Antisense Oligonucleotides as a Tool for Prolonged Knockdown of Nuclear lncRNAs in Human Cell Lines

Rogelio Montiel-Manriquez; Clementina Castro-Hernández; Cristian Arriaga-Canon; Luis A. Herrera

doi:10.3791/65124

Cancer Research

Antisense Oligonucleotides as a Tool for Prolonged Knockdown of Nuclear lncRNAs in Human Cell Lines

Published: September 1, 2023 doi: 10.3791/65124

Rogelio Montiel-Manriquez¹, Clementina Castro-Hernández¹, Cristian Arriaga-Canon¹, Luis A. Herrera^1,2

¹Unidad de Investigación Biomédica en Cáncer, Instituto Nacional de Cancerología-Instituto de Investigaciones Biomédicas, Universidad Nacional Autónoma de México, ²Escuela de Medicina y Ciencias de la Salud, Tecnológico de Monterrey

Abstract

Long noncoding RNAs (lncRNAs) play key regulatory roles in gene expression at the transcriptional level. Experimental evidence has established that a substantial fraction of lncRNA preferentially accumulates in the nucleus. For analysis of the function of nuclear lncRNAs, it is important to achieve efficient knockdown of these transcripts inside the nucleus. In contrast to the use of RNA interference, a technology that depends on the cytoplasmic silencing machinery, an antisense oligonucleotide (ASO) technology can achieve RNA knockdown by recruiting RNase H to the RNA-DNA duplexes for nuclear RNA cleavage. Unlike the use of CRISPR-Cas tools for genome engineering, where possible alterations in the chromatin state can occur, ASOs allow the efficient knockdown of nuclear transcripts without modifying the genome. Nevertheless, one of the major obstacles to ASO-mediated knockdown is its transitory effect. For the study of long-lasting effects of lncRNA silencing, maintaining efficient knockdown for a long time is needed. In this study, a protocol was developed to achieve a knockdown effect for over 21 days. The purpose was to evaluate the cis-regulatory effects of lncRNA knockdown on the adjacent coding gene RFC4, which is related to chromosomal instability, a condition that is observed only through time and cell aging. Two different human cell lines were used: PrEC, normal primary prostate epithelial cells, and HCT116, an epithelial cell line isolated from colorectal carcinoma, achieving successful knockdown in the assayed cell lines.

Introduction

The vast majority of the human genome is transcribed, giving rise to a wide variety of transcripts, including lncRNAs, which, in number, exceed the number of annotated coding genes in the human transcriptome¹. LncRNAs are transcripts longer than 200 nucleotides that do not encode proteins²^,³ and have recently been examined for their important regulatory functions in the cell⁴. Their functions have been shown to be dependent on their subcellular localization⁵, such as the nucleus where a significant fraction of lncRNAs accumulate and actively participate in transcriptional regulation⁶ and for nuclear architecture maintenance⁷, among other biological processes⁸^,⁹^,¹⁰.

For the functional characterization of nuclear lncRNAs, methods capable of inducing knockdown (KD) in the nucleus must be used, and ASOs are a powerful tool to silence nuclear transcripts. In general, ASOs are single-stranded DNA sequences ~20 base pairs in length that bind to complementary RNA by Watson-Crick base pairing¹¹^,¹²^,¹³ and can modify the function of the RNA through mechanisms that depend on their chemical structure and modifications¹³^,¹⁴. ASO chemistry modifications can be divided into 2 major groups: backbone modifications and 2' sugar ring modifications¹⁵, both of which are intended to increase stability by conferring high resistance to nucleases but also to enhance the intended biological effect¹³^,¹⁶. Among backbone modifications, phosphoramidate morpholino (PMO), thiophosphoramidate, and morpholino bonds are widely used for purposes such as interference in splicing¹⁷^,¹⁸ by serving as steric blocking agents¹⁹ but not to induce degradation of the transcript. Another backbone modification is the phosphorothioate (PS) bond, one of the most commonly used modifications in ASOs. In contrast to the previously mentioned modifications, PS bonds do not interfere with RNase H recruitment¹²^,²⁰, thus allowing RNA knockdown. However, there is also a wide variety of 2' sugar ring modifications²¹; nevertheless, for the purpose of RNA knockdown, among the modifications that induce efficient silencing effects are locked nucleic acids (LNAs)²²^, ²³ and 2'-O-methyl modification²⁴. Even though LNAs have proven to be highly effective for knockdown compared to other modifications²⁵, they can induce unwanted effects such as hepatotoxicity²⁶ and apoptosis induction in vivo and in vitro²⁷.

For the purpose of RNA knockdown, ASOs with the proper modifications mentioned before can recruit RNase H1 and H2²⁰^,²⁸, and these enzymes are recruited to DNA-RNA hybrids and cleave the target RNA, releasing the ASO¹³. The RNA products of this cleavage are then processed by the RNA surveillance machinery, resulting in RNA degradation²⁹ without modifying the genomic region of interest, in contrast to other techniques such as CRISPR-Cas systems, where modifications in the chromatin state can create unwanted biological effects³⁰. Despite the advantages of ASO technology, the temporary silencing effects due to cell division or ASO degradation over time are an obstacle to overcome when studying time-dependent processes such as chromosomal instability (CIN)³¹.

In particular, CIN is defined as an increased rate of changes in chromosome number and structure compared to those of normal cells³² and arises from errors in chromosome segregation during mitosis, leading to genetic alterations that originate intratumor heterogeneity³³ over time. Thus, CIN cannot be evaluated only by finding an aneuploid karyotype. For the proper study and evaluation of CIN in cell culture, it is important to monitor the cells over time. For study of the effects of a lncRNA KD on CIN, a methodology that allows a prolonged KD effect is needed. For this purpose, ASOs were used in this protocol, where lncRNA-RFC4 was successfully silenced in the human cell lines HCT115 and PrEC for 18 and 21 days, respectively. This transcript is an uncharacterized lncRNA of 1.2 kb in length, and its genomic location is on chromosome 3 (q27.3). It is adjacent to the protein coding gene RFC4, a gene associated with CIN in different types of human cancer³⁴^,³⁵^,³⁶.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

NOTE: This protocol is intended to be performed only by laboratory personnel with experience in laboratory safety procedures. It is essential to properly read the safety data sheets from all the reagents and materials used in this protocol prior to starting to handle hazardous materials and equipment. It is essential to read, understand and fulfill all the safety requirements indicated in your institution's laboratory safety manual along the whole protocol. Disposal of all biological and chemical waste must be performed according to the institution´s waste management and disposal manual. If not handled with care and according to safe laboratory practices, materials and equipment used in this protocol can cause serious injury. Always follow institution´s safety laboratory manual and safety procedures.

