transcriptional stanse3,13. Som en alternativ tilnærming, kan effektor domener være smeltet å DBDs å opprette en egendefinert epigenetic stanse protein. Dette systemet gir direkte undertrykkende DNA merker eller histone modifikasjoner.

Bruk av syntetiske CRISPR/dCas9 systemer bundet til DNMT3A enzymet har nylig blitt repurposed for transcriptional deaktivering. DNMT3A gir DNA metylering som utøver transcriptional undertrykkelse gjennom dannelsen av heterochromatin på endogene genet arrangører og andre juridiske områder (figur 1B)18,20. McDonald et al.18 og Vojta et al.20 var første forfatterne rapporterer at DNA metylering kan brukes for epigenome-genet stanse eller undertrykkelse, demonstrere at plasmider levert dCas9-DNMT3A fusion systemet kan potently forbedre cytosine metylering rundt TSS18,20. McDonald og kolleger vist at bruken av strategien kan medføre en betydelig reduksjon (ca 40%) i en tumor suppressor genet nivåer CDKN2A mRNA18. Tilsvarende viser målretting regionen unmethylated promoter av BACH eller IL6ST genene økt CpG metylering som er forbundet med en todelt reduksjon i gene expression20. Våre lab har nylig tatt i bruk bruk av DNA metylering for demping patologisk utfallet av SNCA overuttrykte (figur 2)23. Strategien er basert på selektiv ekstrautstyr i DNA metylering i regionen SNCA intron 1 som det tidligere rapportert å være hypomethylated i PD og demens med Lewy organer (DLB) hjerner24,25, 26. Denne hypomethylation har vært knyttet til SNCA overuttrykte, dermed tilby en attraktiv mål for terapeutisk intervensjon24,27,28. Vi har nylig viste et lavt nivå av DNA metylering i SNCA intron 1 regionen i hiPSC-avledet dopaminergic NPCer innhentet fra en PD-pasient med SNCA triplication23. Fordelen med denne eksperimentelle modellen er at NPCer kan være robust overført i kultur eller videre differensiert i modne nerveceller, muliggjør en effektiv screening å identifisere genetiske faktorer som megle mobilnettet fenotyper, inkludert oksidativt stress og apoptose29. Videre, denne modellen gjør forskere til recapitulate utviklingsmessige hendelsene som oppstod før symptomdebut hos pasienter. I tillegg representerer hiPSC-avledet NPCer en stor verktøyet å teste cellulære og molekylære veier tilknyttet genuttrykk. Viktigere, kan hiPSC-avledet NPCer kombinert med state-of-the-art CRISPR/Cas9-epigenome teknologi forenkle utvikling av "neste generasjon narkotika" for mange nevrodegenerative sykdommer.

For å redusere patologisk nivåer av SNCA uttrykk, vi nylig utviklet et lentivirus-basert system med en dCas9-DNMT3A fusion protein og gRNA til spesifikt mål CpG metylering i SNCA intron 1 (figur 2A)23. Denne protokollen vil beskrive lentiviral vektor (LV) design og produksjon i detalj. LVs representerer et effektivt middel for å levere CRISPR/dCas9 komponenter av flere grunner, nemlig (i) deres evne til å bære store DNA setter, (ii) en høy effektivitet av transducing et bredt spekter av cellene, inkludert både dele og nondividing celler30 , og (iii) evnen til å indusere minimal cytotoksiske og immunogenic svar. Nylig vi brukt LV systemet på hiPSC-avledet dopaminergic neurons fra en pasient med triplication av SNCA locus og bevist terapeutisk potensialet i LVs for levering av epigenome-redigering metylering verktøy23 ( Finne 2B). Faktisk forårsaker en LV-gRNA/dCas9-DNMT3A systemet en betydelig økning i DNA metylering i regionen SNCA intron 1. Denne økningen tilsvarer reduksjon i nivåene av SNCA mRNA og protein23. Videre redder SNCA downregulation PD-relaterte fenotyper i SNCA triplication/hiPSC-avledet dopaminergic neurons (f.eks mitokondrie ROS produksjon og celle levedyktighet)23. Viktigere, viste vi at reduksjonen i SNCA uttrykk av LV-gRNA-dCas9-DMNT3A systemet er i stand til å reversere av fenotyper som er karakteristisk for hiPSC-avledet dopaminergic neurons fra en PD pasient som bar i SNCA triplication, som mitokondrie ROS produksjon og celle levedyktighet23. Målet med denne protokollen er 1) å skissere protokollen for produksjon og konsentrasjonen av en optimalisert LV plattform for å generere høy-tittered viral forberedelser og 2) for å beskrive differensiering av hiPSCs i NPCer mønster for å bli moden dopaminergic neurons31,32 og karakterisering av metylering målrettingsområde innen SNCA intron 1.

Lentiviral plattformer har en stor fordel over de mest populære vektor plattform, nemlig adeno-assosiert vektorer (AAVs), som har evnen til å imøtekomme større genetisk innsettinger33,34. AAVs kan genereres ved betydelig høyere avkastning, men har en lav emballasje kapasitet (< 4.8 kb), at deres bruk for å levere alt-i-ett CRISPR/Cas9 systemer. Dermed virker det som LVs ville være det plattform av valget i programmer som er involvert i gjennomføringen av CRISPR/dCas9 verktøy. Protokollen skissert her vil derfor være et verdifullt verktøy for forskere ønsker å effektivt levere epigenome-redigering komponenter til cellene og organene. Protokollen ytterligere skisserer strategi for å øke produksjonen og uttrykk evnene av vektorer via en endring i cis elementer innen vektor uttrykk kassett30,35. Strategien er basert på romanen system utviklet og studerte i vår lab og fremhever dens evne å tilvirke virus partikler i området 1010 viral enheter (VU) /mL30,35.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. system Design- og Virus

  1. Plasmider design og konstruksjon
    Merk: Byggingen av en alt-i-ett LV-gRNA-dCas9-DNMT3A vektor utføres ved hjelp av en produksjon- og uttrykk-optimalisert uttrykk kassett publisert av Ortinski et al.30. Vector kassetten bærer en gjentakelse av webområdet anerkjennelse av transkripsjon faktor Sp1 og en state-of-the-art sletting i den uoversatt (U3 ") en terminal 3-lang gjenta (VTH) (figur 2A)30,36-regionen. Vector ryggraden er funnet for å være effektive i å levere og uttrykke CRISPR/Cas930,35.
    1. Hente den deactivate (død) versjonen av SpCas9 (dCas9) via nettstedet-rettet mutagenese (data ikke vist). Erstatte klone skjuler D10A og H840A mutasjoner i HNH og RuvC katalytisk domener av enzym, henholdsvis med den aktive Cas9 i pBK30129 ved å bytte mellom AgeI-BamHI fragmenter (Figur 3).
    2. DNMT3A katalytisk domenet er avledet fra pdCas9-DNMT3A-eGFP (se Tabell for materiale) med forsterke DNMT3A del BamHI-429/R 5 '- GAGCGGATCCCCCTCCCG - 3' BamHI-429/L 5' - CTCTCCACTGCCGGATCCGG - 3' (Figur 3). For å forsterke regionen DNMT3A, bruker du følgende: (1) 95 ° C for 60 s, (2) 95 ° C for 10 s, (3) 60 ° C i 20 s, (4) 68 ° C i 60 s. Gjenta forhold 2 til 4 30 x. For endelig utvidelse, bruke 68 ° C til 3 min og holde 4 ° C.
    3. Klone DNMT3A fragmentet, fordøyd av en BamHI begrensning enzym, i BamHI-området i den endrede pBK301 vektoren bærer dCas9. Kontroller kloning av direkte Sanger sekvensering. Merk at den resulterte plasmider havner dCas9-DNMT3A-p2a-puromycin transgene. Plasmider uttrykker gRNA stillaset fra menneskelige U6 promoter (Figur 3).
    4. Erstatte puromycin reporter genet med grønne fluorescerende protein (GFP) til å opprette dCas9-DNMT3A-p2a-GFP. Fordøye dCas9-DNMT3A-p2a-Puro plasmider med FseI. Rense vektor fragmentet bruke en gel rensing. Klargjør innsatsen ved å fordøye pBK201a (pLenti-GFP) med FseI. Klone FseI fragmentet i vektoren. Resulterte plasmider pBK539 havner dCas9-DNMT3A-p2a-GFP transgene (Figur 3).
  2. Dyrking HEK-293T celler og plating celler for hva
    Merk: Menneskelige embryonale nyre 293T (HEK-293T) celler er kultivert i komplett høy-glukose Dulbecco modifiserte Eagle's medium (DMEM, 10% bovin kalv serum, 1 x antibiotika-antimycotic, 1 x natrium pyruvate, 1 x unødvendige aminosyre, 2 mM L-glutamin) på 37 ° C med 5% CO 2. for reproduserbarhet protokollen, anbefales det å teste kalv serum når du bytter til en annen mye/bakst. Opptil seks 15 cm er plater nødvendig for lentiviral produksjon.
    1. Bruk lav-passasjen celler for å starte en ny kultur (lavere enn passering 20). Når cellene når 90-95% samløpet, Sug opp media og forsiktig vaske det sterile 1 x fosfat-bufret saltvann (PBS).
    2. Legge til 2 mL trypsin-EDTA (0,05%) og ruge det ved 37 ° C i 3-5 minutter. Hvis du vil deaktivere dissosiasjon reagens, kan du legge 8 mL komplett høy-glukose DMEM og pipette 10 x-15 x med en 10 mL serologisk pipette opprette en enkeltcelle suspensjon av 4 x 106 celler/mL.
    3. For transfections, pels 15 cm plater med 0,2% gelatin. Legg 22,5 mL av høy-glukose medium og frø cellene ved å legge til 2,5 mL av cellen suspensjon (totalt ~ 1 x 107 celler/plate). Inkuber platene på 37 ° C med 5% CO2 til 70%-80% samløpet er nådd.
  3. Hva med HEK-293T celler
    1. Forberede 2 x BES-bufret løsning BBS og 1 M CaCl2, ifølge Vijayraghavan og Kantor35. Filtrere løsningene ved å føre dem gjennom en 0.22 µm og lagre dem på 4 ° C. Hva mix må være klare før sin tillegg til cellene. Hvis blandingen blir skyet under inkubasjonen, forberede frisk 2 x BBS (pH = 6.95).
    2. For å forberede blanding plasmider, bruke fire plasmider som oppført (følgende blandingen er tilstrekkelig for en 15 cm plate): 37,5 µg av CRISPR/dCas9-overføring vektoren (pBK492 [DNMT3A-Puro-NO-gRNA] eller pBK539 [DNMT3A-GFP-NO-gRNA]); 25 µg av pBK240 (psPAX2); 12.5 µg av pMD2.G; 6,25 µg av pRSV-rev (figur 4A). Beregne volumet av plasmider basert på konsentrasjonen og Legg ønsket antall i en 15 mL konisk rør. Legg 312,5 µL av 1 M CaCl2 og bringe det siste bindet 1,25 mL, bruker sterilt dd-H2O. forsiktig legge 1,25 mL av 2 x BBS-løsningen mens vortexing mix. Inkuber i 30 min ved romtemperatur. Cellene er klar for transfection når de er 70%-80% confluent.
    3. Sug opp media, og erstatte den med 22,5 mL nylagde høy-glukose DMEM uten serum. Legge til 2,5 mL av transfection blandingen dropwise i hver 15 cm plate. Swirl platene og ruge på 37 ° C med 5% CO2 for 2-3 h.
    4. Etter 3 h, Legg 2,5 mL (10%) av serum per plate og ruge over natten på 37 ° C med 5% CO2.
    5. På dag 1 etter transfection, observere cellene slik at det er ingen eller minimal celledød, og at cellene dannet en confluent kultur (100%).
      1. Endre media ved å legge til 25 mL av nylagde høy-glukose DMEM og 10% serum hver plate.
    6. Ruge på 37 ° C med 5% CO2 for 48 timer.
  4. Høsting av virus
    1. Samle nedbryting fra alle de transfekterte cellene og basseng dem i 50 mL konisk rør. Sentrifuge 400-450 x g for 10 min. filtrere nedbryting gjennom en 0,45 µm vakuum filter enhet. Etter filtrering kan nedbryting holdes på 4 ° C for kortsiktige lagring (opptil 4 dager). For langtidslagring, lage dele og lagre dem på-80 ° C.
      Merk: Nonconcentrated viral forberedelsene er forventet å være ~ 2 x 107 3 x 107 vu/mL (se delen 1.5 for titer vilje). Det anbefales å forberede engangs dele, siden flere fryse-Tin sykluser vil resultere i en 10%-20% tap i funksjonelle titers.
  5. Konsentrasjonen av virus partikler
    Merk: For rensing utført en to-trinns dobbel-sukrose metoden involverer en sukrose gradient trinn og en sukrose pute er (figur 4B).
    1. Hvis du vil lage en sukrose gradering, forberede koniske ultracentrifugation rør i følgende rekkefølge: 0,5 mL av 70% sukrose i 1 x PBS, 0,5 mL av 60% sukrose i DMEM, 1 mL av 30% sukrose i DMEM og 2 mL av 20% sukrose i 1 x PBS.
    2. Nøye, Legg til nedbryting, samlet i sprøyte 1.4, graderingen. Siden det totale volumet fra fire 15 cm plater er 100 mL, bruk seks ultracentrifugation rør behandle viral nedbryting.
    3. Like distribuere viral nedbryting blant hver ultracentrifugation rør. For å unngå tube brudd under sentrifugering, fyll ultracentrifugation rør til minst tre fjerdedel av deres totale volumkapasitet. Balanse rør med 1 x PBS. Sentrifuge prøvene 70.000 x g 2 h på 17 ° C.
      Merk: For å opprettholde sukrose laget under akselerasjon og deselerasjon trinnene, kan du ultracentrifuge å sakte akselerere og avta rotoren fra 0 til 200 x g og 200-0 x g under den første og siste 3 min spinn, henholdsvis.
    4. Forsiktig samle 30%-60% sukrose brøker i ren rør (figur 4B). Legge 1 x PBS (kald) opp til 100 mL totalvolum. Bland ved pipettering flere ganger.
    5. Nøye, stratify viral forberedelse på en sukrose pute ved å legge 4 mL av 20% sukrose (i 1 x PBS) til røret. Fortsett ved pipettering ~ 20-25 mL av viral løsningen per hver rør. Fyll rør med 1 x PBS Hvis volumet av innholdet er mindre enn tre fjerdedel per rør. Nøye balanse rørene. Sentrifuge 70.000 x g for 2t på 17 ° C. Tom nedbryting og invertere rørene på papirhåndklær å tillate de resterende væsken renne.
    6. Fjern alle flytende ved forsiktig aspirating gjenværende væsken. Merk at på dette trinnet, pellets som inneholder viruset er knapt synlig som små gjennomskinnelig flekker. Legge til 70 µL av 1 x PBS første røret for å resuspend pellet. Grundig Pipetter suspensjon og overføre den til neste røret til alle pellets er resuspended.
    7. Vask rør med en ekstra 50 µL av 1 x PBS og bland som før. Merk at på dette trinnet, volumet av siste suspensjon er ~ 120 µL og vises litt melkeaktig. For å få en klar suspensjon, kan du fortsette med en 60 s sentrifugering 10.000 x g. Overføre nedbryting til en ny tube gjøre 5 µL dele og lagre dem på-80 ° C.
      Merk: Lentiviral vector forberedelser er følsomme for gjentatte sykluser av fryses. I tillegg er det foreslått at trinnene er gjort i vev kultur forvaring eller i utpekte områder kvalifisert i form av å være på tilstrekkelig nivå av biosafety standarder (figur 4B).
  6. Kvantifisering av viral titers
    Merk: Estimering av viral titers utføres ved hjelp av p24 enzym knyttet immunosorbent analysen (ELISA) metoden (p24kneble ELISA) og ifølge National Institutes of Health (NIH) AIDS vaksine Program protokoll for HIV-1 p24 Antigen fange analysen med små endringer.
    1. Bruk 200 µL av 0,05% mellom 20 i kalde 1 x PBS (PBS-T) vask brønnene av en 96-brønns plate 3 x.
    2. For å coat platen, kan du bruke 100 µL monoklonale anti-p24 antistoff utvannet på 1:1,500 i 1 x PBS. Inkuber platen overnatting på 4 ° C.
    3. Forberede blokkerer reagens (1% bovin serum albumin [BSA] i 1 x PBS) og legge til 200 µL hver brønn å unngå uspesifikke bindende. Bruk 200 µL av PBS-T for å vaske den vel 3 x for minst 1 time i rom temperatur.
    4. Fortsett med eksempel utarbeidelse. Når du arbeider med konsentrert vektor forberedelser, fortynne vektoren på 1: 100 ved å bruke 1 µL av utvalget, 89 µL av dd-H20 og 10 µL av Triton X-100 (i en siste konsentrasjon på 10%). For nonconcentrated forberedelser, fortynne prøvene på 1:10.
    5. Få HIV-1 standarder ved hjelp av en todelt føljetong fortynning (Start konsentrasjonen er 5 ng/mL).
    6. Fortynne konsentrert prøvene (forberedt i trinn 1.6.4) i RPMI 1640 supplert med 0,2% mellom 20 og 1% BSA å få 1:10, 000, 1:50, 000, og 1:250,000 fortynninger. Tilsvarende fortynne nonconcentrated prøvene (forberedt i trinn 1.6.4) i RPMI 1640 supplert med 0,2% mellom 20 og 1% BSA å etablere 1:500, 1:2, 500, og 1:12,500 fortynninger.
    7. Legge til prøver og standarder på platen i triplicates. Ruge over natten på 4 ° C.
    8. Neste dag, vaske brønnene 6 x.
    9. Legg 100 µL polyklonale kanin anti-p24 antistoff, utvannet på 1:1,000 i RPMI 1640, 10% fosterets bovin serum (FBS), 0,25% BSA og 2% normal mus serum bruke og ruge på 37 ° C 4 h.
    10. Vask brønnene 6 x. Legge til geit anti-kanin pepperrotperoksidase IgG utvannet på 1:10,000 i RPMI 1640 supplert med 5% normal geit serum, 2% NMS, 0,25% BSA og 0,01% mellom 20. Inkuber ved 37 ° C i 1 time.
    11. Vask brønnene 6 x. Legg TMB peroxidase substrat og ruge ved romtemperatur i 15 min.
    12. For å stoppe reaksjonen, legge 100 µL av 1 N HCl. Microplate leser, måle absorbansen ved 450 nm.
  7. Måling av fluorescerende reporter intensitet
    1. Bruke viral suspensjon for å få en 10 ganger føljetong fortynning (fra 10-1 til 10-5) i 1 x PBS.
    2. Plate 5 x 105 HEK-293T celler i hver brønn av en 6-vel plate. 10 µL av hver viral fortynning gjelder cellene og ruge på 37 ° C med 5% CO2 for 48 timer.
    3. Videre til fluorescens-aktivert cellen sortering (FACS) analyse som følger: koble celler ved å legge til 200 µL 0,05% trypsin-EDTA løsning. Inkuber cellene på 37 ° C i 5 min og resuspend dem i 2 mL DMEM medium (med serum). Samle prøvene i en 15 mL konisk rør og sentrifuger 400 x g på 4 ° C. Resuspend pellet i 500 µL av kaldt 1 x PBS.
    4. Fastsette cellene ved å legge 500 µL av 4% paraformaldehyde (PFA) og ruge i 10 min ved romtemperatur.
    5. Sentrifuge 400 x g på 4 ° C og resuspend pellet i 1 mL 1 x PBS. Analysere GFP uttrykket i en FACS instrument, som beskrevet i Ortinski et al.30. For å avgjøre det virus funksjonelle titer, bruk følgende formel.
      Equation 1
      her
      VS = antall GFP-positive celler.
      TN = totalt antall celler.
      N = antall transduced celler.
      V = volum brukes for signaltransduksjon (i microliters).
  8. Telle GFP-positive celler
    Merk: Bestemme mangfoldet av infeksjon (MOI) som er ansatt for signaltransduksjon. Teste et bredt utvalg av MOIs (fra MOI = 1 MOI = 10).
    1. Frø 3 x 105 til 4 x 105 HEK-293T celler per hver brønn av en 6-vel plate.
    2. Når cellene nå > 80% samløpet, transduce dem med vektoren på MOI rundt.
    3. Ruge på 37 ° C med 5% CO2, og overvåke GFP signalet i cellene for 1-7 dager.
    4. Tell antall celler som GFP-positive. Ansette fluorescerende mikroskop (Plan 4 x mål, 0.1 N.A., 40 x forstørrelse) med et GFP-filter (eksitasjon bølgelengde = 470 nm, utslipp bølgelengde = 525 nm). Bruk untransduced celler for å angi befolkningen kontroll av GFP-negativ celler.
    5. Bruk følgende formel til å bestemme den funksjonelle titer av viruset.
      Equation 2
      her
      N = antall GFP-positive celler.
      D = fortynningsfaktoren;
      M = Forstørrelsesfaktoren;
      V = volum av viruset brukes for signaltransduksjon.
      Merk: Beregne resultatene etter dette eksemplet: for 10 GFP-positive celler (N) telles på en fortynning (D) av 10-4 (1:10, 000) på 20 x forstørrelse (M) i en 10 µL prøve (V), TU per milliliter blir (10 x 104) x (20) x (10) x (100) = 2 x 108 vu/mL.

