A subscription to JoVE is required to view this content. Sign in or start your free trial.

Method Article

Mapping R-Loops and RNA:DNA Hybrids with S9.6-Based Immunoprecipitation Methods

3.9K views

DOI:

10.3791/62455

August 24th, 2021

In This Article

Summary

R-loops constitute a prevalent class of transcription-driven non-B DNA structures that occur in all genomes depending on both DNA sequence and topological favorability. In recent years, R-loops have been implicated in a variety of adaptive and maladaptive roles and have been linked to genomic instability in the context of human disorders. As a consequence, the accurate mapping of these structures in genomes is of high interest to many investigators. DRIP-seq (DNA:RNA Immunoprecipitation followed by high throughput sequencing) is described here. It is a robust and reproducible technique that permits accurate and semi-quantitative mapping of R-loops. A recent iteration of the method is also described in which fragmentation is accomplished using sonication (sDRIP-seq), which allows strand-specific and high-resolution mapping of R-loops. sDRIP-seq thus addresses some of the common limitations of the DRIP-seq method in terms of resolution and strandedness, making it a method of choice for R-loop mapping.

Abstract

R-loops constitute a prevalent class of transcription-driven non-B DNA structures that occur in all genomes depending on both DNA sequence and topological favorability. In recent years, R-loops have been implicated in a variety of adaptive and maladaptive roles and have been linked to genomic instability in the context of human disorders. As a consequence, the accurate mapping of these structures in genomes is of high interest to many investigators. DRIP-seq (DNA:RNA Immunoprecipitation followed by high throughput sequencing) is described here. It is a robust and reproducible technique that permits accurate and semi-quantitative mapping of R-loops. A recent iteration of the method is also described in which fragmentation is accomplished using sonication (sDRIP-seq), which allows strand-specific and high-resolution mapping of R-loops. sDRIP-seq thus addresses some of the common limitations of the DRIP-seq method in terms of resolution and strandedness, making it a method of choice for R-loop mapping.

Introduction

R-loops are three-stranded nucleic acid structures that form primarily during transcription upon hybridization of the nascent RNA transcript to the template DNA strand. This results in the formation of an RNA:DNA hybrid and causes the displacement of the non-template DNA strand in a single-stranded looped state. Biochemical reconstitution1,2,3,4 and mathematical modeling5, in combination with other biophysical measurements6,7, have established that R-loops are....

Access restricted. Please log in or start a trial to view this content.

Protocol

The following protocol is optimized for the human Ntera-2 cell line grown in culture, but it has been successfully adapted without modification to a range of other human cell lines (HEK293, K562, HeLa, U2OS), primary cells (fibroblasts, B-cells) as well as in other organisms with small modifications (mice, flies).

1. Cell harvest and lysis

  1. Culture Ntera-2 cells to 75%-85% confluency. Ensure that the optimal cell count is 5 to 6 million cells with >90% viable counts to start any DRIP procedure.
  2. Wash the cells once with 1x PBS, add 1.5 mL of Trypsin-EDTA 1x, and then incubate for 2 min at 37 °C until the cells d....

Access restricted. Please log in or start a trial to view this content.

Results

DRIP as well as sDRIP can be analyzed through qPCR (Figure 2A) and/or sequencing (Figure 2B). After the immunoprecipitation step, the quality of the experiment must be first confirmed by qPCR on positive and negative control loci, as well as with RNase H-treated controls. Primers corresponding to frequently used loci in multiple human cell lines are provided in Table 2. The results from qPCR should be displayed as a percentage of input, which co.......

Access restricted. Please log in or start a trial to view this content.

Discussion

Described here are two protocols to map R-loop structures in potentially any organism using the S9.6 antibody. DRIP-seq represents the first genome-wide R-loop mapping technique developed. It is an easy, robust, and reproducible technique that allows one to map the distribution of R-loops along any genome. The second technique, termed sDRIP-seq, is also robust and reproducible but achieves higher resolution and strand-specificity owing to the inclusion of a sonication step and a stranded sequencing library construction p.......

Access restricted. Please log in or start a trial to view this content.

Disclosures

The authors declare no conflicts of interest.

Acknowledgements

Work in the Chedin lab is supported by a grant from the National Institutes of Health (R01 GM120607).

....

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
15 mL tube High density Maxtract phase lock gelQiagen129065
2 mL tube phase lock gel lightVWR10847-800
Agarose A/G beadsThermoFisher Scientific20421
Agencourt AMPure XP beadsBeckman CoulterA63881
AmpErase Uracil N-glycosylaseThermoFisher ScientificN8080096
Index adaptersIlluminaCorresponds to the TrueSeq Single indexes
Klenow fragment (3’ to 5’ exo-)New England BioLabsM0212S
NEBNext End repair moduleNew England BioLabsE6050
PCR primers for library amplificationprimer 1.0 P5 (5’ AATGATACGGCGACCACCGAGA
TCTACACTCTTTCCCTACACGA 3’)
PCR primers for library amplificationPCR primer 2.0 P7 (5’ CAAGCAGAAGACGGCATACG
AGAT 3’)
Phenol/Chloroform Isoamyl alcohol 25:24:1Affymetrix75831-400ML
Phusion Flash High-Fidelity PCR master mixThermoFisher ScientificF548S
Quick Ligation KitNew England BioLabsM2200S
Ribonuclease HNew England BioLabsM0297S
S9.6 AntibodyKerafastENH001These three sources are equivalent
S9.6 AntibodyMillipore/SigmaMABE1095
S9.6 AntibodyAbcamab234957

References

  1. Reaban, M. E., Lebowitz, J., Griffin, J. A. Transcription induces the formation of a stable RNA.DNA hybrid in the immunoglobulin alpha switch region. The Journal of Biological Chemistry. 269 (34), 21850-21857 (1994).
  2. Daniels, G. A., Lieber, M. R.

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Tags

DRIP SeqS9 6 ImmunoprecipitationGenomic InstabilityHigh Throughput SequencingsDRIP SeqStrand Specific MappingDNA StructureSonication Fragmentation
Video Coming Soon