1. Design of ASOs

Manually design ASOs as described below.
1. Obtain the complete sequence of the target transcript and analyze it in the RNAfold WebServer, University of Vienna³⁷ (Table of Materials), using the default parameters on the website to obtain the minimum free energy (MFE) secondary structure.
2. When the results are ready, go to MFE plain structure drawing and click View In Forna to open the MFE secondary structure on the website, and the software will show the predicted secondary structure of the transcript analyzed.
3. From the predicted MFE secondary structure, select a region of 20 bp length in the RNA, avoiding G-strings (sequences of 3 guanines in a row) when designing the oligonucleotides. For selection of the best target region for the ASO, use the regions predicted to have a lower probability of internal base pairing (Figure 1).
4. From the selected region of 20 bp, create the reverse complement sequence. Manually create the reverse complement or use the reverse complement online tool (Table of Materials). The reverse complement sequence will be the ASO that must be synthesized for the experiment.
5. Analyze the ASO sequence using Nucleotide Blast NCBI (blastn) and UCSC Genome Browser on Human (GRCh38/hg38). Ensure ASOs do not show homology to other transcripts or other genomic regions in the human genome.
  NOTE: ASO synthesis and purification were performed by a commercial company (Table of Materials).
Ensure the oligonucleotides synthesized have the following characteristics.
1. Ensure PS bonds along the whole sequence of the oligonucleotide³⁸ (Figure 2A). Ensure ASOs are chimeric, with 5 nucleotides flanking the 5' and 3' ends with sugar rings modified with 2'-O-methyl (Figure 2B).
2. Ensure the 10 nucleotides in the middle have an unmodified sugar ring to support RNase H binding (Figure 2C).
3. Ask the company to perform purification using standard desalting and reverse-phase (RP) HPLC³⁹.
4. Order ASO delivery in lyophilized format.
Dissolve the lyophilized ASOs in Dulbecco's phosphate-buffered saline (DPBS) without calcium and magnesium to a final concentration of 200 µM. Store at -20 °C.
Prepare the working solution of ASO by diluting the concentrated stock to a concentration of 20 µM. Prepare the dilution using DPBS. Store at -20 °C.
NOTE: For this study, two ASOs targeting lncRNA-RFC4 were designed. For optimization of the ASO concentration for transfection and efficiency, the protocol by Zong et al.⁴⁰ was followed. Two ASOs were designed and experimentally optimized according to Zong's protocol: ASO-lncRFC4 and ASO-lncRFC4-2. After optimization, one effective ASO targeting lncRNA-RFC4, ASO-lncRFC4, was selected for the prolonged knockdown protocol (Supplementary Figure 1). As a positive control, a previously confirmed efficient ASO targeting lncRNA MALAT1⁸ was used: ASO-MALAT1. For the negative control, an ASO targeting the Escherichia coli lacZ gene, ASO-lacZ (NCBI accession number: FN297865), was designed.

2. Preparation of cells

NOTE: Work inside the cell culture hood every time cell lines, solutions, material, or any product to be used during cell culture manipulation is handled. When manipulating liquids for cell culture, always use sterilized serological pipettes or micropipettes with sterilized tips. Always fulfill and follow all the safety requirements indicated in the institution's laboratory safety manual during the whole protocol.

Prepare the complete cell culture media for each cell line as described below.
1. For HCT116, prepare McCoy's 5A medium with 10% of fetal bovine serum (FBS).
2. For PrEC, prepare prostate epithelial cell basal medium with the prostate epithelial cell growth kit.
Use three 100 mm culture plates (55 cm² surface area) for KD experiments, one for each oligonucleotide to be used: ASO targeting the lncRNA, ASO to be used as a positive control (ASO-MALAT1) and ASO to be used as a negative control (ASO-lacZ).
Use two 35 mm culture plates (9 cm² in surface area) to be used as checkpoints for KD between cell passages, one of which will be transfected with complete transfection media for ASO-lncRFC4 and the other for ASO-lacZ.
NOTE: Transfection was planned according to the lipid-based transfection reagent (see Table of Materials) manufacturer´s procedures and protocols previously reported⁴¹^,⁴².
Seed cells to a density of 1 x 10⁴ cells/cm² in cell culture dishes. Incubate at 37 °C in the incubator using 5% CO₂ in air until cells reach 50% confluency (when 50% of the surface is covered by the cell monolayer). With a confluence of 50%, cells are ready to be transfected for this protocol.
NOTE: For transfection of ASO-lncRFC4 and ASO-lacZ, one 100 mm dish and one 35 mm dish were seeded. For transfection of ASO-MALAT1, only a 100 mm dish was seeded (Figure 3A).

3. Transfection

Warm up reduced serum medium to 37 °C prior to the start of the procedure.
For transfection with ASO-lacZ and ASO-lncRFC4, follow the steps described below.
NOTE: Transfection with ASO-lacZ and ASO-lncRFC4 is planned for cells in a surface area of 55 cm²; when different areas are used, volumes can be adjusted accordingly. This procedure must be performed for each ASO used under the same conditions.
1. Prepare tube 1 inside the cell culture hood by dissolving 43.75 µL of ASO (20 µM) in 1.4 mL of warm reduced serum medium in a 15 mL conical centrifuge tube.
2. Prepare tube 2 inside the cell culture hood by mixing 18.66 µL of lipid-based transfection reagent with 1.4 mL of warm reduced serum medium in a 1.5 mL RNase-free microfuge tube.
3. Incubate tubes 1 and 2 inside the cell culture hood at room temperature for 10 min.
4. Add the solution contained in tube 2 (transfection reagent + reduced serum) directly to tube 1 (ASO + reduced serum) slowly, drop by drop, to avoid spreading the reagents over the surface of the tube.
5. Incubate the mixture contained in tube 1 for 20 min inside the culture hood at room temperature.
6. Add warm reduced serum medium to tube 1 to a final volume of 8.75 mL.
  NOTE: The final transfection media contained ASO at a concentration of 100 nM.
7. Remove the culture media from the cell culture dish containing the cells to be transfected and add 7.5 mL of the transfection media to the 100 mm culture plate and 1 mL to the 35 mm culture plate directly in the cell monolayer, drop by drop. Make sure the media is evenly distributed along the whole surface by gentle shaking of the dish.
8. Incubate in an incubator at 37 °C with 5% CO₂ in air for 6 h.
9. After 6 h of incubation in the transfection media, add 7.5 mL of complete media to the cells in the 100 mm culture plate and 1 mL of complete media to the cells in the 35 mm culture plate. Incubate at 37 °C and 5% CO₂.
For transfection with ASO-MALAT1, perform the experiments as described below.
NOTE: Transfection with ASO-MALAT1 is planned for cells in a surface area of 55 cm².
1. Prepare tube 1 inside the cell culture hood by dissolving 37.5 µL of ASO (20 µM) in 1.2 mL of warm reduced serum medium in a 15 mL conical centrifuge tube.
2. Prepare tube 2 by mixing 16 µL of lipid-based transfection reagent with 1.2 mL of warm reduced serum medium.
3. Incubate tubes 1 and 2 at room temperature for 10 min inside the cell culture hood.
4. Add the solution contained in tube 2 (lipid-based transfection reagent + reduced serum) directly to tube 1 (ASO + reduced serum) slowly, drop by drop, to avoid spreading the reagents over the surface of the tube.
5. Incubate the mixture contained in tube 1 for 20 min inside the culture hood at room temperature.
6. Add warm reduced serum medium to tube 1 to a final volume of 7.5 mL. The final transfection media contained ASO at a concentration of 100 nM.
7. Remove the culture media from the cell culture dish containing the cells to be transfected and add 7.5 mL of the transfection media directly to the cell monolayer dropwise to ensure that the medium is evenly distributed along the whole surface by gentle shaking of the dish.
8. Incubate at 37 °C in an incubator using 5% CO₂ in air for 6 h.
9. After 6 h of incubation with the transfection media, add 7.5 mL of complete media to the cells and incubate in an incubator at 37 °C and 5% CO₂.
Assess cells microscopically every 12-24 h until cells are ready for the next transfection round.
NOTE: Next, transfection must be performed when cells achieve confluence of 70%. If needed, exchange media replacing with complete culture medium.
When cells are 70% confluent in the cell culture dish, repeat the procedure (steps 3.1 to 3.4) and perform the next round of transfection.
NOTE: After the second transfection, cells should be assessed microscopically every 12-24 h. Cell harvest and passaging must be performed when cells achieve confluence of 80%-85%. If needed, exchange media replacing with complete culture medium.