2. differensiering av dopaminergic nevrale stamceller

  1. Dyrking hiPSCs
    Merk: hiPSCs fra en pasient med triplication av SNCA locus, ND34391, ble innhentet fra National Institute av nevrologiske lidelser og strek (NINDS) katalog (se tabell for materiale).
    1. Kultur hiPSCs mater-uavhengige vilkår i arkmateren uten ESC-iPSC kultur medium (se Tabell for materiale) på hESC-kvalifiserte grunnleggende matrix membran (BMM)-belagt plater (se Tabell for materiale). Vask confluent kolonier med 1 mL av DMEM/F12, Legg 1 mL av dissosiasjon reagens (se Tabell for materiale), og Inkuber for 3 min ved romtemperatur.
    2. Sug opp dissosiasjon reagensen og tilsett 1 mL av mater-fri ESC-iPSC kultur medium.
    3. Skrape platen med en celle lifter og resuspend koloniene i 11 mL mater-fri ESC-iPSC kultur medium av pipettering 4 x-5 x bruker borosilicate pipetter.
    4. Plate 2 mL kolonien suspensjon på BMM-belagt plater og Plasser platen på 37 ° C med 5% CO2. Utføre en daglig medium endring og dele cellene hver 5-7 dager.
  2. Differensiering inn dopaminergic nevrale stamceller
    Merk: Differensiering av hiPSCs i dopaminergic nevrale stamceller (MD NPC) utføres ved hjelp av en kommersielt tilgjengelig neural induksjon middels protokoll per produsentens instruksjoner, med små modifikasjoner31,32 ( se Tabellen for materiale). Den første dagen av differensiering regnes som 0. Høykvalitets hiPSCs er nødvendig for effektiv nevrale differensiering. Induksjon av MD NPCer er performedusing et embryoid organ (EB)-basert protokoll.
    1. Før du starter differensiering av hiPSCs, forberede en microwell kultur plate (se Tabell for materiale) i henhold til produsentens instruksjoner.
    2. Etter å forberede microwell kultur plate, Legg 1 mL av neural induksjon medium (NIM, se Tabellen for materiale) med 10 µM Y-27632.
    3. Avsette platen til klar til bruk.
    4. Vask hiPSCs med DMEM/F12, Legg 1 mL av cellen avdeling løsning (se Tabell for materiale), og Inkuber i 5 min på 37 ° C med 5% CO2.
    5. Resuspend enkeltceller i DMEM/F12 og sentrifuge dem 300 x g i 5 min.
    6. Nøye Sug opp nedbryting og resuspend cellene i NIM + 10 µM Y-27632 å få en endelig konsentrasjon av 3 x 106 celler/mL.
    7. Tilsett 1 mL av encellede suspensjon en enkelt brønn av microwell kultur plate og sentrifuge platen på 100 x g i 3 minutter.
    8. Undersøke platen under mikroskop for å sikre en jevn distribusjon av cellene blant microwell og ruge cellene på 37 ° C med 5% CO2.
    9. dager 1-4, kan du utføre en daglig delvis medium endring.
    10. Bruker 1 mL brønnene, fjerne 1,5 mL av mediet og kast. Sakte, legge til 1,5 mL frisk NIM uten Y-27632.
    11. Gjenta trinn 2.2.10 til dag 4.
    12. dag 5, pels en brønn av en 6-vel plate med BMM.
    13. Plassere en 37 µm reversibel sil (se Tabell for materiale) på en 50 mL konisk tube (avfall). Velg pilen reversibel silen oppover.
    14. Fjerne mediet fra microwell kultur plate uten å forstyrre dannet EBs.
    15. Legg 1 mL av DMEM/F12 og raskt samle EBs med borosilicate pipette og filtrere dem gjennom silen.
    16. Gjenta trinn 2.2.15 til alle LoF fjernes fra microwell kultur plate.
    17. Invertere silen over en ny 50 mL konisk tube og legge 2 mL NIM å samle alle EBs.
    18. Plate 2 mL EB suspensjon i en enkelt brønn av BMM-belagt platen ved hjelp av en borosilicate pipette. Inkuber EBs på 37 ° C med 5% CO2.
    19. dag 6, forberede 2 mL NIM + 200 ng/mL SSH (se Tabell for materiale) og utføre en daglig medium endring.
    20. dag 8, undersøke prosentandelen av neuronal induksjon.
    21. Telle alle tilknyttede EBs og, spesielt, bestemme antall hver individuelle EB som er fylt med nevrale rosetter. Kvantifisere nevrale rosett induksjon ved hjelp av følgende formel.
      Equation 3
      Merk: Hvis neural induksjon er < 75%, neural rosett valg kan være ineffektiv.
    22. dag 12, forberede 250 mL av N2B27 medium med 119 mL neurobasal medium, 119 mL av DMEM/F12 medium, 2,5 mL av GlutaMAX, 2,5 mL av NEAA, 2,5 mL N2 supplement, 5 mL av B27 uten vitamin A, 250 μL Gentamicin (50 mg/mL) , og 19. 66 μL BSA (7 mg/mL).
    23. For å forberede 50 mL av komplett N2B27 medium, legge 3 μM CHIR99021, 2 μM SB431542, 20 ng/mL bFGF, 20 ng/mL EGF og 200 ng/mL SSH.
      Merk: Det er viktig å forberede det fullførte middels rett før bruk.
    24. Sug opp medium fra brønnene som inneholder nevrale rosetter og vaskes med 1 mL av DMEM/F12.
    25. Ad 1 mL av nevrale rosett utvalg reagens (se Tabell for materiale) og Inkuber på 37 ° C med 5% CO2 for 1 h.
    26. Fjerne utvalg reagensen og bruker en 1 mL hindre, sikt direkte mot rosett klynger.
    27. Legge til suspensjon slik 15 mL konisk Gjenta trinn 2.2.25 og 2.2.26 til fleste nevrale rosett klynger er samlet.
      Merk: For å unngå forurensning med nonneuronal celletyper, ikke overselect.
    28. Sentrifuge rosett suspensjon 350 x g for 5 min. leveringstanken nedbryting og resuspend nevrale rosetter i N2B27 + 200 ng/mL SSH. Legg nevrale rosett suspensjon til et BMM-belagt godt og ruge platen på 37 ° C med 5% CO2.
    29. dager 13 – 17, utføre en daglig medium endring ved hjelp av fullført N2B27 medium. Passasje cellene når kulturer er 80-90% confluent.
    30. For å dele cellene, forberede en BMM-belagt plate.
    31. Vask cellene med 1 mL av DMEM/F12, Sug opp mediet og legge 1 mL av dissosiasjon reagens (se Tabell for materiale).
    32. Inkuber i 5 min på 37 ° C, Legg 1 mL av DMEM/F12, og fjerne tilknyttede celler av pipettering opp og ned. Samle NPC suspensjon i et 15 mL konisk rør. Sentrifuger 300 x g i 5 min.
    33. Sug opp nedbryting og resuspend cellene i 1 mL av komplett N2B27 + 200 ng/mL SSH.
    34. Telle celler plate dem på en tetthet på 1,25 x 105 celler/cm2og ruge cellene på 37 ° C med 5% CO2.
    35. Endre mediet annenhver dag, med komplett N2B27 + 200 ng/mL SSH.
      Merk: I denne passasjen, NPCer regnes som passasjen (P) 0. SSH kan trekkes fra N2B27 middels på P2.
    36. Passasje cellene når de når 80-90% samløpet.
    37. På dette stadiet, kan du bekrefte at celler uttrykke markører Nestin og FoxA2 med immunocytochemistry og qPCR. Denne protokollen fører til generering av 85% dobbel-positive celler for markører for Nestin og FoxA2.
    38. For passaging celler, gjentar du trinn 2.2.31–2.2.36.
    39. Fryse cellene, fra passasje P2. Frysing av celler, Gjenta trinn 2.2.31–2.2.36 og resuspend celle pellet på 2 x 106 til 4 x 106 celler/mL bruker kaldt nevrale frysing medium (se Tabell for materiale).
    40. Overføre 1 mL av cellen suspensjon i hver cryovial og fryse celler ved hjelp av et standard langsom-rate-kontrollerte kjølesystem. For langvarig lagring, holde cellene i flytende nitrogen.
  3. Tiner MD NPCer
    1. Forberede en BMM-belagt plate og varme fullstendig N2B27. Legge til 10 mL av varm DMEM/F12 i en 15 mL konisk rør. Sett en cryovial i en 37 ° C varme blokk i 2 minutter.
      1. Overføre cellene fra cryovial til røret som inneholder DMEM/F12. Sentrifuger 300 x g i 5 min.
      2. Sug opp nedbryting, resuspend cellene i 2 mL N2B27 og legge til celle suspensjon i en brønn av BMM-belagt plate. Inkuber cellene på 37 ° C med 5% CO2.

3. signaltransduksjon MD NPCer og analyse av metylering endringer

  1. Signaltransduksjon av MD NPCer
    1. Transduce MD NPCer på 70% samløpet med LV-gRNA/dCas9-DNMT3A vektorer på MOI = 2. Erstatte N2B27 middels 16 h posttransduction.
    2. Legg til N2B27 med 5 µg/mL puromycin, 48 timer etter signaltransduksjon. Kultur cellene i 3 uker i N2B27 pluss puromycin for å få stabile MD NPC linjene. Cellene er klar for nedstrøms programmer (DNA, RNA, protein analyser, fenotypiske karakterisering23, frysing og passaging).
  2. Karakteristikk av metylering profilen SNCA intron 1
    1. Ekstra DNA fra hver stabilt transduced celle linje med en DNA utvinning kit (se Tabell for materiale).
    2. Bruk 800 ng DNA å utføre en bisulfite konvertering, ved hjelp av en kommersielt tilgjengelig kit (se Tabell for materiale). Etter omregningen bisulfite elute DNA bisulfite-konvertert til 20 ng/µL.
  3. PCR for pyrosequencing analyse
    1. Klargjør PCR master blandingen i en nuclease-fri rør. For hver reaksjon, bruke 0,4 µL av omvendt primer (10 µM), 0.4 µL av fremover primer (10 µM), 1.6 µL av MgCl2 (25 mM), 2 µL av 10 x CoralLoad konsentrere seg, 10 µL av 2 x PCR master mix, 4 µL av 5 x Q-løsning, 1 µL av DNA , og 0,6 µL nuclease uten vann.
    2. Overføre reaksjon platen til en thermocycler og utføre PCR bruker følgende: 95 ° C i 15 min, 50 kretsløpene 94 ° c for 30 s, 56 ° C for 30 s og 72 ° C i 30-s, med et siste 10 min utvidelse skritt på 72 ° C. Primere brukt for pyrosequencing av SNCA intron 1 er oppført i tabell 1og figur 7A supplerende figur 1.
    3. Etter forsterkning, visualisere amplicons 2 µL av PCR produkt med ethidium bromide flekker, følgende agarose gel geleelektroforese.
    4. Pyrosequencing analyser godkjennes ved hjelp av blandinger av unmethylated (U) og denaturert (M) bisulfite-konvertert DNAs i de følgende prosenter, nemlig 100U:0M, 75U:25M, 50U:50M, 25U:75M og 0U:100M (se Tabell for materiale).
    5. Utføre pyrosequencing med pyrosequencing reagenser (se Tabell for materiale) og beregne metylering verdiene for hvert CpG område med pyrosequencing programvare. En detaljert pyrosequencing-protokollen, se Bassil et al.37.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Validering av produksjon titers av LV-dCas9-DNMT3A-GFP/Puro vektorer sammenlignet naive GFP motpart

Vi utførte p24kneble ELISA sammenligne mellom fysiske titers i LV-dCas9-DNMT3A-GFP/Puro med de naive GFP/Puro kolleger. Representant resultater, presentert i figur 5A, viser at fysisk avkastning av vektorer, generert ved hjelp av protokollen her skissert, er sammenlignbare. Dette tyder på at nytten av optimalisert vektor ryggraden, kombinert med optimalisert produksjon protokollen, gir høy avkastning titer av CRISPR/dCas9 vektorer. For å evaluere effektiviteten av emballasjen på dCas9-DNMT3A transgene i viral partikler, utført vi en signaltransduksjon av konsentrert vektoren i HEK-293T celler (figur 5B). Uansett, resultatene i figur 5A viste at signaltransduksjon prisene i LV-dCas9-DNMT3A-GFP-vektoren var betydelig lavere enn naive GFP vektor (figur 5B). Den funksjonelle titer i LV-dCas9-DNMT3A-GFP-vektoren var faktisk fire ganger lavere enn naiv motstykke, antyder at emballasjen effektiviteten av den CRISPR/dCas9 er redusert. Videre dannet LV-dCas9-DNMT3A-Puro vektoren puromycin-resistente kolonier på var femdoblet lavere sammenlignet med naiv-Puro motparten. Vi testet effektiviteten av Albin på LV-dCas9-DNMT3A-Puro vektorer i MD NPCer. Dette celler ble transduced med en naiv LV-GFP vektor og LV-dCas9-DNMT3A-Puro på MOI = 1. Som vist i figur 5C, var signaltransduksjon ratene av Puro kontroll vektoren femdoblet høyere sammenlignet med dCas9-DNMT3A vektoren. Disse resultatene ble bekreftet ved å bruke GFP versjoner av vektorer (figur 5 d). Som foreslått i delen diskusjon med lavere emballasje/uttrykk kjennetegner LV-epigenome-redigering systemet beskrevet her, er sin nivåer tilstrekkelig til å indusere bærekraftig DNA metylering på målet sekvenser. Videre kan disse egenskapene forbedres ved å skalere opp produksjon prosedyren.

Differensiering av MD NPCer

EB-basert protokoll beskrevet her kan differensiering av MD NPCer (figur 6A). Vi vurdert differensiering prosessen ved hjelp av spesifikke indikatorer på ulike stadier. hiPSCs uttrykt pluripotency markør OCT4, mens MD NPCer uttrykt både Nestin og FOXA2 (figur 6 C). Tidligere rapporterte vi at denne differensiering protokollen gir 83.3% av celler som er dobbel positivt for det Nestin og FOXA2 markører31, bekrefter vellykket differensiering av disse cellene. Minst må 75%-80% av cellene vise celle-spesifikke markører. En lavere avkastning (< 50%) positiv celleområde etter markører vil kreve en annen differensiering protokoll.

Validering av pyrosequencing søk for SNCA intron 1 metylering profil

Syv pyrosequencing analyser (tabell 1, utfyllende figur 1, figur 7A) ble designet og godkjent for kvantifisering av metylering status SNCA intron 1. Chr4: 89,836,150-89,836,593 (GRCh38/hg38) regionen inneholder 23 forbruksvarer. Designet analyser ble godkjent for linearitet bruker forskjellige blandinger av unmethylated (U) og denaturert (M) bisulfite-konvertert DNAs som standarder. Blandinger ble brukt i de følgende prosenter, nemlig 100U:0M, 75U:25M, 50U:50M, 25U:75M og 0U:100M. Alle syv analyser ble godkjent (figur 7B) og viste lineær sammenheng R2 > 0.93. Analyser som ikke ble validert ble redesignet. Bruker de validerte analyser, var det mulig å fastslå metylering nivåene på de 23 forbruksvarer i SNCA intron 1 (figur 7C).

Figure 1
Figur 1: Epigenome-redigeringsverktøy for genet aktivisering og undertrykkelse. (A) lukket konformasjon av DNA viser heterochromatin organisasjonen. Effektor molekylene, inkludert VP64, P65, rta, DNA demethylation enzym og tet-1 kan bli rekruttert til den regulatoriske regioner (arrangører, introns, etc.) via sammenkobling med dCas9-gRNA system. Rekruttering av systemet gir chromatin remodeling som fører til etablering av åpne chromatin organisasjonen (euchromatin) som er forbundet med gene aktivisering. (B) Epigenome-baserte stanse kan oppnås ved rekruttering dCas9 repressory komplekser, inkludert KRAB, HDACs og DNA metylering enzym, DNMT3A til den regulatoriske regioner (arrangører, introns, etc.) via tethering med gRNA komponent. Rekruttering av systemet resultatene i genet deaktivering (demping), forbundet med DNA chromatin remodeling, og veddemålsplasseringer av generelle transkripsjon maskiner chromatin struktur. Klikk her for å se en større versjon av dette tallet.

Figure 2
Figur 2: utformingen av lentiviral vektorer for målrettet DNA metylering innen SNCA triplicated loci. (A) i produksjon og uttrykk-optimalisert vektor ryggraden er beskrevet i detalj av Kantor et al.23, Ortinski et al.30og Vijayraghavan og Kantor35. Merknadene vektoren cis elementer er en vektor emballasje element (ψ, psi), Rev svar elementet (RRE), Sp1 bindende områder (Sp1), menneskelige U6 promoter (hU6), en kjerne-forlengelse faktor 1α promoter (EFS-NC) og hepatitt hakkespett posttranscriptional regulerende element (WPRE). (B) skjematisk fremstilling av SNCA triplicated locus. DNA metylering er en viktig transcriptional regulering mekanisme som direkte eller indirekte begrenser DNA tilgjengelighet21. Økt SNCA uttrykk ble observert tilfeldigvis å lave CpG metylering nivåer SNCA intron 1 (grønne pilene etiketten aktivert gene expression staten triplicated SNCA locus). Rekruttering av LV-gRNA/dCas9-DNMT3A vektorer teeter methyltransferase enzymet i SNCA intron 1 regionen. Dette resulterer i montering av lukkede chromatin som resulterer i den transcriptional downregulation av SNCA (røde piler). Klikk her for å se en større versjon av dette tallet.

Figure 3
Figur 3: bygging av en lentiviral vektor uttrykk kassett bærer dCas9-DNMT3A transgene. Foreldrekontroll vektoren, pBK301, er beskrevet i Ortinski et al.30. Vektoren ble klonet med dCas9-DNMT3A-Puro (pBK492) eller dCas9-DNMT3A-GFP (pBK539) (kloning strømmen kan bli funnet i protokollen og Kantor et al.23). Klikk her for å se en større versjon av dette tallet.

Figure 4
Figur 4: Lentiviral vektor emballasje, produksjon og rensing. (A) forbigående transfection protokoll som brukes for produksjon av LV-gRNA/dCas9-DNMT3A. Vil generere vektorer, HEK-293T celler var transfekterte med vesicular stomatitt virus G-protein (VSV-G), emballasje og uttrykk plasmider23. Virus partikler ble Hentet fra kultur supernatants. Den andre generasjonen av pakkesystemet ble brukt til å supplere uttrykk kassettene. Systemet næret Tat og Rev proteiner. Rev plasmider, pRSV-REV, ble supplert separat. Forkortelser: pCMV = cytomegalovirus promoter; LTRs = lang terminal gjentar; VSV-G = vesicular stomatitt virus G-protein; RRE = Rev svar element; SP1 = transkripsjon faktor Sp1 bindende områder; Ψ = emballasje vektorelementene (psi); WPRE = hakkespett hepatitt virus posttranscriptional regulatorisk element; EFS-NC = en kjerne-forlengelse faktor 1α promoter; hU6 = human U6 promoter. (B) vektoren rensing og konsentrasjonen er utført som følger: dobbel-sukrose gradient protokollen ble brukt til å rense og konsentrere virus partikler etter forbigående transfection (se ovenfor). Kort, kultur nedbryting (SN) var samlet og lastet på sukrose gradering. Hvis du vil opprette gradient, 70%, 60%, 30% og 20% sukrose løsninger oppløst i 1 x PBS ble brukt. Det andre trinnet i rensing inkludert ultracentrifugation mot en pute av 20% sukrose. Det dannet pellet var resuspended i 1 x PBS. Klikk her for å se en større versjon av dette tallet.

Figure 5
Figur 5: evaluering av viral titers. (A) p24 ELISA-analysen. En tittering prosedyre er utført som beskrevet av Kantor et al.23. Naive (GFP) vektoren er uthevet i den sorte ruten. LV-dCas9-DNMT3A-Puro vektor (lyseblå bar) og LV-dCas9-DNMT3A-GFP vektor (grønne linjen) er også markert. Fysisk partikkel produksjonen av vektorer er evaluert. Resultatene registreres i kopi tall per milliliter, der 1 ng av p24kneble = 1 x 104 virus partikler. Søylediagram dataene representerer den gjennomsnittlig ± SD fra tre uavhengige eksperimenter. (B) evaluering av de funksjonelle titers etter signaltransduksjon inn HEK-293T celler. Det Puro inneholder LVs ble transduced i HEK-293T celler som beskrevet i representant resultater. De funksjonelle titers av viral produksjonen ble målt ved å telle antall kolonier etter puromycin utvalg. Resultatene ble beregnet som forholdet mellom antall kolonier fra lentiviral vektor-Puro (kontroll vektor) i forhold til dCas9-DNMT3A-Puro motparten. Stolpediagrammet representerer den gjennomsnittlig ± SD fra tre uavhengige eksperimenter. (C) evaluering signaltransduksjon effektivitet og uttrykk for vektorer i HEK-293T celler (øvre panel) og NPCer (nedre panel). Venstre panelene representerer naiv (GFP) vektor transductions. Høyre panelene representerer dCas9-DNMT3A-GFP vektoren transductions. Tre dager posttransduction, bildene ble samlet med fluorescens mikroskop (40 x). (D) evaluering av de funksjonelle titers etter signaltransduksjon inn NPCer. Det Puro inneholder LVs var transduced i NPCer som beskrevet i representant resultater og resultatene ble beregnet som panelet B. Stolpediagrammet representerer den gjennomsnittlig ± SEM av tre biologiske replikerer. Forkortelser: HEK-293T = menneskelige embryonale nyre 293T; NPCer = nevrale stamceller. Klikk her for å se en større versjon av dette tallet.

Figure 6
Figur 6: differensiering og karakterisering av hiPSC-avledet MD NPCer. (A) tidslinjen viser differensiering av hiPSC-avledet MD NPCer. kvantifisering av MD NPC markører (B og C) immunocytochemistry og (D og E) sanntid (RT) PCR. Nivåene av hver mRNA ble beregnet i forhold til den geometriske middelverdien for GAPDH-mRNA og PPIA-mRNA referanse kontroller med metoden 2- ΔΔCT . Hver kolonne representerer gjennomsnittet av to biologiske og tekniske replikat. Feilfeltene representerer SEM. Klikk her for å se en større versjon av dette tallet.

Figure 7
Figur 7: kvantitative validering av pyrosequencing søk målretting SNCA intron 1. (A) oversikt over pyrosequencing analyser i SNCA intron 1. (B) det designet analyser ble validert ved hjelp av ulike forhold av unmethylated (U) og denaturert (M) bisulfite-konvertert DNA, nemlig 100U:0M, 75U:25M, 50U:50M, 25U:75M og 0U:100M. (C) validert analyser ble brukt for å måle andelen metylering av de 23 forbruksvarer i SNCA intron 1 i hiPSC-avledet MD NPCer fra en pasient med triplication av SNCA locus. Barer representerer gjennomsnittet av andelen denaturert forbruksvarer to uavhengige eksperimenter, og de viser SEM. Klikk her for å se en større versjon av dette tallet.

Analysen # Primer frem (5 - 3') Primer omvendt (5 - 3') Sekvensering Primer (5 - 3') CpG dekket
1 TTTTTGGGGAGTTTAAGGAAAGA AACCTCCTTACACTTCCATTTCAT * GGGGAGTTTAAGGAAAGA 1
2 TGGGGAGTTTAAGGAAAGAGATTT ACCTCCTTACACTTCCATTTCATT * GGTTGAGAGATTAGGTTGTT 2,3,4,5,6,7
3 TTGGGGAGTTTAAGGAAAGAGAT ACCTCCTTACACTTCCATTTCATT * AGAGAGGATGTTTTATG 7,8
4 TTTTTGGGGAGTTTAAGGAAAGA * CCTCCTTACACTTCCATTTCATT CTTACACTTCCATTTCATTAT 9,8
5 TGGGGAGTTTAAGGAAAGAGATTT CCCTCAACTATCTACCCTAAACA * GAGTTTGGTAAATAATGAA 10, 11, 12, 13, 14, 15, 16, 17
6 GTGTAAGGAGGTTAAGTTAATAGG ACAACAAACCCAAATATAATAATTCTAAT * AGGTTAAGTTAATAGGTGGTAA 17, 18, 19, 20, 21, 22
7 TTTTTGGGGAGTTTAAGGAAAGA * CTCAAACAAACAACAAACCCAAAT CTCAAACAAACAACAAACCCAAAT 23, 22, 21, 20
* Angir biotyniliated primere

Tabell 1: Pyrosequencing søk for vurdering av SNCA intron 1 CpG metylering nivåer.

Supplerende figur 1: oversikt over pyrosequencing søk i SNCA intron 1. Klikk her for å laste ned denne filen.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

LVs har begynt å dukke opp som bilen av valget for epigenome redigering, spesielt i sammenheng med genetiske sykdommer, hovedsakelig på grunn av deres evne til å (i) tilpasse store DNA nyttelast og (ii) effektivt transduce en rekke dele og nondividing celler. Store emballasje effekten av LVs er spesielt gunstig for programmene som involverer emballasje av CRISPR/dCas9 som er for store. Fra dette perspektivet representerer LVs det plattform av valget for levering av alt-i-ett CRISPR/Cas9 systemer. Faktisk er AAV plattformen, som er ofte ansatt for prekliniske og kliniske gene terapi programmer, ikke fullt i stand til å imøtekomme store tilpassede størrelser av dCas9-effektor. Faktisk er de strenge forpakningsbehov av AAV vektorer forbyr bruken for levering av CRISPR/dCas9 komponenter. For å forbedre AAV emballasje evne, er flere romanen AAV-baserte plattformer utviklet. For eksempel konstruert en delt-intein tilnærming skille en Cas9 systemet inn to AAV kassetter har vært nylig38. Tilnærmingen har økt samlet emballasje kapasitet; Det kreves imidlertid produksjon og cotransduction to AAV vektorer38. Oppdagelsen av SaCas9, utledet fra Staphylococcus aureus, tillot utviklingen av SaCas9/guide RNA systemet39,40. SaCas9 er en kortere, men like potent Cas9 enzym, enkelt pakket inn AAV vektorer. In vivo eksperimenter har vist at dette systemet effektivt mål kolesterol regulatory genet PCSK940. Likevel trenger emballasje effektiviteten av alt-i-ett AAV vektorer ytterligere forbedring. Vurderer klare fordeler av LV leveringssystem, vi nylig utviklet og brukt en lentiviral ryggraden-næret dCas9-DNMT3A transgene, samt en gRNA stillaset. For å teste terapeutiske potensialet i dette nye systemet, brukt vi det PD hiPSC-avledet neurons gjennomført SNCA loci triplication23. Vi validert effektiviteten av dette systemet som resulterte i den finjusterte downregulation SNCA-mRNA og protein nivå23. Viktigere, vist systemet evnen til å redde sykdom-relaterte mobilnettet fenotyper, tyder det store potensialet av tilnærming for epigenome-basert behandling23.

For å øke produksjonen av vektorer, vi nylig introdusert flere endringer i vektor uttrykk kassetten, inkludert integrering av Sp1 områder, sletting i 3' LTR og en nedbemanninger av uttrykket plasmider (se neste avsnitt)30 .

Endringer i eksisterende plattformer

Produksjonsmetoden presenteres her gjør det mulig for generering av LV-CRISPR/dCas9 vektorer på titers i området fra 1 x 1010 vu/mL (figur 5). Som fremhevet ovenfor, for å oppnå høyere produksjon titers, vi lagt en gjentakelse av webområdet transkripsjon faktor Sp1-binding til en alt-i-ett-CRISPR/Cas9 uttrykk vektor kassett og introduserte en state-of-the-art sletting i regionen U3 av 3' LTR. Disse endringene resulterte i en betydelig oppregulering i vektor emballasje effektivitet (~2.5x) samt et transgene uttrykk (ca sevenfold)30,35. Disse forbedringene er i samsvar med tidligere genererte data41,42,43,44.

Avgjørende skritt og feilsøking

Optimalisert vektor kassetten, pakket inn i virus partikler, genererer titers ca 1 x 1010 vu/ml per ~ 5 x 107 produsent celler. Ved produksjon av vektorer på lavere titers anses følgende forbedringer. 1) bruk HEK-293T celler i noen lav passasje. Erstatte cellene regelmessig etter ≥20 passasjer. Erstatt dessuten cellene når de viser en langsom vekst. 2) rutinemessig sjekk komponentene i mediet siden de kan bidra til endringer i viruset titer. Erstatte fosterets serum med kostnadseffektiv kosmiske kalv serum. 3) forskjellige linjer brukes for vektor generasjon vise forskjellige produksjon fitness. For eksempel HEK-293T cellene er i stand til å generere vektorer på nivåer som er høyere enn HEK - 293FT cellene med tre ganger (data ikke vist). 4) den optimale hva ville oppnås når celler på 70%-80% samløpet. Lavere tettheter vil resultere i tidlig celledød som faktor viral toksisitet. Men ville de høyere tettheten føre til en betydelig reduksjon i produksjonseffektivitet. Som hovedregel bør celle tetthet før transfection tillate at cellene å dele en gang før å etablere en fullt confluent kultur. 5) transfection titers avhenger også pH i BBS reagensen. Som en generell regel foreslår vi testing et nytt parti av BBS i en pilot transfection før bruk. 2 x BBS pH skal 6.95.

Produksjon gir versus signaltransduksjon effektivitet/uttrykk

Det bør være påpekte at selv om Sp1-LVs bærer CRISPR/dCas9 effekter av transgener kan generere titers i 1 x 1010 vu/mL per ~ 5 x 107 produsent celler, som er sammenlignbare med en naiv vektor (figur 5A), den effektiviteten av emballasje av virus er betydelig svekket med dCas9-DNMT3A transgene. Faktisk viser vi en ca femdoblet reduksjon av funksjonelle titers og uttrykk mulighetene i LV-dCas9-DNMT3A-Puro/GFP vektorer (figur 5B-D). Reduksjon i emballasje effektiviteten og uttrykk for vektorer kan være et resultat av DNMT3A overuttrykte. I denne forbindelse har det vært vist at DNA metylering kan spille en viktig rolle i å kontrollere HIV-1 replikering og dets genuttrykk. Derfor vil det være nødvendig å avgjøre om LVs er underlagt en lignende regulering, og hvis det er tilfelle, å utvikle strategier for å induserbart-silence DNMT3A aktiviteten under vektor produksjon scenen. Til tross for en lavere produksjon avkastning viser vektorer anstendig funksjonelle titers (i lave 109 -serien, som bør være nok mange programmer, inkludert de som krever i vivo levering). Det er verdt å merke seg at produksjonen prosedyren kan være lett oppskalert, som omtalt i review, hvilke burde tillate matchende til titers med andre uttrykk systemer.

Vector håndtering og sikkerhet

Vil generere LVs, anses følgende sikkerhet poeng. Først krever LVs biosikkerhet nivå 2 beholdere. Til tross for den relative sikkerheten av LVs (som stammer fra deres SIN natur), har gjenværende transcriptional aktivitet vært demonstrert22. Videre kan LV genomer reddes av HIV-122. På grunn av alt dette anbefaler vi utfører replikering kompetanse analyser (spesielt på konsentrert forberedelsene). For prosedyrer om håndtering av lentiviruses, vi refererer her til biosikkerhet i mikrobiologisk og biomedisinsk laboratorier, 4th edition, utgitt av Centers for Disease Control (CDC, tilgjengelig online). For klinisk bruk, kan du bruke tredje generasjon av pakkesystemet. Det bør imidlertid bemerkes at bruken av tredje generasjon av emballasje knytter lavere titers sammenligne med de andre generasjon emballeringssystemer.

Betydning og fremtidige retninger

Romanen plattformen skissert her forbedrer stadig voksende verktøykassen for levering av epigenome-redigering komponenter og andre molekylære Last til cellene og organene. Til tross for den siste utviklingen i utviklingsland HIV-1-baserte systemer demonstrere bare noen plattformer bærekraftig avkastningen av viral produksjon. Optimalisering av vektor ryggraden rapporterte her gjorde det mulig å løse noen av problemene knyttet til relativt lav effektivitet av vektorer. For ytterligere å forbedre produksjonsegenskaper vektor, ville det være verdifullt å teste om vektor gir og uttrykk kan forbedres via tillegg av multi-kopiert gjentar samme binding motivet eller ved multipleksing Sp1 motivet anerkjennelse nettsteder for andre faktorer. I denne forbindelse kan resultatene som presenteres her tilby en generelle strategi for forbedring av relativt svake vev-spesifikke arrangører, som menneskelige synapsin jeg (hSyn) og CamKIIa.

Vi har nylig vist at langsiktige uttrykk for LV Cas9/programoversikt RNA kan føre til off-målet bivirkninger30. Selv om dette begrepet brukt mest dele celler, ville det være svært gunstig å utvikle episomal vektor systemer kunne levere transiently terapeutiske lastene. Som nevnt ovenfor er AAV vektorer svært verdifulle, transiently levere biler; likevel muligheten til lav emballasje sterkt påvirke bruken, særlig for epigenome-redigering programmer. Derfor ville integrase dårlig lentiviral vektorer (IDLVs) tilbyr en attraktiv måte for levering og uttrykk for epigenome-redigeringsverktøy basert på CRISPR/dCas9. Følgende egenskaper for IDLV-plattformen er spesielt attraktivt: (i) kapasitet til å levere genetisk Last til et bredt spekter av cellene og organene; (ii) en overlegen emballasje kapasitet, som er en betydelig fordel over AAV vektorer; (iii) forbigående natur levering (som er en betydelig fordel i forhold til det integrase kompetente LVs)45,30. Episomal IDLV genomer fremhever sine svært lav integrering priser og, som sådan, er svært gunstig for reduksjon av en risiko for insertional mutagenese. Vi har nylig optimalisert IDLV produksjon og uttrykk egenskaper, opprette plattformen som er sikker og effektiv levering av CRISPR/Cas9 komponenter30. De forbedrede IDLVs var faktisk i stand til å indusere rask og vedvarende genomet redigering i HEK-293T celler og postmitotic hjernen nevroner. Systemet er preget av forbigående uttrykk og ble funnet for å være tryggere enn det tilsvarende integrase-kompetente LVs. Tilpasning av IDLV vektorer for programmer med epigenome-redigering manipulasjoner ville være svært fordelaktig for feltet gene terapi.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Duke University arkivert en foreløpig patentsøknad knyttet til denne studien.

Acknowledgments

Dette arbeidet ble finansiert delvis av Kahn Neurotechnology Development Award (å OC) og nasjonale institutter for helse/National Institute av nevrologiske lidelser og slag (NIH/NINDS) (R01 NS085011 å OC).

Materials

Name Company Catalog Number Comments
Equipment
Optima XPN-80 Ultracentrifuge Beckman Coulter A99839
0.22 μM filter unit, 1 L Corning 430513
0.45-μm filter unit, 500 mL Corning 430773
100 mm TC-Treated Culture Dish Corning 430167
15 mL conical centrifuge tubes Corning 430791
150 mm TC-Treated Cell Culture dishes with 20 mm Grid Corning 353025
50 mL conical centrifuge tubes Corning 430291
6-well plates Corning 3516
Aggrewell 800 StemCell Technologies 34811
Allegra 25R tabletop centrifuge Beckman Coulter 369434
BD FACS Becton Dickinson 338960
Conical bottom ultracentrifugation tubes Seton Scientific 5067
Conical tube adapters Seton Scientific PN 4230
Eppendorf Cell Imaging Slides Eppendorf 30742060
High-binding 96-well plates Corning 3366
Inverted fluorescence microscope Leica DM IRB2
QIAprep Spin Miniprep Kit (50) Qiagen 27104
Reversible Strainer StemCell Technologies 27215
SW32Ti rotor Beckman Coulter 369650
VWR® Disposable Serological Pipets, Glass, Nonpyrogenic VWR 93000-694
VWR® Vacuum Filtration Systems VWR 89220-694
xMark™ Microplate Absorbance plate reader Bio-Rad 1681150
Name Company Catalog Number Comments
Cell culture reagents
Human embryonic kidney 293T (HEK 293T) cells ATCC CRL-3216
Accutase StemCell Technologies 7920
Anti-Adherence Rinsing Solution StemCell Technologies 7010
Anti-FOXA2 Antibody Abcam Ab60721
Anti-Nestin Antibody Abcam Ab18102
Antibiotic-antimycotic solution, 100x Sigma Aldrich A5955-100ML
B-27 Supplement (50x), minus vitamin A Thermo Fisher Scientific 12587010
BES Sigma Aldrich B9879 - BES
Bovine Albumin Fraction V (7.5% solution) Thermo Fisher Scientific 15260037
CHIR99021 StemCell Technologies 72052
Corning Matrigel hESC-Qualified Matrix Corning 08-774-552
Cosmic Calf Serum Hyclone SH30087.04
DMEM-F12 Lonza 12-719
DMEM, high glucose media Gibco 11965
DNeasy Blood & Tissue Kit Qiagen 69504
EpiTect PCR Control DNA Set Qiagen 596945
EZ DNA Methylation Kit Zymo Research D5001
Gelatin Sigma Aldrich G1800-100G
Gentamicin Thermo Fisher Scientific 15750078
Gentle Cell Dissociation Reagent stemCell Technologies 7174
GlutaMAX Thermo Fisher Scientific 35050061
Human Recombinant bFGF StemCell Technologies 78003
Human Recombinant EGF StemCell Technologies 78006
Human Recombinant Shh (C24II) StemCell Technologies 78065
MEM Non-Essential Amino Acids Solution (100x) Thermo Fisher Scientific 11140050
mTeSR1 StemCell Technologies 85850
N-2 Supplement (100x) Thermo Fisher Scientific 17502001
Neurobasal Medium Thermo Fisher Scientific 21103049
Non-Essential Amino Acid (NEAA) Hyclone SH30087.04
PyroMark PCR Kit Qiagen 978703
RPMI 1640 media Thermo Fisher Scientific 11875-085
SB431542 StemCell Technologies 72232
Sodium pyruvate Sigma Aldrich S8636-100ML
STEMdiff Neural Induction Medium StemCell Technologies 5835
STEMdiff Neural Progenitor Freezing Medium StemCell Technologies 5838
TaqMan Assay FOXA2 Thermo Fisher Scientific Hs00232764
TaqMan Assay GAPDH Thermo Fisher Scientific Hs99999905
TaqMan Assay Nestin Thermo Fisher Scientific Hs04187831
TaqMan Assay OCT4 Thermo Fisher Scientific Hs04260367
TaqMan Assay PPIA Thermo Fisher Scientific Hs99999904
Trypsin-EDTA 0.05% Gibco 25300054
Y27632 StemCell Technologies 72302
Name Company Catalog Number Comments
p24 ELISA reagents
Monoclonal anti-p24 antibody NIH AIDS Research and Reference Reagent Program 3537
Goat anti-rabbit horseradish peroxidase IgG Sigma Aldrich 12-348 Working concentration 1:1500
Goat serum, Sterile, 10 mL Sigma G9023 Working concentration 1:1000
HIV-1 standards NIH AIDS Research and Reference Reagent Program SP968F
Normal mouse serum, Sterile, 500 mL Equitech-Bio SM30-0500
Polyclonal rabbit anti-p24 antibody NIH AIDS Research and Reference Reagent Program SP451T
TMB peroxidase substrate KPL 5120-0076 Working concentration 1:10,000
Name Company Catalog Number Comments
Plasmids
pMD2.G Addgene 12253
pRSV-Rev Addgene 52961
psPAX2 Addgene 12259
Name Company Catalog Number Comments
Restriction enzymes
BsmBI New England Biolabs R0580S
BsrGI New England Biolabs R0575S
EcoRV New England Biolabs R0195S
KpnI New England Biolabs R0142S
PacI New England Biolabs R0547S
SphI New England Biolabs R0182S

DOWNLOAD MATERIALS LIST

References

  1. Hsu, P. D., Lander, E. S., Zhang, F. Development and applications of CRISPR-Cas9 for genome engineering. Cell. 157, (6), 1262-1278 (2014).
  2. Gaj, T., Gersbach, C. A., Barbas, C. F. 3rd ZFN, TALEN, and CRISPR/Cas-based methods for genome engineering. Trends in Biotechnology. 31, (7), 397-405 (2013).
  3. Thakore, P. I., Black, J. B., Hilton, I. B., Gersbach, C. A. Editing the epigenome: technologies for programmable transcription and epigenetic modulation. Nature Methods. 13, (2), 127-137 (2016).
  4. Gilbert, L. A., et al. CRISPR-mediated modular RNA-guided regulation of transcription in eukaryotes. Cell. 154, (2), 442-451 (2013).
  5. Gilbert, L. A., et al. Genome-Scale CRISPR-Mediated Control of Gene Repression and Activation. Cell. 159, (3), 647-661 (2014).
  6. Perez-Pinera, P., et al. RNA-guided gene activation by CRISPR-Cas9-based transcription factors. Nature Methods. 10, (10), 973-976 (2013).
  7. Chavez, A., et al. Highly efficient Cas9-mediated transcriptional programming. Nature Methods. 12, (4), 326-328 (2015).
  8. Horlbeck, M. A., et al. Nucleosomes impede Cas9 access to DNA in vivo and in vitro. eLife. 5, (2016).
  9. Chavez, A., et al. Comparison of Cas9 activators in multiple species. Nature Methods. 13, (7), 563-567 (2016).
  10. Zhou, H., et al. In vivo simultaneous transcriptional activation of multiple genes in the brain using CRISPR-dCas9-activator transgenic mice. Nature Neuroscience. 21, (3), 440-446 (2018).
  11. Tanenbaum, M. E., Gilbert, L. A., Qi, L. S., Weissman, J. S., Vale, R. D. A protein-tagging system for signal amplification in gene expression and fluorescence imaging. Cell. 159, (3), 635-646 (2014).
  12. Konermann, S., et al. Genome-scale transcriptional activation by an engineered CRISPR-Cas9 complex. Nature. 517, (7536), 583-588 (2015).
  13. Holtzman, L., Gersbach, C. A. Editing the Epigenome: Reshaping the Genomic Landscape. Annual Review of Genomics and Human Genetics. (2018).
  14. Perez-Pinera, P., et al. Synergistic and tunable human gene activation by combinations of synthetic transcription factors. Nature Methods. 10, (3), 239-242 (2013).
  15. Thakore, P. I., et al. Highly specific epigenome editing by CRISPR-Cas9 repressors for silencing of distal regulatory elements. Nature Methods. 12, (12), 1143-1149 (2015).
  16. Amabile, A., et al. Inheritable Silencing of Endogenous Genes by Hit-and-Run Targeted Epigenetic Editing. Cell. 167, (1), 219-232 (2016).
  17. Liu, X. S., et al. Editing DNA Methylation in the Mammalian Genome. Cell. 167, (1), 233-247 (2016).
  18. McDonald, J. I., et al. Reprogrammable CRISPR/Cas9-based system for inducing site-specific DNA methylation. Biology Open. 5, (6), 866-874 (2016).
  19. Huang, Y. H., et al. DNA epigenome editing using CRISPR-Cas SunTag-directed DNMT3A. Genome Biology. 18, (1), 176 (2017).
  20. Vojta, A., et al. Repurposing the CRISPR-Cas9 system for targeted DNA methylation. Nucleic Acids Research. 44, (12), 5615-5628 (2016).
  21. Razin, A., Kantor, B. DNA methylation in epigenetic control of gene expression. Progress in Molecular and Subcellular Biology. 38, 151-167 (2005).
  22. Kantor, B., Ma, H., Webster-Cyriaque, J., Monahan, P. E., Kafri, T. Epigenetic activation of unintegrated HIV-1 genomes by gut-associated short chain fatty acids and its implications for HIV infection. Proceedings of the National Academy of Sciences of the United States of America. 106, (44), 18786-18791 (2009).
  23. Kantor, B., et al. Downregulation of SNCA Expression by Targeted Editing of DNA Methylation: A Potential Strategy for Precision Therapy in PD. Molecular Therapy. (2018).
  24. Jowaed, A., Schmitt, I., Kaut, O., Wullner, U. Methylation regulates alpha-synuclein expression and is decreased in Parkinson's disease patients' brains. Journal of Neuroscience. 30, (18), 6355-6359 (2010).
  25. Wang, Y., et al. A DNA methyltransferase inhibitor, 5-aza-2'-deoxycytidine, exacerbates neurotoxicity and upregulates Parkinson's disease-related genes in dopaminergic neurons. CNS Neuroscience & Therapeutics. 19, (3), 183-190 (2013).
  26. Matsumoto, L., et al. CpG demethylation enhances alpha-synuclein expression and affects the pathogenesis of Parkinson's disease. PLOS One. 5, (11), e15522 (2010).
  27. Desplats, P., et al. Alpha-synuclein sequesters Dnmt1 from the nucleus: a novel mechanism for epigenetic alterations in Lewy body diseases. Journal of Biological Chemistry. 286, (11), 9031-9037 (2011).
  28. Ai, S. X., et al. Hypomethylation of SNCA in blood of patients with sporadic Parkinson's disease. Journal of the Neurological Sciences. 337, (1-2), 123-128 (2014).
  29. Tagliafierro, L., Chiba-Falek, O. Up-regulation of SNCA gene expression: implications to synucleinopathies. Neurogenetics. 17, (3), 145-157 (2016).
  30. Ortinski, P. I., O’Donovan, B., Dong, X., Kantor, B. Integrase-Deficient Lentiviral Vector as an All-in-One Platform for Highly Efficient CRISPR/Cas9-Mediated Gene Editing. Molecular Therapy - Methods & Clinical Development. 5, 153-164 (2017).
  31. Tagliafierro, L., et al. Genetic analysis of alpha-synuclein 3' untranslated region and its corresponding microRNAs in relation to Parkinson's disease compared to dementia with Lewy bodies. Alzheimer’s & Dementia. 13, (11), 1237-1250 (2017).
  32. Tagliafierro, L., Zamora, M. E., Chiba-Falek, O. Multiplication of the SNCA locus exacerbates neuronal nuclear aging. Human Molecular Genetics. (2018).
  33. Kantor, B., McCown, T., Leone, P., Gray, S. J. Clinical applications involving CNS gene transfer. Advances in Genetics. 87, 71-124 (2014).
  34. Kantor, B., Bailey, R. M., Wimberly, K., Kalburgi, S. N., Gray, S. J. Methods for gene transfer to the central nervous system. Advances in Genetics. 87, 125-197 (2014).
  35. Vijayraghavan, S., Kantor, B. A Protocol for the Production of Integrase-deficient Lentiviral Vectors for CRISPR/Cas9-mediated Gene Knockout in Dividing Cells. Journal of Visualized Experiments. (130), e56915 (2017).
  36. Bayer, M., et al. A large U3 deletion causes increased in vivo expression from a nonintegrating lentiviral vector. Molecular Therapy. 16, (12), 1968-1976 (2008).
  37. Bassil, C. F., Huang, Z., Murphy, S. K. Bisulfite pyrosequencing. Methods in Molecular Biology. 1049, 95-107 (2013).
  38. Truong, D. J., et al. Development of an intein-mediated split-Cas9 system for gene therapy. Nucleic Acids Research. 43, (13), 6450-6458 (2015).
  39. Nishimasu, H., et al. Crystal Structure of Staphylococcus aureus Cas9. Cell. 162, (5), 1113-1126 (2015).
  40. Ran, F. A., et al. In vivo genome editing using Staphylococcus aureus Cas9. Nature. 520, (7546), 186-191 (2015).
  41. Van Lint, C., Ghysdael, J., Paras, P., Burny, A., Verdin, E. A transcriptional regulatory element is associated with a nuclease-hypersensitive site in the pol gene of human immunodeficiency virus type 1. Journal of Virology. 68, (4), 2632-2648 (1994).
  42. Van Lint, C., et al. Transcription factor binding sites downstream of the human immunodeficiency virus type 1 transcription start site are important for virus infectivity. Journal of Virology. 71, (8), 6113-6127 (1997).
  43. Goffin, V., et al. Transcription factor binding sites in the pol gene intragenic regulatory region of HIV-1 are important for virus infectivity. Nucleic Acids Research. 33, (13), 4285-4310 (2005).
  44. Kim, Y. S., et al. Artificial zinc finger fusions targeting Sp1-binding sites and the trans-activator-responsive element potently repress transcription and replication of HIV-1. Journal of Biological Chemistry. 280, (22), 21545-21552 (2005).
  45. Kantor, B., et al. Notable reduction in illegitimate integration mediated by a PPT-deleted, nonintegrating lentiviral vector. Molecular Therapy. 19, (3), 547-556 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics