Différenciation neuronale efficace à l'aide de la culture monocellulaire des cellules souches embryonnaires humaines

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Présenté ici est un protocole pour la génération d'une culture unicellulaire des cellules souches embryonnaires humaines et leur différenciation ultérieure en cellules progénitrices neurales. Le protocole est simple, robuste, évolutif et adapté aux applications de dépistage des médicaments et de médecine régénérative.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Jeon, K., Park, K., Jetten, A. M. Efficient Neural Differentiation using Single-Cell Culture of Human Embryonic Stem Cells. J. Vis. Exp. (155), e60571, doi:10.3791/60571 (2020).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

La différenciation in vitro des cellules souches embryonnaires humaines (HESC) a transformé la capacité d'étudier le développement humain à la fois aux niveaux biologique et moléculaire et a fourni des cellules pour une utilisation dans des applications régénératrices. Les approches standard pour la culture hESC utilisant la culture de type colonie pour maintenir les HESC indifférenciés et le corps embryonnaire (EB) et la formation de rosette pour la différenciation en différentes couches germinales sont inefficaces et prennent du temps. Présenté ici est une méthode de culture unicellulaire en utilisant hESCs au lieu d'une culture de type colonie. Cette méthode permet le maintien des caractéristiques des HESC indifférenciés, y compris l'expression de marqueurs hESC à des niveaux comparables aux HESC de type colonie. En outre, le protocole présente une méthode efficace pour la génération de cellules progénitrices neurales (NPC) à partir de hESCs de type unicellulaire qui produit des PNJ dans un délai de 1 semaine. Ces cellules expriment fortement plusieurs gènes de marqueur de PNJ et peuvent se différencier en divers types de cellules neurales, y compris les neurones dopaminergiques et les astrocytes. Ce système de culture unicellulaire pour les HESC sera utile pour étudier les mécanismes moléculaires de ces processus, les études de certaines maladies et les écrans de découverte de médicaments.

Introduction

Les cellules souches embryonnaires humaines (HESC) ont le potentiel de se différencier en trois couches germinales primaires, qui se différencient ensuite en diverses lignées cellulaires progénitrices multipotentes. Ces lignées donnent par la suite naissance à tous les types de cellules dans le corps humain. Les systèmes de culture hESC in vitro ont transformé la capacité d'étudier le développement embryonnaire humain et ont servi d'outil précieux pour obtenir de nouvelles connaissances sur la façon dont ces processus sont réglementés aux niveaux biologique et moléculaire. De même, les études sur les cellules souches pluripotentes induites (iPSC) générées par la reprogrammation de cellules somatiques isolées de patients humains fournissent de nouvelles informations sur diverses maladies. En outre, l'ancêtre et les cellules différenciées dérivées des HESC peuvent être utiles pour la recherche impliquant la thérapie de cellules souches et le dépistage de drogue1,2,3,4.

Les hESC peuvent être induits pour se différencier en cellules progénitrices neurales (PNJ), qui sont des cellules multipotentielles avec une capacité d'auto-renouvellement étendue. Par la suite, ces cellules peuvent être différenciées en neurones, astrocytes, et oligodendrocytes5,6. Les PNJ offrent également un système cellulaire pour les études in vitro de la biologie neurodéveloppementale et de diverses maladies neurologiques. Cependant, les méthodes actuelles de culture de type colonie impliquant les HESC et leur différenciation en PNJ sont inefficaces et impliquent souvent la coculture ainsi que le corps embryonnaire (EB) et la formation de rosette5,7,8,9. Ces protocoles présentent des taux de survie plus faibles et une différenciation spontanée et prennent plus de temps.

Présenté ici est un système de culture amélioré et robuste qui est facilement évolutif et utilise la culture de type unicellulaire de haute densité de hESCs10. L'inclusion de l'inhibiteur de Roh-kinase (ROCK) a contribué à l'efficacité de survie sensiblement améliorée pendant la culture de type de cellule simple de hESC10,11,12,13,14. Dans ce système de culture, les HESC peuvent être facilement entretenus et étendus. En outre, le protocole présente une méthode efficace pour générer des PNJ à partir de la culture de type unicellulaire des HESC, qui permet la production de PNJ très purs. Inhibition des voies de signalisation BMP/TGMD/activine avec des inhibiteurs ALK induisent efficacement la différenciation des HCES de type unicellulaire en PNJ15,16, qui peuvent alors être induits à se différencier en lignées neuronales fonctionnelles, telles que les neurones dopaminergiques et les astrocytes.