4. Cell harvest and passaging

NOTE: Cell harvest and passaging are performed after every 2 rounds of transfection and after the 2^nd, 4^th, and 6^th rounds of transfection. The mean time for harvest in HCT116 cells was 6 days after the 1^st, 3^rd, and 5^th transfections, and for PrEC cells, the mean time was 7 days after the 1^st, 3^rd, and 5^th transfections. The timepoint for transfection differs for both cell lines used in this protocol. For HCT116, the 2^nd, 3^rd, 4^th, 5^th, and 6^th transfections are performed 3, 6, 9, 12 and 15 days after the first transfection, respectively. For PrEC, the 2^nd, 3^rd, 4^th, 5^th, and 6^th transfections are performed 3, 7, 10, 14 and 18 days after the first transfection, respectively. Refer to the timeline in Figure 3 to check timepoints for transfection, passaging, and harvesting.

Perform cell harvesting and passaging for the KD experiments in 100 mm culture plates as described below.
1. Proceed to harvest cells and passage when cells achieve confluence of 80%-85%.
2. Warm up the complete medium and wash solutions to 37 °C. Warm up the dissociation reagent to room temperature. Warm up the neutralizing solution for the dissociation reagent to room temperature.
  NOTE: Washing solutions, dissociation reagents and neutralizing solutions differ for the two cell lines used in this protocol. HCT116 cells are washed with PBS (phosphate buffered saline) and dissociated with trypsin-EDTA solution. Neutralization of the dissociation reagent is performed with complete culture media for HCT116 cells. For PrEC, HEPES-buffered saline solution is used as the washing solution. Trypsin-EDTA is used as the dissociation reagent. For neutralization of the dissociation reagent, use trypsin neutralizing solution.
3. Inside the culture hood, remove culture media from the cell culture dish and wash gently with 3 mL of washing solution, followed by discarding the washing solution. Repeat this step 2x.
4. Add 2 mL of dissociation reagent according to the cell line to the cell monolayer and incubate at 37 °C for 3-5 min. Assess cells every 2 min until dissociation is complete.
5. Add 2 mL of neutralizing solution according to the cell line and transfer the whole volume of the cell suspension from the cell culture dish to a 15 mL conical centrifuge tube.
6. For RNA extraction, take 500 µL of the cell suspension and transfer it to a 1.5 mL centrifuge tube. Place the tube on ice and proceed to step 5.1 for RNA extraction and RT-qPCR.
7. Centrifuge the rest of the cell suspension at 120 x g for 5 min at room temperature and discard the supernatant.
8. Resuspend the cell pellet in 2 mL of complete culture media and proceed to cell counting according to standard procedures.
9. For karyotyping, seed cells to a density of 1 x 10⁴ cells/cm² in a cell culture dish of 35 mm in diameter (surface area of 9 cm²), incubate in an incubator at 37 °C at 5% CO₂ in air for 24 h and proceed to karyotyping according to standard procedures.
10. To continue the KD experiments in the next cellular passage, seed cells to a density of 1 x 10⁴ cells/cm² in a new cell culture dish 100 mm in diameter. This dish will be passage number 2 for the experiment. Incubate at 37 °C in incubator using 5% CO₂ in air until cells achieve confluence of 50%.
  NOTE: If desired, the remaining cells can be used for protein extraction and/or freezing according to standard procedures.
11. Repeat steps 3.1 to 4.1.10 for transfection and harvesting from passage 2 and from passage 3.
Follow the next procedure for cell harvest for the checkpoints of the KD experiments in 35 mm culture dishes.
NOTE: The harvest for the first checkpoint in the KD experiment is performed 2 days after the 2^nd and 4^th transfection procedures.
1. Warm up the complete media and washing solutions to 37 °C. Warm up the dissociation reagent to room temperature. Warm up the neutralizing solution for the dissociation reagent to room temperature.
2. Inside the culture hood, remove culture media from the cell culture dish and wash gently with 0.5 mL of washing solution and then discard the washing solution. Repeat this step 2x.
3. After discarding the washing solutions, add 0.5 mL of dissociation reagent according to the cell line and incubate at 37 °C for 3-5 min. Assess cells every 2 min until the dissociation is complete.
4. Add 0.5 mL of neutralizing solution according to the cell line and transfer the whole volume of the cell suspension from the cell culture dish to a 1.5 mL microcentrifuge tube and place it on ice.
5. Proceed to step 5.1 for RNA extraction and qPCR.

5. RNA extraction and RT-PCR

Centrifuge the cell suspension at 200 x g for 2 min at 4 °C and discard the supernatant. Wash the cell pellet with 600 µL of cold PBS (4 °C).
Centrifuge the cell suspension at 200 x g for 2 min at 4 °C and discard the supernatant.
Use the cell pellet for RNA extraction according to standard procedures.
Proceed to DNase treatment of the purified RNA according to the standard procedure followed in the laboratory. At the pause point, store purified RNA at -80 °C for long periods.
Use the RNA for standard cDNA synthesis with every RNA sample obtained. At the pause point, store cDNA at -20 °C for long periods.
Perform standard qPCR as per the steps described below.
1. For qPCR, oligonucleotides amplify the following transcripts: lncRNA of interest, MALAT1 and a constitutively expressed gene as an internal control (Table 1). For this protocol, the expression RPS28 was used as an internal control.
2. Perform qPCR reactions to amplify the internal control, the lncRNA of interest and MALAT1 using cDNA from the ASO-LacZ sample. This sample will be used to normalize the expression from the other samples.
3. Perform qPCR reactions to amplify the internal control RPS28 and the lncRNA of interest using cDNA from the ASO-lncRNA sample.
4. Perform qPCR reactions to amplify the internal controls RPS28 and MALAT1 using cDNA from the ASO-MALAT1 sample. Follow reaction set up and thermocycler conditions as described in Table 2.
5. Analyze qPCR data by ΔΔCt normalization of the expression of the transcript of interest against the internal control, and then, normalize the expression of the transcript of interest (lncRNA or MALAT1) against the expression of the same transcript in the ASO-LacZ sample to obtain the relative expression level of the transcript.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

In the present protocol, the use of ASOs was adapted to the KD of a nuclear lncRNA for a prolonged time in the human cell lines PrEC and HCT116.

Certainly, the KD experiment was successful in the cell line PrEC for 21 days of the experiment, as observed in Figure 4. To confirm this statement, in addition to analyzing expression in the days of cell passaging (Figure 4 A-C), we analyzed the checkpoints established between passages 1 and 2 and between passages 2 and 3; a total of 5 times (Figure 4-D). Successful KD of lncRNA-RFC4 was observed every time when cells were harvested, and the expression of lncRNA-RFC4 was significantly lower in the cells treated with ASO-lncRFC4 than in the control ASO-lacZ cells. The times for checkpoint harvesting were carefully selected to be performed between the longer periods without cell transfection. The chemistry of the ASOs used in this protocol has been proven to confer resistance to nucleases and maintain the stability of the ASO for more than 120 h (5 days)⁵⁶. The longest time without ASO transfection of the cells was 84 h, and checkpoints were performed just before the next transfection round, assuring effective KD during the 21 days of experiment.

For the cell line HCT116, similar results were observed. The experiment in this cell line lasted 18 days because it has a shorter duplication time in comparison to PrEC. During the whole experiment, in HCT116 cells, KD was successful. The expression of lncRNA-RFC4 was significantly lower in the cells transfected with ASO-lncRFC4 than in those transfected with the control ASO-lacZ in the 3 passages analyzed (Figure 5 A-C) and in the checkpoints for the experiment (Figure 5D). The longest period without transfection in this cell line was 72 h, and the checkpoints were performed just before the next transfection round after the longest period without transfection. In this way, it was assured that KD was performed along the 18 days of the experiment in HCT116 cells.

On the other hand, in the experiments with the positive control ASO-MALAT1, the expression of lncRNA-MALAT1 was analyzed by qPCR, and the results in PrECs (Figure 6A-C) and HCT116 (Figure 6D-F) cells confirmed the success of the transfection protocol in these experiments. The expression of lncRNA-MALAT1 was significantly lower in the cells treated with ASO-MALAT1 than in the control cells treated with ASO-lacZ.

The results obtained after the implementation of this procedure confirm the success of the KD of lncRNA-RFC4 in both cell lines analyzed during the whole experiment (Supplementary Figure 2). Successful silencing of this lncRNA during the duration of the experiment will be helpful in evaluating CIN in this experimental model.

FIGURE 1. Secondary structure of linc-RFC4, nucleotides 1 to 197. The lowest free energy structure was predicted by RNAfold WebServer, accessed January 2020, University of Vienna, and the colors represent the base-pair probabilities. The structure of the 1.2 kb lncRNA is shown at the bottom. The blue box highlights the structure that contains the target site for ASO-lncRFC4. The red dotted line represents the complementary target region for ASO-lncRFC4. Please click here to view a larger version of this figure.

FIGURE 2. Antisense oligonucleotide chemistry modifications. (A) ASOs were synthesized with phosphorothioate bonds among the whole sequence (circled in red). (B) The 5 nucleotides in the 5' and 3' ends had the 2'-O-methyl modification (circled in red). (C) Representation of the ASO used for this protocol, 20 nucleotides in length with 10 nucleotides with an unmodified sugar ring flanked by 5 nucleotides to the 5' and 3' ends with a sugar ring modified with 2'-O-methyl. Please click here to view a larger version of this figure.

Figure 3. Schematic representation of the transfection procedure. (A) For each cellular passage, 5 dishes were seeded in total with three 100 mm culture plates for transfection with ASO-lacZ, ASO-lncRFC4 and ASO-MALAT1. These dishes were used for the KD experiment for harvesting and cellular passage. The 2 remaining dishes were 35 mm culture plates for transfection with ASO-lacZ and ASO-lncRFC4 to be used as checkpoints between cell passages. The transfection procedure was started when cells achieve the desired confluency. (B) Preparation of tubes 1 and 2. In tube 1, ASO is mixed with reduced serum medium, and a mixture of Lipofectamine and reduced serum medium is prepared in tube 2. (C) Adding of contents of tube 2 into tube 1. (D) Incubation for 20 min at room temperature. (E) Complete transfection media with reduced serum medium. (F) Addition of transfection media to the cells and incubation. Please click here to view a larger version of this figure.

Figure 4. Knockdown of lncRNA-RFC4 in the PrEC cell line. Graphics represent the expression of lncRNA-RFC4 obtained from the analysis of the qPCR data by ΔΔCt in the samples collected from KD experiments in the cell line PrEC. Error bars represent standard deviation. Experiments were conducted in biological triplicates. (A) The expression of the lncRNA in the first passage was significantly lower (p<0.05) in the cells treated with ASO-lncRFC4 than in the control cells treated with ASO-lacZ, and successful KD was achieved in this cellular passage. A significant KD effect was observed in passage two (B) and passage three (C), achieving a KD effect over 21 days in this cell line. (D) Checkpoints collected between passages at days 9 and 16 show a significant KD effect (p<0.05) on the cells treated with ASO-lncRFC4 compared to the control ASO-lacZ. Please click here to view a larger version of this figure.

Figure 5. Knockdown of lncRNA-RFC4 in the HCT116 cell line. Graphics represent the expression of lncRNA-RFC4 obtained from the analysis of the qPCR data by ΔΔCt in the samples collected from KD experiments in the HCT116 cell line. Error bars represent standard deviation. Experiments were conducted in biological triplicates. (A) The expression of the lncRNA in the first passage was significantly lower (p<0.05) in the cells treated with ASO-lncRFC4 than in the control cells treated with ASO-lacZ, and successful KD was achieved in this cellular passage. A significant KD effect was observed in passage two (B) and passage three (C), achieving a KD effect over 18 days in this cell line. (D) Checkpoints collected between passages at days 8 and 14 show a significant KD effect (p<0.05) on the cells treated with ASO-lncRFC4 compared to the control ASO-lacZ. Please click here to view a larger version of this figure.

Figure 6. Knockdown of ASO-MALAT1 was used as a positive control for transfection in PrEC and HCT116 cells. Graphics represent the expression of lncRNA-MALAT1 obtained from the analysis of the qPCR data by ΔΔCt in the samples collected from KD experiments in the cell lines PrEC (A-C) and HCT116 (D-F). Error bars represent standard deviation. A significant KD effect (p<0.05) was observed in the 3 cell passages analyzed during the experiment. Please click here to view a larger version of this figure.

Antisense Oligonucleotide	Sequence
ASO-lincRFC4-1	UCACUTGTCCGCTGCCUGCU
ASO-MALAT1	AUGGAGGTATGACATAUAAU
ASO-LacZ	GCUUCATCCACCACAUACAG
qPCR Oligonucleotides
lncRFC4_FW-151	GGGTCATCTAGCCCATTCCC
lncRFC4_RV-151	TCCTGTGTCTTTCTCTGCGT
RPS28_FW-101	CGATCCATCATCCGCAATG
RPS28_RV-101	AGCCAAGCTCAGCGCAAC
MALAT1-104.FW	GGATTCCAGGAAGGAGCGAG
MALAT1-104.RV	AGGATCCTCTACGCACAACG

Table 1. Sequences of antisense oligonucleotides and oligonucleotides for qPCR.

Reaction setup
qPCR Master Mix (2X)		5 µL
Forward primer		0.2 µM
Reverse primer		0.2 µM
cDNA		1 ng/µL
Nuclease-Free water		To 10 µL
Total volume		10 µL
Thermocycler conditions
Temperature	Time		Number of cycles
95 °C	10 min		1
95 °C	20 s
60 °C	20 s		40
72 °C	20 s

Table 2: Reaction setup for performing qPCR.

Supplementary Figure 1. ASO concentration optimization. Graphics represent the expression of lncRNA-RFC4 obtained from the analysis of the RT-qPCR data by ΔΔCt in the concentration optimization protocol in the cell line PrEC. Error bars represent standard deviation. Experiments were conducted in technical triplicates (n=3). (A) The KD effect of lncRNA-RFC4 using ASO-lncRFC4 was significant (p<0.05) at concentrations of 50 nM and 100 nM, and at concentrations of 150 nM and 200 nM, the KD effect was not significant (p>0.05). (B) KD of lncRNA-RFC4 using ASO-lncRFC4-2 at the 4 concentrations used (50 nM, 100 nM, 150 nM, and 200 nM) was not significantly different in comparison to that of the control ASO-LacZ (p>0.05). After optimization, ASO-lncRFC4 was selected because it induced a significant knockdown effect. Even though the strongest knockdown effect was at 50 nM with this ASO, the concentration that induced the strongest biological effect in this model (regulation of the adjacent coding gene RFC4) was 100 nM, which is why this concentration was selected for the protocol of prolonged knockdown. Please click here to download this File.

Supplementary Figure 2. ASO-lncRFC4 mediates specific knockdown of the lncRNA-RFC4. Graphics were obtained from the analysis of the RT-qPCR data by ΔΔCt in the KD experiments in PrEC in the passages 1 (day 7), 2 (day 14) and 3 (day 21) and represent the expression of the lncRNA-MALAT1 (A), the protein coding gene EIF4A2 (B) which is adjacent to the 3' end of RFC4, and the protein coding gene TP53 (C), a gene related to CIN. The specific target of ASO-lncRFC4 is the lncRNA-RFC4, expression of the other transcripts was measured to show that ASO-lncRFC4 is specific to the lncRNA-RFC4 and does not affect the expression of other transcripts, coding, or non-coding. Please click here to download this File.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

As previously mentioned, lncRNAs have key regulatory functions in the cell; thus, dysregulation of these transcripts may be involved in diseases. Cancer is one such disease characterized by lncRNA dysregulation⁴³^,⁴⁴. In this disease, lncRNAs are known to play important regulatory roles as oncogenes⁴⁵ or tumor suppressors⁴⁶. Some of them are involved in the development of hallmarks of cancer, and they can regulate, for example, proliferation⁴⁷^,⁴⁸^,⁴⁹, clinical progression, metastasis⁴⁸^,⁵⁰^,⁵¹^,⁵²^,⁵³ and CIN⁵⁴, with CIN being an important enabling hallmark of human cancer⁵⁵. One of the obstacles to overcome when studying CIN is that this condition is only observed over time, and for establishment of CIN, cells must be analyzed over time, not only in one observation, because methodologies for functional studies on genes related to CIN must achieve changes in gene expression over a prolonged time.

The use of ASOs for lncRNA KD has become a good alternative to overcome the undesired effects of the technologies used for genome engineering, such as CRISPR-Cas, where the off-target effects or the modification of the chromatin state in the edited region may cause adverse biological effects⁵⁷^,⁵⁸^,⁵⁹. Nevertheless, in contrast to CRISPR-Cas systems, the use of ASOs has a disadvantage: the temporary KD effect after transfection. To overcome this situation, we developed this methodology where a series of transfections are performed to achieve a prolonged KD of the nuclear lncRNA-RFC4 without disturbing the chromatin state in the genomic region to be studied.

For successful nuclear silencing using ASOs, it is important that ASOs are delivered in the nucleus, where they hybridize by Watson-Crick base pairing to their target and recruit RNase H to cleave the target RNA; thus, ASOs must maintain stability over time inside the cell. Chemically modified ASOs can maintain stability for a longer time than unmodified oligonucleotides. One of the modifications added to the ASOs used for this protocol is the phosphorothioate (PS) bonds along the sequence (Figure 2A). This modification increases the stability of the ASO, protecting it from nuclease degradation⁶⁰^,⁶¹^,⁶² and thus increasing the half-life of the ASO from hours to days. In the study conducted by Iwamoto et al.⁵⁶, a series of ASOs with and without PS bonds was tested in vivo, and ASOs without PS bonds were completely degraded after 48 h in contrast to ASOs containing PS bonds, where no significant degradation was observed even after 120 h. A 2'-ribose modification added to the 5 nucleotides in the 5' and 3' ends was also added to the ASOs used in this protocol (Figure 2B). This modification confers stability protecting against digestion by nucleases, blocks the nucleophilic 2′ hydroxyl moiety⁶⁰, provides higher binding affinity to target RNA and increases lipophilicity⁶³. The stability of the ASO to be used for this protocol is critical, and the combination of both modifications mentioned previously increases the half-life of the ASO for the success of the experiment.

Another important step in this protocol is ASO design. The experiment must be designed with controls, a positive control that will indicate the success of the transfection and KD and a negative control that mimics the same conditions without targeting any sequence in the genome of the experimental model to be used. In this experiment, a previously characterized and successful ASO targeting the lncRNA MALAT1⁸ was used as a positive control for the transfection procedure; nevertheless, the use of a positive control may differ from the cell lines and experimental models used. For selection of a positive control for the KD experiment, it is important to confirm that the target RNA to be used as a positive control is expressed in the model to be used. As a negative control, an ASO was designed to target the Escherichia coli lacZ gene. Confirmation that the negative control does not have targets in the genome of the experimental model to be used is mandatory to avoid off-target effects in the experiment. In the same way, for the ASO targeting the gene of interest, it is important to confirm that there is no other target RNA in the model to be used.

With respect to the experimental design of this protocol, for successful confirmation of the KD effect of the ASO targeting the lncRNA, the expression analysis must be done comparing the ASO of interest, in this case the ASO-lncRFC4, against the ASO used as negative control, which in this case was ASO-lacZ, which is why cells are transfected with the ASO-lacZ and ASO-lncRFC4 separately. Unsuccessful KD may occur. For determination of whether the failure of the experiment was due to troubles with the transfection protocol, it is important to use the positive control ASO against MALAT1 when successful KD is observed in the positive control ASO but not in the ASO targeting the gene of interest. One of the reasons for this failure could be the low efficiency of the ASO designed, and at least 2 different ASOs should be designed prior to the prolonged KD experiment to choose the more efficient one. On the other hand, when unsuccessful KD is observed even in the positive control, problems with transfection may have occurred for a wide variety of reasons; among them, the transfection efficiency across different cell lines and experimental models may differ⁶⁴, and transfection optimization must be performed using the positive control. Another reason might be the lack of expression of the transcript used as a positive control in the experimental model. To overcome this situation, before the experiment, the expression of the transcript to be used as a positive control must be experimentally confirmed. In addition to seeding the cells for the KD experiment and evaluation of CIN, it is important to seed cells to be used as checkpoints during longer periods without transfection in the experiment. As mentioned previously, the half-life of the ASOs with the chemical modifications used in this protocol is longer than 120 h in in vivo models. For this purpose, the checkpoints were selected to be evaluated after the longer period without transfection, just before the next transfection round. For PrEC and HCT116, the checkpoints were performed 84 and 72 h after the last transfection, respectively, thus assuring a silencing effect of the targeted nuclear lncRNA.

Furthermore, for comparison of the several technologies for gene KD, it is important for the selection of the proper methodology to be aware of the objective of the study because each of the technologies used to modify gene expression has its own advantages and disadvantages. In this study, lncRNA-RFC4 was characterized for the first time; consequently, to study the function of the new lncRNA, a methodology that minimally alters the chromatin state of the region must be used. In this case, the use of CRISPR-Cas systems to induce permanent modifications that result in diminished gene expression may have created effects that could have not been entirely produced by the KD of the lncRNA but also from the modification of the chromatin state in the region. Since this novel lncRNA and its locus are still poorly characterized, it is not known whether the region contains important regulatory elements such as enhancers or other underlying DNA elements that could have been disturbed by the complete removal of these sequences in the knockout induced by CRISPR-Cas technologies. Because of this, for successful knockdown without modifying the gene locus, ASO technology was selected, a tool that induces KD of the lncRNA without modifying the genomic region from which it is transcribed⁶⁵. This is a better approach to study the function of the transcript itself and not the function of the genomic region from which it is transcribed.

In the methodology proposed here, a prolonged KD of a nuclear lncRNA was successfully achieved by performing a series of transfections of chemically modified ASOs in two human cell lines.

In this protocol, the prolonged KD effect was applied to evaluate CIN in this cellular model, a phenomenon that can be evaluated only through time and cell aging. The evaluation of CIN is an important step in cancer research because this characteristic is an enabling hallmark of cancer that facilitates the acquisition of different malignant capabilities in the cell, but in addition to CIN, the prolonged KD of lncRNAs is a useful tool to study different biological processes. One of the main areas of interest is in developmental biology and embryology, where the expression patterns of lncRNAs, among other transcripts, are well controlled over time.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

The authors declare no conflict of interest.

Acknowledgments

Montiel-Manriquez, Rogelio is a doctoral student from Programa de Doctorado en Ciencias Biomédicas, Universidad Nacional Autónoma de México (UNAM) and has received CONACyT fellowship with CONACyT CVU number: 581151.

Materials

Name	Company	Catalog Number	Comments
15ml Centrifuge Tubes - 15ml Conical Tubes	Thermo Fisher Scientific	339650
Corning 100 mm TC-treated Culture Dish	Corning	430167	Surface area:55 cm2
Corning 35 mm TC-treated Culture Dish	Corning	430165	Surface area: 9 cm2
DPBS, no calcium, no magnesium	Thermo Fisher Scientific	14190144
Fetal Bovine Serum (FBS)	ATCC	30-2020
HCT 116 cell line	ATCC	CCL-247
HEPES, 1M Buffer Solution	Thermo Fisher Scientific	15630122
Integrated DNA Technologies	NA	NA	https://www.idtdna.com/
Lipofectamine RNAiMAX Reagent	Thermo Fisher Scientific	13778150
McCoy's 5A medium	ATCC	30-2007
Normal Human Primary Prostate Epithelial Cells (HPrEC)	ATCC	PCS-440-010
Nucleotide Blast NCBI	NA	NA	https://blast.ncbi.nlm.nih.gov/Blast.cgi
Opti-MEM Reduced Serum Media	Thermo Fisher Scientific	31985070
PBS (10X), pH 7.4	Thermo Fisher Scientific
Prostate Epithelial Cell Basal Medium	ATCC	PCS-440-030
Prostate Epithelial Cell Growth Kit	ATCC	PCS-440-040
Reverse complement online tool	NA	NA	https://www.bioinformatics.org/sms/rev_comp.html
RNAfold WebServer	NA	NA	http://rna.tbi.univie.ac.at//cgi-bin/RNAWebSuite/RNAfold.cgi
RNase-free Microfuge Tubes, 1.5 mL	Thermo Fisher Scientific	AM12400
TrypLE Express Enzyme (1X), no phenol red	Thermo Fisher Scientific	12604013	Trypsin-EDTA solution
Trypsin Neutralizing Solution	ATCC	PCS-999-004
Trypsin-EDTA for Primary Cells	ATCC	PCS-999-003
UCSC Genome Browser, Human (GRCh38/hg38)	NA	NA	https://genome.ucsc.edu/

DOWNLOAD MATERIALS LIST

References

Fang, S., et al. NONCODEV5: a comprehensive annotation database for long non-coding RNAs. Nucleic Acids Research. 46 (Database issue), D308-D314 (2018).
Kopp, F., Mendell, J. T. Functional Classification and Experimental Dissection of Long Noncoding RNAs. Cell. 172 (3), 393-407 (2018).
Palazzo, A. F., Koonin, E. V. Functional Long Non-coding RNAs Evolve from Junk Transcripts. Cell. 183 (5), 1151-1161 (2020).
Ransohoff, J. D., Wei, Y., Khavari, P. A. The functions and unique features of long intergenic non-coding RNA. Nature Reviews Molecular Cell Biology. 19 (3), 143-157 (2017).
Chen, L. L. Linking Long Noncoding RNA Localization and Function. Trends in Biochemical Sciences. 41 (9), 761-772 (2016).
Basu, S., Larsson, E. A Catalogue of Putative cis-Regulatory Interactions Between Long Non-coding RNAs and Proximal Coding Genes Based on Correlative Analysis Across Diverse Human Tumors. G3: Genes|Genomes|Genetics. 8 (6), 2019-2025 (2018).
Petermann, F., et al. The Magnitude of IFN-γ Responses Is Fine-Tuned by DNA Architecture and the Non-coding Transcript of Ifng-as1. Molecular Cell. 75 (6), 1229.e5-1242.e5 (2019).
Tripathi, V., et al. The Nuclear-Retained Noncoding RNA MALAT1 Regulates Alternative Splicing by Modulating SR Splicing Factor Phosphorylation. Molecular Cell. 39 (6), 925-938 (2010).
Chen, L. L., Carmichael, G. G. Decoding the function of nuclear long non-coding RNAs. Current Opinion in Cell Biology. 22 (3), 357-364 (2010).
Vance, K. W., Ponting, C. P. Transcriptional regulatory functions of nuclear long noncoding RNAs. Trends in Genetics. 30 (8), 348-355 (2014).
Ren, H., Zhang, Z., Zhang, W., Feng, X., Xu, L. Prodrug-type antisense oligonucleotides with enhanced nuclease stability and anti-tumour effects. European Journal of Pharmaceutical Sciences. 162, 105832 (2021).
Kole, R. RNA therapeutics: beyond RNA interference and antisense oligonucleotides. DRUG DISCOVERY. 16, (2012).
DeVos, S. L., Miller, T. M. Antisense Oligonucleotides: Treating Neurodegeneration at the Level of RNA. Neurotherapeutics. 10 (3), 486-497 (2013).
Le, B. T., et al. Antisense Oligonucleotides Targeting Angiogenic Factors as Potential Cancer Therapeutics. Molecular Therapy Nucleic Acids. 14, 142-157 (2019).
Shadid, M., Badawi, M., Abulrob, A. Antisense oligonucleotides: absorption, distribution, metabolism, and excretion. Expert Opinion on Drug Metabolism & Toxicology. 17 (11), 1281-1292 (2021).
Roberts, T. C., Langer, R., Wood, M. J. A. Advances in oligonucleotide drug delivery. Nature Reviews Drug Discovery. 19 (10), 673-694 (2020).
Havens, M. A., Hastings, M. L. Splice-switching antisense oligonucleotides as therapeutic drugs. Nucleic Acids Research. 44 (14), 6549-6563 (2016).
Michaels, W. E., Pena-Rasgado, C., Kotaria, R., Bridges, R. J., Hastings, M. L. Open reading frame correction using splice-switching antisense oligonucleotides for the treatment of cystic fibrosis. Proceedings of the National Academy of Sciences. 119 (3), e2114886119 (2022).
Lim, K. H., et al. Antisense oligonucleotide modulation of non-productive alternative splicing upregulates gene expression. Nature Communications. 11 (1), 3501 (2020).
Crooke, S. T. Molecular Mechanisms of Antisense Oligonucleotides. Nucleic Acid Therapeutics. 27 (2), 70-77 (2017).
Monia, B. P., Johnston, J. F., Sasmor, H., Cummins, L. L. Nuclease Resistance and Antisense Activity of Modified Oligonucleotides Targeted to Ha. Journal of Biological Chemistry. 271 (24), 14533-14540 (1996).
Grünweller, A., et al. Comparison of different antisense strategies in mammalian cells using locked nucleic acids, 2′-O-methyl RNA, phosphorothioates and small interfering RNA. Nucleic Acids Research. 31 (12), 3185-3193 (2003).
Amodio, N., et al. Drugging the lncRNA MALAT1 via LNA gapmeR ASO inhibits gene expression of proteasome subunits and triggers anti-multiple myeloma activity. Leukemia. 32 (9), 1948-1957 (2018).
Yoo, B. H., Bochkareva, E., Bochkarev, A., Mou, T. C., Gray, D. M. 2′-O-methyl-modified phosphorothioate antisense oligonucleotides have reduced non-specific effects in vitro. Nucleic Acids Research. 32 (6), 2008-2016 (2004).
Chu, H. P., et al. TERRA RNA Antagonizes ATRX and Protects Telomeres. Cell. 170 (1), 86.e16-101.e16 (2017).
Kasuya, T., et al. Ribonuclease H1-dependent hepatotoxicity caused by locked nucleic acid-modified gapmer antisense oligonucleotides. Scientific Reports. 6 (1), 30377 (2016).
Swayze, E. E., et al. Antisense oligonucleotides containing locked nucleic acid improve potency but cause significant hepatotoxicity in animals. Nucleic Acids Research. 35 (2), 687-700 (2007).
Hyjek, M., Figiel, M., Nowotny, M. RNases H: Structure and mechanism. DNA Repair. 84, 102672 (2019).
Lima, W. F., De Hoyos, C. L., Liang, X., Crooke, S. T. RNA cleavage products generated by antisense oligonucleotides and siRNAs are processed by the RNA surveillance machinery. Nucleic Acids Research. 44 (7), 3351-3363 (2016).
Fu, Y., et al. High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells. Nature Biotechnology. 31 (9), 822-826 (2013).
Drews, R. M., et al. A pan-cancer compendium of chromosomal instability. Nature. 606 (7916), 976-983 (2022).
Benhra, N., Barrio, L., Muzzopappa, M., Milán, M. Chromosomal Instability Induces Cellular Invasion in Epithelial Tissues. Developmental Cell. 47 (2), 161.e4-174.e4 (2018).
Gronroos, E., López-García, C. Tolerance of Chromosomal Instability in Cancer: Mechanisms and Therapeutic Opportunities. Cancer Research. 78 (23), 6529-6535 (2018).
Liu, L., et al. An RFC4/Notch1 signaling feedback loop promotes NSCLC metastasis and stemness. Nature Communications. 12 (1), 2693 (2021).
Shiomi, Y., Nishitani, H. Control of Genome Integrity by RFC Complexes; Conductors of PCNA Loading onto and Unloading from Chromatin during DNA Replication. Genes. 8 (2), (2017).
Carter, S. L., Eklund, A. C., Kohane, I. S., Harris, L. N., Szallasi, Z. A signature of chromosomal instability inferred from gene expression profiles predicts clinical outcome in multiple human cancers. Nature Genetics. 38 (9), 1043-1048 (2006).
Gruber, A. R., Lorenz, R., Bernhart, S. H., Neuböck, R., Hofacker, I. L. The Vienna RNA Websuite. Nucleic Acids Research. 36 (suppl_2), W70-W74 (2008).
Wan, W. B., et al. Synthesis, biophysical properties and biological activity of second generation antisense oligonucleotides containing chiral phosphorothioate linkages. Nucleic Acids Research. 42 (22), 13456-13468 (2014).
Kanavarioti, A. HPLC methods for purity evaluation of man-made single-stranded RNAs. Scientific Reports. 9 (1), 1019 (2019).
Zong, X., et al. Knockdown of Nuclear-Retained Long Noncoding RNAs Using Modified DNA Antisense Oligonucleotides. Nuclear Bodies and Noncoding RNAs: Methods and Protocols. , 321-331 (2015).
Zhao, M., et al. Lipofectamine RNAiMAX: An Efficient siRNA Transfection Reagent in Human Embryonic Stem Cells. Molecular Biotechnology. 40 (1), 19-26 (2008).
Nuclear bodies and noncoding RNAs: methods and protocols. , Humana Press. New York. (2015).
CAWG Drivers and Functional Interpretation Group. Cancer LncRNA Census reveals evidence for deep functional conservation of long noncoding RNAs in tumorigenesis. Communications Biology. 3 (1), 56 (2020).
Schmitt, A. M., Chang, H. Y. Long Noncoding RNAs in Cancer Pathways. Cancer Cell. 29 (4), 452-463 (2016).
Hosono, Y., et al. Oncogenic Role of THOR, a Conserved Cancer/Testis Long Non-coding RNA. Cell. 171 (7), 1559.e20-1572.e20 (2017).
Cho, S. W., et al. Promoter of lncRNA Gene PVT1 Is a Tumor-Suppressor DNA Boundary Element. Cell. 173 (6), 1398.e22-1412.e22 (2018).
Ding, W., Ren, J., Ren, H., Wang, D. Long Noncoding RNA HOTAIR Modulates MiR-206-mediated Bcl-w Signaling to Facilitate Cell Proliferation in Breast Cancer. Scientific Reports. 7 (1), (2017).
Huo, H., et al. Long non-coding RNA NORAD upregulate SIP1 expression to promote cell proliferation and invasion in cervical cancer. Biomedicine & Pharmacotherapy. 106, 1454-1460 (2018).
Prensner, J. R., et al. The Long Non-Coding RNA PCAT-1 Promotes Prostate Cancer Cell Proliferation through cMyc. Neoplasia. 16 (11), 900-908 (2014).
Li, H., et al. Long noncoding RNA NORAD, a novel competing endogenous RNA, enhances the hypoxia-induced epithelial-mesenchymal transition to promote metastasis in pancreatic cancer. Molecular Cancer. 16, (2017).
Li, Q., et al. High expression of long noncoding RNA NORAD indicates a poor prognosis and promotes clinical progression and metastasis in bladder cancer. Urologic Oncology: Seminars and Original Investigations. 36 (6), 310.e15-310.e22 (2018).
Katayama, H., et al. Long non-coding RNA HOTAIR promotes cell migration by upregulating insulin growth factor-binding protein 2 in renal cell carcinoma. Scientific Reports. 7 (1), (2017).
Ling, H., et al. CCAT2, a novel noncoding RNA mapping to 8q24, underlies metastatic progression and chromosomal instability in colon cancer. Genome Research. 23 (9), 1446-1461 (2013).
Lee, S., et al. Noncoding RNA NORAD Regulates Genomic Stability by Sequestering PUMILIO Proteins. Cell. 164 (1-2), 69-80 (2016).
Hanahan, D., Weinberg, R. A. Hallmarks of Cancer: The Next Generation. Cell. 144 (5), 646-674 (2011).
Iwamoto, N., et al. Control of phosphorothioate stereochemistry substantially increases the efficacy of antisense oligonucleotides. Nature Biotechnology. 35 (9), 845-851 (2017).
Naeem, M., Majeed, S., Hoque, M. Z., Ahmad, I. Latest Developed Strategies to Minimize the Off-Target Effects in CRISPR-Cas-Mediated Genome Editing. Cells. 9 (7), 1608 (2020).
Vicente, M. M., Chaves-Ferreira, M., Jorge, J. M. P., Proença, J. T., Barreto, V. M. The Off-Targets of Clustered Regularly Interspaced Short Palindromic Repeats Gene Editing. Frontiers in Cell and Developmental Biology. 9, (2021).
Zhang, X. H., Tee, L. Y., Wang, X. G., Huang, Q. S., Yang, S. H. Off-target Effects in CRISPR/Cas9-mediated Genome Engineering. Molecular Therapy - Nucleic Acids. 4, e264 (2015).
Shen, X., Corey, D. R. Chemistry, mechanism, and clinical status of antisense oligonucleotides and duplex RNAs. Nucleic Acids Research. 46 (4), 1584-1600 (2018).
Stein, C. A., Subasinghe, C., Shinozuka, K., Cohen, J. S. Physicochemical properties of phosphorothioate oligodeoxynucleotides. Nucleic Acids Research. 16 (8), 3209-3221 (1988).
Crooke, S. T., Vickers, T. A., Liang, X. Phosphorothioate modified oligonucleotide-protein interactions. Nucleic Acids Research. 48 (10), 5235-5253 (2020).
Manoharan, M. 2′-Carbohydrate modifications in antisense oligonucleotide therapy: importance of conformation, configuration and conjugation. Biochimica et Biophysica Acta (BBA) - Gene Structure and Expression. 1489 (1), 117-130 (1999).
Maurisse, R., et al. Comparative transfection of DNA into primary and transformed mammalian cells from different lineages. BMC Biotechnology. 10 (1), 9 (2010).
Bassett, A. R., et al. Considerations when investigating lncRNA function in vivo. eLife. 3, e03058 (2014).

Cancer Research