En résumé, le protocole de culture de type unicellulaire utilisant les CSSH offre un modèle attrayant pour étudier la différenciation de ces cellules en différentes lignées, y compris les PNJ. Ce protocole est facilement évolutif et donc adapté pour générer des cellules pour la recherche impliquant la thérapie régénérative et le dépistage des médicaments.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Préparation des plaques enduites de matrice de membrane de sous-sol hESC-qualifiées

  1. Décongeler lentement la membrane de membrane du sous-sol qualifiée par le HESC (voir Table of Materials)solution à 4 oC pendant au moins 2 à 3 h ou pendant la nuit pour éviter la formation d'un gel.
  2. Pour préparer les plaques recouvertes de matrice de membrane de sous-sol, diluez la matrice dans le DMEM/F12 froid à une concentration finale de 2%. Bien mélanger et enrober chaque puits d'une plaque de 6 puits avec 1 ml de la solution de matrice diluée.
  3. Incuber les plaques recouvertes de matrice séminatoire séminante au sous-sol à température ambiante (RT) pendant au moins 3 h ou à 4 oC pendant la nuit.
    REMARQUE : Les plaques munie d'une matrice membranaire du sous-sol peuvent être entreposées à 4 oC pendant 1 semaine avant que la solution de matrice ne soit enlevée et que les plaques ne soient utilisées.

2. Adaptation des HESC de type Colonie à la culture hESC unicellulaire

  1. Pour passer les cultures sans mangeoire de type de colonie H9 (WA09) hESCs cultivés sur la matrice de membrane de sous-sol, aspirer le milieu des puits (Figure 1A)9.
  2. Laver 1x avec 1 ml de DPBS. Ajouter 1 ml de solution de dispase (1 U/mL) par puits et incuber à 37 oC pendant 20 min.
  3. Retirer le dispase, laver les cellules 1x doucement avec 2 ml de DMEM/F12, retirer le milieu, et ajouter 2 mL de DMEM/F12 à chaque plaque.
  4. Détachez délicatement les colonies en tirant doucement de haut en bas et transférez-les dans un tube de 15 ml.
  5. Centrifuger les granulés pendant 2 min à 370 x g et aspirer le milieu.
  6. Pour dissocier les granulés cellulaires en cellules individuelles, ajouter 2 ml de solution de détachement cellulaire (1x concentration, voir Table of Materials) et couver à 37 oC pendant 10 min.
  7. Centrifugeuses cellules pendant 2 min à 370 x g et retirez la solution de détachement.
  8. Ajouter le milieu ESC humain mTeSR1 frais et dissocier les cellules en cellules simples en faisant un tuyauterie doux de haut en bas.
  9. Pour adapter les HESC de type colonie à une culture de type monocellulaire, plaquez environ 1,5 à 2,0 x 106 HESC dans chaque puits de la membrane du sous-sol enduit 6 plaques de puits dans 2 mL de mTeSR1 contenant 10 'M inhibiteur de ROCK pendant 24 h (Figure 1A).
  10. Après 24 h, remplacer le milieu hESC par du mTeSR1 frais sans inhibiteur ROCK et permettre aux HESC de se développer en tant que type monocellulaire pendant 3 jours. Changer le milieu tous les jours.
  11. Le jour 4, lorsque les cultures atteignent près de 100% de confluence, dissocier les cellules dans la solution de détachement, puis replate comme décrit à l'étape 2.6.
    REMARQUE : L'inhibiteur de ROCK améliore la survie de cellules pendant les 24 h initiaux de la culture hESC de type unicellulaire.

3. Formation et différenciation du corps embryonnaire en trois couches germinales (Figure 2)

  1. Pour former des EB, d'abord resuspendre les cellules dans 3 mL de milieu mTeSR1 avec un inhibiteur de 10 M ROCK pendant les 24 premiers h, puis incuber toute la nuit dans des plats à attachement bas de 60 mm dans un incubateur de 37 oC pour permettre l'agrégation.
  2. Après 24 h, les petits EB sont transférés dans un tube de 15 ml. Laisser les EB s'installer au fond du tube et retirer délicatement le milieu à l'eau avec une pipette. Transférer les EB dans le milieu EB (knockout-DMEM complété par 20% de remplacement de sérum knock-out, 1x supplément de glutamine [voir Tableau des matériaux], 1% NEAA [acides aminés non essentiels; voir Tableau des matériaux], et 0,2% de mercaptoéthanol) et leur permettre de se développer dans les plats à faible attachement pendant 7 jours. Le médium peut être changé tous les deux jours comme décrit ci-dessus (Figure 2A).
  3. Le jour 7, collectez les EB dans les plats et transférez-les dans un tube de 15 ml. Retirez délicatement le milieu à l'eau avec une pipette et transférez les EB dans une plaque de 6 puits recouverte de membrane du sous-sol.
  4. Laisser les EB se fixer à la plaque et couver pendant 12 jours dans le milieu EB, au cours de laquelle ils se différencieront en trois couches germinales (Figure 2B). Changez le médium tous les deux jours.
    REMARQUE : Pendant l'agrégation des cellules, le plat à faible attachement aide à éviter l'attachement EB.

4. Différenciation des HESC de type unicellulaire en PNJ (Figure 3)

  1. Pour induire la différenciation du PNJ, dissocier les HESC de type unicellulaire avec 1 ml de solution de détachement (1x) et incuber pendant 10 min à 37 oC.
  2. Centrifuger les cellules pendant 2 min à 370 x g et enlever le supernatant de solution de détachement. Ajouter 1 ml de DMEM/F12 et resuspendre les cellules par pipetage doux.
  3. Cellules de plaque sur une matrice de membrane de sous-sol enduite 6 plaque de puits à une densité de 2 x 105 cellules/puits dans 2 mL de mTeSR1 contenant 10 'M inhibiteur de ROCK.
  4. Après 24 h, remplacer le milieu de culture par un milieu d'induction neuronale (DMEM avec 1% B27 moins vitamine A) complété par 1 m de dorsomorphine et 5 M SB431542.
  5. Changer le médium tous les deux jours pendant les 4 premiers jours de l'induction neuronale, puis tous les jours jusqu'à atteindre la confluence au jour 7 (Figure 3B).
    REMARQUE : (1) La dorsomorphine inhibe la voie BMP en ciblant les récepteurs ALK2,3,6 et inhibe également l'AMPK; SB431542 est un inhibiteur de la voie TGFD/Activin en ciblant ALK5,7. (2) Le même protocole a été testé avec une autre ligne ESC (WA01), qui a donné des résultats similaires à WA0916. (3) Nous avons généralement utilisé Matrigel pour la matrice de membrane de sous-sol ; cependant, les cellules peuvent être cultivées sur Geltrex, puis différenciées en PNJ avec des résultats très similaires comme l'indique l'expression de plusieurs marqueurs PNJ(figure 4D,E). Manipulez Geltrex de la même manière que Matrigel (voir la section 1).

5. Expansion et cryoconservation de PNJ

  1. Après 7 jours d'induction neuronale, dissocier les cellules avec 1 ml de solution de détachement (1x) et incuber pendant 10 min à 37 oC.
  2. Centrifuger les cellules pendant 2 min à 370 x g et enlever le supernatant de solution de détachement. Ajouter 1 ml de milieu d'expansion du PNJ (voir Tableau des matériaux)et resuspendre les cellules par tuyauterie douce.
  3. Plaque 1 x 105 cellules dans 2 ml de milieu d'expansion de PNJ sur la matrice de membrane de sous-sol-enduit 6 plaques de puits.
  4. Les PNJ de passage plusieurs fois, si nécessaire, lorsque les cultures atteignent près de 90% de confluence. Au cours des premiers passages de 3 à 4, ajouter 10 'M inhibiteur ROCK pendant les 24 h initiaux pour prévenir la mort cellulaire. Après ces passages, les cellules peuvent être passages et cultivées sans inhibiteur ROCK. Changer le support tous les deux jours pendant l'expansion.
  5. Cryopreserve PNJ lorsque les cultures atteignent la confluence.
    1. Pour la cryoconservation, dissocier les cellules en 1 ml de solution de détachement (1x) pendant 5 min à 37 oC, puis la suspension centrifugeuse pendant 2 min à 370 x g pour enlever la solution de détachement.
    2. Ajouter la solution de congélation cellulaire (voir Tableau des matériaux) aux PNJ dissociés à 1 x 106 cellules/mL et distribuer 1 mL d'aliquots aux cryovials.
    3. Placer les cryovials dans un contenant de congélation et les conserver toute la nuit dans un congélateur de -80 oC.
  6. Conserver les cryovials dans l'azote liquide.

6. Préparation des plaques enduites de poly-L-ornithine (PLO) et de Laminin

  1. Pour préparer les plaques enduites d'OLP/laminin, diluer la solution de stock de l'OLP dans le PBS ou l'eau à une concentration finale de 10 g/mL. Bien mélanger et enrober chaque puits d'une assiette de 6 puits avec 1 ml de solution PLO diluée.
  2. Incuber pendant au moins 2 h à 37 oC ou toute la nuit à 4 oC.
  3. Lavez-vous chaque puits avec du PBS.
  4. Diluer la solution de stock de laminindansdanse froide ou de l'eau à 10 g/mL. Bien mélanger la solution de laminin. Retirer le PBS et enrober immédiatement chaque puits de 1 ml de la solution de laminin. Conserver les assiettes à 4 oC et les utiliser dans la semaine. Laver avec PBS et ajouter immédiatement le milieu de culture.
    REMARQUE : Ne laissez pas sécher les plaques enduites d'OLP/laminin.

7. Différenciation des PNJ dérivés du HESC dans les neurones dopaminergiques (Figure 6A)

  1. Les PNJ de plaque dans les plats enrobés d'OLP/laminin dans le milieu d'expansion de PNJ à une densité d'environ 50%.
  2. Après 24 h, changer le milieu vers le milieu DA1 (milieu neurobasal contenant 2 mM de supplément de glutamine, 1x NEAA, 1x B27, 200 ng/mL SHH, et 100 ng/mL FGF8) et changer le milieu tous les deux jours.
  3. Les cultures de passage quand elles atteignent la confluence. Dissocier les cellules avec 1 ml de solution de détachement (1x) et couver pendant 10 min à 37 oC.
  4. Centrifuger les cellules pendant 2 min à 370 x g et enlever le supernatant de solution de détachement. Ajouter 1 ml de milieu DA1 et resuspendre les cellules par pipetting douce.
  5. Plaque 1 x 105 cellules dans 2 ml de milieu DA1 sur 6 plaques de puits enduites d'OLP/laminin.
  6. Après 10 jours, changer au milieu DA2 (milieu neurobasal contenant 2 mM de supplément de glutamine, 1x NEAA, 1x B27, 200 'M acide ascorbique, 20 ng/mL BDNF, et 20 ng/mL GNDF) et changer de milieu tous les deux jours pendant 20 jours supplémentaires (Figure 6A).
    REMARQUE : Ajouter de l'acide ascorbique frais tous les jours au milieu DA2. Dans les 14 premiers jours, les cellules différenciées doivent être transmises lorsqu'elles atteignent 90 % de confluence, mais plus après.

8. Différenciation des PNJ dérivés de l'ESC en Astrocytes

  1. Cellules progénitrices neurales de plaque sur des plaques PLO/laminin-enduites dans le milieu d'expansion de PNJ à une densité d'environ 50%.
  2. Après 24 h, changer le milieu à l'astrocyte moyen (DMEM/F12 moyen comprenant 1:100 N2, 1:100 B27, 200 ng/mL IGF, 10 ng/mL activin A, 10 ng/mL heregulin -1, et 8 ng/mL bFGF) et changer le médium tous les deux jours.
  3. Les cultures de passage quand elles atteignent la confluence. Dissocier les cellules avec 1 ml de solution de détachement (1x) et couver pendant 10 min à 37 oC.
  4. Centrifuger les cellules pendant 2 min à 370 x g et enlever le supernatant de solution de détachement. Ajouter 1 ml de milieu astrocyte et resuspendre les cellules par pipetting douce.
  5. Assiette 1 x 105 cellules dans 2 ml de milieu astrocyte sur l'OLP/laminin-enduit 6 plats de puits.
  6. Permettre que la différenciation se poursuive pendant un total de 5 à 6 semaines(figure 6B).

9. Staining immunofluorescence

  1. Cellules de culture dans les plats de 35 mm comme décrit ci-dessus pour chaque type de cellule. Aspirer le milieu et ajouter 1 ml de solution PFA de 4 % par plat et incuber pendant 20 min à RT.
  2. Laver 2x pendant 5 min avec PBS.
    REMARQUE : Une fois les cellules fixées, les plaques d'analyse peuvent être scellées avec du parafilm et stockées à 4 oC. Tache avec un anticorps dans un délai de 1 semaine après fixation.
  3. Ajouter 300 l de solution de blocage (sérum de chèvre ou d'âne en PBS) par plat et incuber à RT pendant 30 à 60 min.
  4. Laver le plat 2x avec PBS pendant 5 min.
  5. Ajouter 300 l de solution d'anticorps primaires(tableau 1) (dilué dans la solution de blocage) et incuber à RT pendant 1,5 h ou toute la nuit à 4 oC.
  6. Laver 2x avec PBS pendant 10 min.
  7. Ajouter 300 l d'anticorps secondaire conjugué saillage (tableau 1) dans la solution de blocage et incuber dans l'obscurité pendant 1 h à RT.
  8. Laver les cellules 2x pendant 10 min avec DU PBS.
  9. Ajouter la solution de coloration Hoechst (1 m de concentration finale en PBS) pour tacher les noyaux. Incuber les cellules dans l'obscurité pendant 5 min à RT.
  10. Laver les cellules 1x avec PBS pendant 5 min, puis ajouter 500 'L de PBS. Gardez la vaisselle dans l'obscurité, puis observez la fluorescence à l'intérieur d'un microscope confocal(Figure 2B, Figure 5C, Figure 6Aet Figure 7B).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Présenté ici est un protocole amélioré pour le maintien et l'expansion de la culture de type unicellulaire des HESC et leur différenciation efficace en cellules progénitrices neurales, qui se différencie par la suite en diverses lignées neuronales en aval, y compris les neurones dopaminergiques et les astrocytes.

Les images de contraste de phase représentative montrent la morphologie cellulaire à différentes étapes au cours de l'adaptation des HESC de type colonie à la culture de type unicellulaire (Figure 1A). Grâce à la condition de culture unicellulaire, il a été constaté que les HESC adaptés étaient capables d'être maintenus à haute densité, puis facilement et efficacement sous-cultivés en atteignant la confluence (Figure 1A,B). Ces cellules conservaient les caractéristiques du cycle cellulaire (c.-à-d. une courte phase G1 et une proportion élevée de cellules en phase S) typiques des HESC de type colonie(figure 1C,D). Ils ont également exprimé les marqueurs ESC (c.-à-d. OCT4, TRA 1-81, SOX2 et NANOG) à des niveaux comparables à ceux des HESC de type colonie, comme l'indiquent qRT-PCR et l'analyse de l'immunostaining(figure 7, tableau 2). En outre, il a été démontré que les HESC unicellulaires étaient capables de former des corps embryonnaires contenant des cellules des trois couches germinales : endoderm (expression SOX17), mesoderm (expression SMA) et ectoderm (expression Tuj-1)(figure 2).

Ensuite, il a été démontré que les HESC de type unicellulaire se différenciaient efficacement en cellules progénitrices neurales à l'aide d'un protocole PNJ (figure 3A), comme l'indique la perte de la morphologie hESC typique et l'apparence de la morphologie des PNJ ( Figure3B)16. La différenciation des PNJ a été appuyée par l'expression accrue des marqueurs DeNP de signature (c.-à-d. SOX1, OTX2, ZIC1 et OTX1; Figure 5A, tableau 2) et confirmé par l'analyse immunostaining et FACS. La même analyse a également montré que plus de 90 % des cellules ont souillé de positif pour la protéine SOX1, PAX6 et NCAM(figure 5B,C). Pour examiner la capacité des PNJ hES-dérivés d'une seule cellule de se différencier en diverses lignées neuronales en aval, la différenciation de ces cellules en neurones et astrocytes dopaminergiques a été examinée. Comme le montre la figure 6A,B, les PNJ à cellule unique dérivées du SSN ont pu se différencier en neurones et astrocytes dopaminergiques, comme l'indique l'apparition de morphologies caractéristiques et l'expression de marqueurs dopaminergiques spécifiques à la lignée (c.-à-d. TH; Figure 6A) et les marqueurs d'astrocytes (c.-à-d. GFAP et S100B; Figure 6B).

Figure 1
Figure 1 : Adaptation des HESC de type colonie à la culture de type unicellulaire. (A) Images de contraste de phase représentative des cultures unicellulaires des H9 hESCs à différents moments après placage sur les plats enduits de matrice de membrane de sous-sol de 2%. Grossissement faible (gauche) et élevé (droite). Panneau supérieur : image représentative des HESC de type colonie. D'autres panneaux montrent des images représentatives de cultures à des moments différents au cours de l'adaptation aux HESC de type unicellulaire. Barre d'échelle de 200 m. (B) Les courbes de croissance des H9 hESC ont été surveillées dans des plaques recouvertes de matrice de membrane de sous-sol de 2 % avec un inhibiteur de 10 m ROCK pendant les 24 premiers h pendant l'état de culture unicellulaire. (C,D) Analyse du cycle cellulaire du type de colonie (C) et du type monocellulaire (D) H9 hESCs par cytométrie de flux. Veuillez cliquer ici pour voir une version plus grande de ce chiffre.

Figure 2
Figure 2 : Différenciation in vitro des HESC de type unicellulaire adapté en trois couches germinales. (A) Images de phase représentative des corps embryonnaires (EB) dérivées du type unicellulaire des HESC. Barre d'échelle de 100 m. (B) Images immunofluorescentes de HESC différenciés analysés pour l'expression des trois marqueurs différents de couche germinale : SOX17 (endoderm), SMA (mesoderm), et Tuj-1 (ectoderm). Les noyaux ont été tachés avec DAPI. Barre d'échelle de 50 m. Veuillez cliquer ici pour voir une version plus grande de ce chiffre.

Figure 3
Figure 3 : Différenciation des HESC de type unicellulaire en cellules progénitrices neurales par différenciation directe. (A) Schématique du protocole de différenciation des hESCs en cellules progénitrices neurales (PNJ). les hESC ont été traités avec la dorsomorphine (DMH) et Le SB431542 (SB) 1 jour après placage. (B) Images de contraste de phase représentative de la morphologie cellulaire pendant la différenciation neuronale. Barre d'échelle de 200 m. Veuillez cliquer ici pour voir une version plus grande de ce chiffre.

Figure 4
Figure 4 : culture hESC sur différents produits de matrice de membrane de sous-sol. (A) hESCs cultivés sur Matrigel ou Geltrex ont montré une capacité de se développer et de se différencier en PNJ qui était similaire à la culture cellulaire unique. Des cellules ont été souillées avec un anticorps de NESTIN. Les noyaux ont été tachés avec DAPI. Barre d'échelle de 50 m. (B) hESCs cultivés sur Matrigel ou Geltrex a montré le même potentiel de se différencier en PNJ comme indiqué par le pourcentage de cellules NESTIN- et PAX6-positifs. Les cellules ont été analysées par cytométrie de flux au jour 7 de la différenciation de PNJ. Veuillez cliquer ici pour voir une version plus grande de ce chiffre.

Figure 5
Figure 5 : Expression des marqueurs pNJ. (A) Après 7 jours de différenciation neuronale, l'expression des gènes marqueurs de PNJ (c.-à-d. OTX1, OTX2, SOX1, et ZIC1) a été analysée par QRT-PCR. Les valeurs ont été normalisées à GAPDH et calculées par rapport aux valeurs des CSH (p 'lt; 0.05). (B) Le pourcentage de cellules positives SOX1, NESTIN-, SOX2 et NCAM a été déterminé par cytométrie de flux au jour 7 de la différenciation du PNJ. (C) Au jour 7, les cellules étaient tachées d'anticorps contre les marqueurs neuronaux SOX1, NESTIN, NCAM, OTX2 et PAX6. Les noyaux ont été tachés avec DAPI. Barre d'échelle de 100 m. Veuillez cliquer ici pour voir une version plus grande de ce chiffre.

Figure 6
Figure 6 : Différenciation des pnitas gidopaminegiques et des astrocytes des PNJ dérivés de hESCs de type unicellulaire. (A) Image de contraste de phase représentative des neurones dopaminergiques (panneau supérieur). Barre d'échelle de 100 m. Des cellules différenciées ont été souillées avec des anticorps contre le marqueur dopaminergique de neurone TH (hydroxylase de tyrosine) comme indiqué. Les noyaux ont été tachés avec DAPI. Barre d'échelle de 50 m. (B) Image de contraste de phase représentative des astrocytes (panneau supérieur). Barre d'échelle de 100 m. Des cellules différenciées ont été souillées avec des anticorps contre le marqueur d'astrocyte GFAP (protéine acide fibrillaire glial) et S100-B (protéine de liaison de calcium De100 B), comme indiqué. Les noyaux ont été tachés avec DAPI. Barre d'échelle de 50 m. Veuillez cliquer ici pour voir une version plus grande de ce chiffre.

Figure 7
Figure 7 : Caractérisation des HESC de type de cellule unique. (A) hESCs adaptés à la culture de type unicellulaire ont été analysés pour l'expression des marqueurs ESC (c.-à-d., OCT4, NANOG, et SOX2) par QRT-PCR. Les valeurs ont été normalisées à GAPDH (p 'lt; 0.05). (B) Images immunofluorescentes de hESCs tachés pour l'expression des marqueurs de pluripotence OCT4, TRA-1-81, et SSEA-1. Les noyaux ont été tachés avec DAPI. Barre d'échelle de 50 m. Veuillez cliquer ici pour voir une version plus grande de ce chiffre.

Anticorps primaires Espèces Dilution Numéro de catalogue Société
OCT4 (en) Souris 1:1000 sc-5279 (en) Santa Cruz
TRA 1-81 Souris 1:500 sc-21706 Santa Cruz
SSEA-1 Annonces Souris 1:500 sc-21702 Santa Cruz
SOX1 (EN) Chèvre 1:500 AF-3369 AF-3369 R-D
SOX2 (EN) Lapin 1:1,000 sc-20088 Santa Cruz
Sma Lapin 1:500 ab-5694 (en) Abcam (abcam)
Tuj1 (Tuj1) Souris 1:1000 T8578 (en) Sigma
NESTIN (NESTIN) Souris 1:1000 ab-22035 Abcam (abcam)
OTX2 (EN) Souris 1:250 ab-21990 (en) Abcam (abcam)
hNCAM (en) Souris 1:200 sc-106 (en) Santa Cruz
hPAX6 (en) Souris 1:250 561664 Bd
E Souris 1:500 T1299 (en) Sigma
S100b (S100b) Souris 1:250 ab4066 (en) Abcam (abcam)
GFAP (en) Lapin 1:1,000 ab7260 (en) Abcam (abcam)
Anticorps secondaires
Anti-souris Chèvre 1:1,000 AF 488 ou 647 Technologies de vie
Anti-lapin Chèvre 1:1,000 AF 488 ou 647 Technologies de vie

Tableau 1 : Anticorps utilisés en immunocytochimie et en analyse FACS.

Nom d'amorce Séquence d'apprêt
OCT4 (en) F: GGAAGGTATTCAGCCAAAAA
R: CTCCAGGTTGCCTCTCACTC
Nanog F: GGTTCCAGAACCAGAGAATGA
R: ATTGGAAGGTCCCAGTCG
SOX1 (EN) F: CCTTAGGTTTCCCCTCGCTTT
R: CAGGCTGAATTCGGTTCTCATT
OTX1 (OTX1) F: AAGATCAACCTGCCGGAGTCT
R: CGTGAATTGGCCACTGCTTTT
OTX2 (EN) F: TGGAAGCACTGTTGCCAAG
R: TAAACCATACCTGCACCCTCG
ZIC1 ZIC1 ZIC1 F: AACCCCAAAAAGTCGTGCAAC
R: TCCTCCCAGAAGCAGATGTGA
GAPDH (EN) F: CCCATCACCATCTCACGGAG
R: CTTCTCCATGGTGGTGAAGACG

Tableau 2 : Liste des amorces utilisées dans l'analyse QRT-PCR.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Des méthodes évolutives et efficaces pour la différenciation des HESC en diverses lignées et la génération d'un nombre suffisant de cellules différenciées sont des critères importants pour le dépistage des médicaments et la thérapie par cellules souches. Diverses méthodes de passage unicellulaire ont été publiées, dans lesquelles les cellules sont cultivées en présence d'inhibiteur syUP Ou d'autres petites molécules pour améliorer la survie, mais les produits finaux de ces méthodes de culture sont le type de colonie hESCs17,18,19,20,21. Le protocole ESC unicellulaire, qui est partiellement basé sur des méthodes publiées précédemment19,20,21,22, génère et maintient avec succès des cultures hESC de type cellulaire unique et empêche la culture hESC de type colonie. Il comprend le placage unicellulaire à haute densité, l'association multicellulaire, la croissance des monocouches et la sous-culture efficace (figure 1). Ce dernier a été réalisé par l'ajout de l'inhibiteur ROCK au cours des 24 h initiaux de la culture de type unicellulaire de hESCs, ce qui améliore la survie des cellules17,18,19,20,21. Ce protocole est plus facilement évolutif et permet l'expansion de ces cellules pour des applications thérapeutiques dans le dépistage des médicaments et des cellules souches.

Il est en outre démontré que les HESC de type unicellulaire peuvent différencier efficacement la lignée des PNJ (figure 3) sans l'utilisation d'une étape intermédiaire, comme eb et la formation de rosette23,24,25. La conversion neurale élevée des hESC de type unicellulaire a été réalisée par l'inhibition des voies de signalisation de BMP/TGFMD/activin par traitement avec les inhibiteurs d'ALK, la dorsomorphine, et SB43154215,16,26. Avec ce protocole, les HESC de type unicellulaire adapté peuvent se différencier efficacement en PNJ sans avoir besoin de formation d'EB et de rosette (Figure 5) et ou être induits à se différencier en neurones et astrocytes dopaminergiques (Figure 6).

En résumé, la culture de type unicellulaire des HESC fournit un système rapide et efficace pour étudier les mécanismes moléculaires qui régulent la différenciation multi-étapes à diverses lignées. Plus précisément, ce protocole a utilisé des PNJ et a décrit leur différenciation ultérieure en lignées neuronales supplémentaires, telles que les astrocytes et les neurones dopaminergiques. Le protocole fournit une plate-forme pour la production simple, robuste et évolutive de cellules progénitrices et différenciées qui peuvent convenir aux études de base, au dépistage des médicaments et aux applications en médecine régénérative.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Les auteurs ne déclarent aucun conflit d'intérêts.

Acknowledgments

Nous remercions le Dr Carl D. Bortner (NIEHS) pour son aide dans l'analyse du FACS. Cette recherche a été soutenue par le Programme de recherche intra-muros de l'Institut national des sciences de la santé environnementale, les National Institutes of Health, Z01-ES-101585 à amJ.

Materials

Name Company Catalog Number Comments
35 mm m-dishes ibidi 81156 Cell culture dish
6-well plates Corning 3516
Accutase Innovative Cell Technologies AT104-500 Cell detachment solution
Activin A R&D system 338-AC-050
Ascorbic Acid Sigma Aldrich A4403
B27 supplement Thermo Fisher 17504044
B27 supplement (-Vit A) Thermo Fisher 12587010
BDNF Applied Biological Materials Z100065
bFGF Peprotech 100-18C
Centrifuge DAMON/ICE 428-6759
CO2 incubator Thermo Fisher 4110
Corning hESC-qulified Matrix (Magrigel) Corning 354277 Basement membrane matrix (used for most of the protocol here)
Cryostor CS 10 Stemcell Technologies 7930 Cell freezing solution
Dispase Stemcell Technologies 7923
DMEM Thermo Fisher 10569-010
DMEM/F12 Thermo Fisher 10565-018
Dorsomorphin Tocris 3093
EGF Peprotech AF-100-16A
Fetal Bovine Serum Fisher Scientific SH3007003HI
FGF8 Applied Biological Materials Z101705
GDNF Applied Biological Materials Z101057
Geltrex matrix Thermo Fisher A1569601 Basement membrane matrix
GlutaMax Thermo Fisher 35050061 Glutamine supplement, 100X
H9 (WA09) human embryonic stem cell line WiCell WA09
Heregulin b-1 Peprotech 100-3
IGF Peprotech 100-11
Knockout DMEM Thermo Fisher 10829018
Knockout Serum Replacement Thermo Fisher 10828028
Laminin Sigma Aldrich L2020
mTeSR1 Stemcell Technologies 85850 hESC culture medium
N2 supplement Thermo Fisher 17502001
NEAA Thermo Fisher 11140050
Neurobasal Thermo Fisher 21103049
Poly-L-ornithine Sigma Aldrich P3655
ROCK inhibitor Tocris 1254
SB431542 Tocris 1614
SHH Applied Biological Materials Z200617
Stemdiff Neural Progenitor medium Stemcell Technologies 5833 NPC expansion medium

DOWNLOAD MATERIALS LIST

References

  1. Thomson, J. A., et al. Embryonic stem cell lines derived from human blastocysts. Science. 282, (5391), 1145-1147 (1998).
  2. Rosler, E. S., et al. Long-term culture of human embryonic stem cells in feeder-free conditions. Developmental Dynamics. 229, (2), 259-274 (2004).
  3. Mallon, B. S., Park, K. Y., Chen, K. G., Hamilton, R. S., McKay, R. D. Toward xeno-free culture of human embryonic stem cells. The International Journal of Biochemistry & Cell Biology. 38, (7), 1063-1075 (2006).
  4. Hoffman, L. M., Carpenter, M. K. Characterization and culture of human embryonic stem cells. Nature Biotechnology. 23, (6), 699-708 (2005).
  5. Yan, Y., et al. Efficient and rapid derivation of primitive neural stem cells and generation of brain subtype neurons from human pluripotent stem cells. Stem Cells Translational Medicine. 2, (11), 862-870 (2013).
  6. Goncalves, J. T., Schafer, S. T., Gage, F. H. Adult Neurogenesis in the Hippocampus: From Stem Cells to Behavior. Cell. 167, (4), 897-914 (2016).
  7. Watanabe, K., et al. A ROCK inhibitor permits survival of dissociated human embryonic stem cells. Nature Biotechnology. 25, (6), 681-686 (2007).
  8. International Stem Cell Initiative. Characterization of human embryonic stem cell lines by the International Stem Cell Initiative. Nature Biotechnology. 25, (7), 803-816 (2007).
  9. Hartung, O., Huo, H., Daley, G. Q., Schlaeger, T. M. Clump passaging and expansion of human embryonic and induced pluripotent stem cells on mouse embryonic fibroblast feeder cells. Current Protocols in Stem Cell Biology. 14, (1), Chapter 1 Unit 1C 10 (2010).
  10. Chen, K. G., et al. Non-colony type monolayer culture of human embryonic stem cells. Stem Cell Research. 9, (3), 237-248 (2012).
  11. Chen, G., Hou, Z., Gulbranson, D. R., Thomson, J. A. Actin-myosin contractility is responsible for the reduced viability of dissociated human embryonic stem cells. Cell Stem Cell. 7, (2), 240-248 (2010).
  12. Li, X., Krawetz, R., Liu, S., Meng, G., Rancourt, D. E. ROCK inhibitor improves survival of cryopreserved serum/feeder-free single human embryonic stem cells. Human Reproduction. 24, (3), 580-589 (2009).
  13. Ohgushi, M., et al. Molecular pathway and cell state responsible for dissociation-induced apoptosis in human pluripotent stem cells. Cell Stem Cell. 7, (2), 225-239 (2010).
  14. Pakzad, M., et al. Presence of a ROCK inhibitor in extracellular matrix supports more undifferentiated growth of feeder-free human embryonic and induced pluripotent stem cells upon passaging. Stem Cell Reviews and Reports. 6, (1), 96-107 (2010).
  15. Chambers, S. M., et al. Highly efficient neural conversion of human ES and iPS cells by dual inhibition of SMAD signaling. Nature Biotechnology. 27, (3), 275-280 (2009).
  16. Jeon, K., et al. GLIS3 Transcriptionally Activates WNT Genes to Promote Differentiation of Human Embryonic Stem Cells into Posterior Neural Progenitors. Stem Cells. 37, (2), 202-215 (2019).
  17. Emre, N., et al. The ROCK inhibitor Y-27632 improves recovery of human embryonic stem cells after fluorescence-activated cell sorting with multiple cell surface markers. PLoS ONE. 5, (8), e12148 (2010).
  18. Hanna, J., et al. Human embryonic stem cells with biological and epigenetic characteristics similar to those of mouse ESCs. Proceedings of the National Academy of Sciences of the United States of America. 107, (20), 9222-9227 (2010).
  19. Saha, K., et al. Surface-engineered substrates for improved human pluripotent stem cell culture under fully defined conditions. Proceedings of the National Academy of Sciences of the United States of America. 108, (46), 18714-18719 (2011).
  20. Tsutsui, H., et al. An optimized small molecule inhibitor cocktail supports long-term maintenance of human embryonic stem cells. Nature Communications. 2, 167 (2011).
  21. Xu, Y., et al. Revealing a core signaling regulatory mechanism for pluripotent stem cell survival and self-renewal by small molecules. Proceedings of the National Academy of Sciences of the United States of America. 107, (18), 8129-8134 (2010).
  22. Ungrin, M. D., Joshi, C., Nica, A., Bauwens, C., Zandstra, P. W. Reproducible, ultra high-throughput formation of multicellular organization from single cell suspension-derived human embryonic stem cell aggregates. PLoS ONE. 3, (2), e1565 (2008).
  23. Kim, D. S., et al. Highly pure and expandable PSA-NCAM-positive neural precursors from human ESC and iPSC-derived neural rosettes. PLoS ONE. 7, (7), e39715 (2012).
  24. Sun, Y., Hu, J., Zhou, L., Pollard, S. M., Smith, A. Interplay between FGF2 and BMP controls the self-renewal, dormancy and differentiation of rat neural stem cells. Journal of Cell Science. 124, (Pt 11), 1867-1877 (2011).
  25. Zhou, J. M., Chu, J. X., Chen, X. J. An improved protocol that induces human embryonic stem cells to differentiate into neural cells in vitro. Cell Biology International. 32, (1), 80-85 (2008).
  26. Smith, J. R., et al. Inhibition of Activin/Nodal signaling promotes specification of human embryonic stem cells into neuroectoderm. Developmental Biology. 313, (1), 107-117 (2008).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics