Name: Retroviral Scanning: Mapping MLV Integration Sites to Define Cell-specific Regulatory Regions (Video) | JoVE Journal
Uploaded: 2017-05-28T14:00:00.000+00:00
Duration: 10 min 10 s
Description: Learn to map MLV retroviral integration sites in human cells using linker-mediated PCR and deep sequencing. This method identifies cell-specific regulatory regions to advance gene therapy strategies.

ai_agent_IP

ai_agent

maintenance

instantTrialDurationMinutes

isBiopharma

enableNewMyJoveSectionDesign

educationFeatures

seoMetaApi

ai_copilot_institution_blacklist

ai_chat_institution_blacklist

freeAccessWindow

ssoRoleCapture

scheduledMaintenanceBanner

joveLabsFeatures

disable_autoplay_for_bots

extended_trial_duration

5 minutes

This work was supported by grants from the European Research Council (ERC-2010-AdG, GT-SKIN), the Italian Ministry of Education, Universities and Research (FIRB-Futuro in Ricerca 2010-RBFR10OS4G, FIRB-Futuro in Ricerca 2012-RBFR126B8I_003, EPIGEN Epigenomics Flagship Project), the Italian Ministry of Health (Young researchers Call 2011 GR-2011-02352026) and the Imagine Institute Foundation (Paris, France).

1. MLV Transduction of Human Cells
<ol>
	<li>Isolate target cells and transduce them with an mLV-derived retroviral vector harboring the eGFP reporter gene and pseudotyped with Vesicular Stomatitis Virus G (VSV-G) or the amphotropic envelope glycoprotein16.
	<ol>
		<li>Keep mock-transduced cells as a negative control for the following analyses. Since mLV-based retroviral vectors can transduce efficiently dividing cells, culture the target cell population in conditions that stimulate cell division. Transduction conditions need to be specifically optimized for each cell type under study. Cell growth and transduction conditions for human hematopoietic progenitors, T cells and epidermal cells are described in References 7, 14, 15, and 17.</li>
	</ol>
	</li>
	<li>48 h after transduction, resuspend 100,000 cells in 300 μL of phosphate-buffered saline (PBS) containing 2% fetal bovine serum and measure eGFP expression by flow cytometric analysis (488-nm excitation laser). Use mock-transduced cells as negative control. For optimal integration site retrieval, purify GFP+ cells by Fluorescence Activated Cell Sorting (FACS).</li>
	<li>Collect 0.5 to 5 million cells for genomic DNA preparation. A longer culture period (&gt;7 days) is preferred to dilute the unintegrated provirus and necessary when analyzing the long-term progeny of bona fide stem cells (see Discussion Section and reference15). The cell pellets can be snap-frozen and stored at -80 °C until use.</li>
</ol>
2. Amplification of mLV integration sites by linker-mediated-PCR (LM-PCR)
<ol>
	<li>Preparation of genomic DNA (gDNA)
	<ol>
		<li>Extract gDNA using a column-based DNA extraction kit and follow the protocol for cultured cells, according to the manufacturer's instructions.</li>
	</ol>
	</li>
	<li>Restriction enzyme digestion
	<ol>
		<li>Set up 4 restriction enzyme digestions per sample in 1.5 mL tubes. Digest 0.1 to 1 μg gDNA in each tube by adding 1 µL of Tru9I (10U) and 1 µL of Buffer M in a final volume of 10 µL. Incubate the reactions at 65 °C for 6 h or overnight.</li>
		<li>Add to each reaction 1 µL of PstI (10U), 1 µL of Buffer H and 8 µL of water. Incubate the reactions at 37 °C for 6 h or overnight. Samples can be stored at -20 °C until use.</li>
	</ol>
	</li>
	<li>Linker ligation
	<ol>
		<li>Prepare a 100 μM Tru9I linker stock solution in a 1.5 mL tube by mixing the linker plus strand and linker minus strand oligonucleotides at a 100 μM concentration. Put the tube in a water set at 100 °C and let it cool down at room temperature. Tru9I linker stock solution can be stored at -20 °C until use.</li>
		<li>Set up 8 linker ligation reactions in 1.5 mL tubes. For each reaction, add the following components to 10 µL of restriction enzyme digestion: 1.4 µL of 10X T4 DNA Ligase Reaction buffer, 1 µL of 10 μM linker Tru9I, 1 µL (2,000U) of T4 DNA ligase and 0.6 µL of water. Incubate at 16 °C for 3 to 6 h. Samples can be stored at -20 °C until use.</li>
	</ol>
	</li>
	<li>First PCR
	<ol>
		<li>Set up 48 PCR reactions (6 reactions from each ligation tube) in 0.2 mL tubes. For each PCR, add the following reagents to 2 µL of ligation reaction: 5 µL of 10X PCR buffer, 2 µL of 50 mM Magnesium Sulfate, 1 µL of 10 mM deoxynucleotide (dNTP) Mix, 1 µL of 10 μM linker primer, 1 µL of 10 μM mLV-3' LTR primer, 0.3 µL (1.5U) of Taq DNA Polymerase and 37.7 µL of water. Primer sequences are provided in Table 1.</li>
		<li>Perform PCR reaction in a thermal cycler with heated lid, as follows: 95 °C for 2 min; 25 cycles of 95 °C for 15 s, 55 °C for 30 s, 72 °C for 1 min; 72 °C for 5 min; hold at 4 °C. Samples can be stored at -20 °C until use.</li>
	</ol>
	</li>
	<li>Second PCR
	<ol>
		<li>Set up 48 PCR reactions (1 from each "first PCR" tube) in 0.2 mL tubes. For each PCR, add the following components to 2 µL of the first PCR reaction: 5 µL of 10X PCR buffer, 2 µL of 50 mM Magnesium Sulfate, 1 µL of 10 mM dNTP Mix, 1 µL of 10 μM linker nested primer, 1 µL of 10 μM mLV-3' LTR nested primer, 0.3 µL of Taq DNA Polymerase (1.5 U) and 37.7 µL of water. Use nested primers designed for the specific massive sequencing strategy chosen: (i) linker nested primer and mLV-3' LTR nested primer compatible with Illumina platform; (ii) linker nested primer and mLV-3' LTR nested primer compatible with Roche platform. Primer sequences are listed in Table 1.</li>
		<li>Perform PCR reaction in a thermal cycler with heated lid, as follows: 95 °C for 2 min; 25 cycles of 95 °C for 15 s, 58 °C for 30 s, 72 °C for 1 min; 72 °C for 5 min; hold at 4 °C. Samples can be stored at -20 °C until use.</li>
		<li>Pool the 48 nested PCR reactions in a 15 mL tube (final volume of ~2.4 mL). Samples can be stored at -20 °C until use.</li>
	</ol>
	</li>
	<li>Determine the presence and the size of the LM-PCR products by agarose gel electrophoresis.
	<ol>
		<li>Add 4 µL of Loading Buffer to 20 µL of LM-PCR products and load the sample onto a 1% agarose gel, together with a 100 bp DNA ladder. Run the gel at 5 V/cm for 30 to 60 min and visualize the PCR products by ethidium bromide staining.</li>
		<li>Run an LM-PCR reaction from the mock-transduced sample as negative control.</li>
	</ol>
	</li>
	<li>Precipitate the amplicons by adding 0.1 volumes of sodium acetate solution (3 M; pH 5.2) and 2.5 volumes of 100% ethanol. Mix and freeze at -80 °C for 20 min.
	<ol>
		<li>Spin at full speed in a standard microcentrifuge at 4 °C for 20 min. Discard the supernatant and wash the pellet with 70% ethanol. Spin at full speed in a standard microcentrifuge at 4 °C for 5 min.</li>
		<li>Discard the supernatant and air dry the pellet. Add 200 µL of PCR-grade water and resuspend the DNA. Samples can be stored at -20 °C until use.</li>
	</ol>
	</li>
	<li>Add 20 μL of Loading Buffer to 100 µL of the LM-PCR products and load the sample onto a 1% agarose gel, together with a 100 bp DNA ladder.
	<ol>
		<li>Run the gel at 5 V/cm for 30 to 60 min and cut the portion of the gel containing 150 to 500 bp-long amplicons.</li>
		<li>Purify the LM-PCR products with a column-based gel extraction kit and measure the concentration using an UV spectrophotometer.</li>
	</ol>
	</li>
	<li>Use 1 µL of library to evaluate the length of the LM-PCR products using a bioanalyzer instrument, according to manufacturer's instructions.</li>
	<li>Shotgun cloning of amplicons
	<ol>
		<li>Use 20 ng of the purified LM-PCR products and clone them in the pCR2.1-TOPO vector, according to the manufacturer's instructions.</li>
		<li>Perform sequencing reactions using the M13 Universal primer, followed by genomic mapping of the resulting sequences, to reveal the presence of the viral-genome junctions (including the mLV-3' LTR nested primer) in &gt;50% of the clones to identify samples suitable for massive sequencing. Example of a viral-genome junction: 
		<img alt="DNA sequence analysis with color-coded genetic sequences, text representation." src="/files/ftp_upload/55919/55919junction.jpg" data-altupdatedat="1788250015000" data-alt="Junction"> 
		MLV-3' LTR nested primer 454 and linker nested primer 454 (Table 1) are indicated in bold and the 3' end of the viral LTR in italic. The human genomic sequence is highlighted in red text (chr10:6439408-6439509, hg19).</li>
	</ol>
	</li>
</ol>
3. Massive Sequencing of mLV Integration Sites
NOTE: LM-PCR products can be sequenced using commercial platforms (choosing the proper nested primer pair in the second PCR reaction, see subsection 2.5.1). For sequencing by Roche GS-FLX pyrosequencing platform, refer to previous papers7,14,15. In this section, a newly-optimized protocol for Illumina sequencing platform is described.
<ol>
	<li>Library preparation
	<ol>
		<li>Set up 1 indexing PCR reaction per sample in 0.2 mL tubes. For each PCR, add the following reagents to 5 µL (150-170 ng) of purified LM-PCR product: 5 µL of Index Primer 1, 5 µL of Index Primer 2, 25 µL of 2X Master Mix and 10 µL of PCR-grade water. Use a different index combination for each sample.</li>
		<li>Perform PCR reactions in a thermal cycler with heated lid, as follows: 95 °C for 3 min; 8 cycles of 95 °C for 30 s, 55 °C for 30 s, 72 °C for 30 s; 72 °C for 5 min; hold at 4 °C.</li>
		<li>Purify the PCR products using a solid-phase reversible immobilization (SPRI) bead isolation protocol: in new 1.5 mL tubes, add 56 µL of beads to each sample and proceed following manufacturer's instructions. Elute in 25 µL of Tris-HCl 10 mM. Libraries can be stored at -20 °C until use.</li>
	</ol>
	</li>
	<li>Library check
	<ol>
		<li>Use 1 µL of sample to assess library size using a bioanalyzer instrument.</li>
		<li>Use 1 µL of sample to quantify library molarity using a fluorescence-based Real time PCR assay, according to manufacturer's instructions.</li>
	</ol>
	</li>
	<li>Library dilution and sequencing
	<ol>
		<li>Dilute libraries to 10 nM using Tris-HCl 10 mM. For pooling libraries, transfer 5 µL of each diluted library to a new 1.5 mL tube and then dilute the pool to 4 nM in Tris-HCl 10 mM.</li>
		<li>Mix 5 µL of diluted pool with 5 µL of 0.2 N NaOH in a new 1.5 mL tube, vortex briefly, spin-down and incubate for 5 min at room temperature to denature the libraries.</li>
		<li>Put tubes on ice and add 990 µL of pre-chilled hybridization buffer (HT1). Aliquot 300 µL of denatured pool in a new 1.5 mL tube and add 300 µL of pre-chilled HT1 to obtain a 10 pM final library pool.</li>
		<li>In parallel, mix 2 µL of PhiX control library (10 nM) with 3 µL of Tris-HCl 10 mM in a 1.5 mL tube. Add 5 µL of NaOH 0.2 N, vortex briefly, spin-down and incubate for 5 min at room temperature to denature the diluted PhiX. Put tube on ice and add 990 µL of pre-chilled HT1.</li>
		<li>Aliquot 300 µL of denatured PhiX in a new 1.5 mL tube and add 300 µL of pre-chilled HT1 to obtain a 10 pM final PhiX.</li>
		<li>In a new 1.5 mL tube, mix 510 µL of denatured library pool with 90 µL of denatured PhiX library, thus obtaining a final 10 pM pool with 15% of PhiX control.</li>
		<li>Pipette these 600 µL of sample volume into the Load Sample reservoir of the thawed sequencing reagent cartridge and proceed immediately to perform a single-read 150-cycle run. 
		NOTE: The critical reagents and primer sequences required for this protocol are listed in Table 1.</li>
	</ol>
	</li>
</ol>

<ol><li>Ernst, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Mapping+and+analysis+of+chromatin+state+dynamics+in+nine+human+cell+types%5BTitle%5D)+AND+%22Nature%22%5BJournal%5D)">Mapping and analysis of chromatin state dynamics in nine human cell types.</a> Nature. 473 (7345), 43-49 (2011).</li>
<li>Shlyueva, D., Stampfel, G., Stark, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Transcriptional+enhancers%3A+from+properties+to+genome-wide+predictions%5BTitle%5D)+AND+%22Nat+Rev+Genet%22%5BJournal%5D)">Transcriptional enhancers: from properties to genome-wide predictions.</a> Nat Rev Genet. 15 (4), 272-286 (2014).</li>
<li>Roadmap Epigenomics Consortium. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Integrative+analysis+of+111+reference+human+epigenomes%5BTitle%5D)+AND+%22Nature%22%5BJournal%5D)">Integrative analysis of 111 reference human epigenomes.</a> Nature. 518 (7539), 317-330 (2015).</li>
<li>Heintzman, N. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Histone+modifications+at+human+enhancers+reflect+global+cell-type-specific+gene+expression%5BTitle%5D)+AND+%22Nature%22%5BJournal%5D)">Histone modifications at human enhancers reflect global cell-type-specific gene expression.</a> Nature. 459 (7243), 108-112 (2009).</li>
<li>Creyghton, M. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Histone+H3K27ac+separates+active+from+poised+enhancers+and+predicts+developmental+state%5BTitle%5D)+AND+%22Proc+Natl+Acad+Sci+U+S+A%22%5BJournal%5D)">Histone H3K27ac separates active from poised enhancers and predicts developmental state.</a> Proc Natl Acad Sci U S A. 107 (50), 21931-21936 (2010).</li>
<li>Hnisz, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Super-enhancers+in+the+control+of+cell+identity+and+disease%5BTitle%5D)+AND+%22Cell%22%5BJournal%5D)">Super-enhancers in the control of cell identity and disease.</a> Cell. 155 (4), 934-947 (2013).</li>
<li>Cattoglio, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((High-definition+mapping+of+retroviral+integration+sites+identifies+active+regulatory+elements+in+human+multipotent+hematopoietic+progenitors%5BTitle%5D)+AND+%22Blood%22%5BJournal%5D)">High-definition mapping of retroviral integration sites identifies active regulatory elements in human multipotent hematopoietic progenitors.</a> Blood. 116 (25), 5507-5517 (2010).</li>
<li>Biasco, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Integration+profile+of+retroviral+vector+in+gene+therapy+treated+patients+is+cell-specific+according+to+gene+expression+and+chromatin+conformation+of+target+cell%5BTitle%5D)+AND+%22EMBO+Mol+Med%22%5BJournal%5D)">Integration profile of retroviral vector in gene therapy treated patients is cell-specific according to gene expression and chromatin conformation of target cell.</a> EMBO Mol Med. 3 (2), 89-101 (2011).</li>
<li>De Ravin, S. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Enhancers+are+major+targets+for+murine+leukemia+virus+vector+integration%5BTitle%5D)+AND+%22J+Virol%22%5BJournal%5D)">Enhancers are major targets for murine leukemia virus vector integration.</a> J Virol. 88 (8), 4504-4513 (2014).</li>
<li>LaFave, M. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((mLV+integration+site+selection+is+driven+by+strong+enhancers+and+active+promoters%5BTitle%5D)+AND+%22Nucleic+Acids+Res%22%5BJournal%5D)">mLV integration site selection is driven by strong enhancers and active promoters.</a> Nucleic Acids Res. 42 (7), 4257-4269 (2014).</li>
<li>Gupta, S. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Bromo-+and+extraterminal+domain+chromatin+regulators+serve+as+cofactors+for+murine+leukemia+virus+integration%5BTitle%5D)+AND+%22J+Virol%22%5BJournal%5D)">Bromo- and extraterminal domain chromatin regulators serve as cofactors for murine leukemia virus integration.</a> J Virol. 87 (23), 12721-12736 (2013).</li>
<li>Sharma, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((BET+proteins+promote+efficient+murine+leukemia+virus+integration+at+transcription+start+sites%5BTitle%5D)+AND+%22Proc+Natl+Acad+Sci+U+S+A%22%5BJournal%5D)">BET proteins promote efficient murine leukemia virus integration at transcription start sites.</a> Proc Natl Acad Sci U S A. 110 (29), 12036-12041 (2013).</li>
<li>De Rijck, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+BET+family+of+proteins+targets+moloney+murine+leukemia+virus+integration+near+transcription+start+sites%5BTitle%5D)+AND+%22Cell+reports%22%5BJournal%5D)">The BET family of proteins targets moloney murine leukemia virus integration near transcription start sites.</a> Cell reports. 5 (4), 886-894 (2013).</li>
<li>Romano, O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Transcriptional%2C+epigenetic+and+retroviral+signatures+identify+regulatory+regions+involved+in+hematopoietic+lineage+commitment%5BTitle%5D)+AND+%22Sci+Rep%22%5BJournal%5D)">Transcriptional, epigenetic and retroviral signatures identify regulatory regions involved in hematopoietic lineage commitment.</a> Sci Rep. 6, 24724(2016).</li>
<li>Cavazza, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Dynamic+Transcriptional+and+Epigenetic+Regulation+of+Human+Epidermal+Keratinocyte+Differentiation%5BTitle%5D)+AND+%22Stem+Cell+Reports%22%5BJournal%5D)">Dynamic Transcriptional and Epigenetic Regulation of Human Epidermal Keratinocyte Differentiation.</a> Stem Cell Reports. 6 (4), 618-632 (2016).</li>
<li>Miller, A. D., Law, M. F., Verma, I. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Generation+of+helper-free+amphotropic+retroviruses+that+transduce+a+dominant-acting%2C+methotrexate-resistant+dihydrofolate+reductase+gene%5BTitle%5D)+AND+%22Mol+Cell+Biol%22%5BJournal%5D)">Generation of helper-free amphotropic retroviruses that transduce a dominant-acting, methotrexate-resistant dihydrofolate reductase gene.</a> Mol Cell Biol. 5 (3), 431-437 (1985).</li>
<li>Cattoglio, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((High-definition+mapping+of+retroviral+integration+sites+defines+the+fate+of+allogeneic+T+cells+after+donor+lymphocyte+infusion%5BTitle%5D)+AND+%22PLoS+One%22%5BJournal%5D)">High-definition mapping of retroviral integration sites defines the fate of allogeneic T cells after donor lymphocyte infusion.</a> PLoS One. 5 (12), e15688(2010).</li>
<li>Aiuti, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Lentiviral+hematopoietic+stem+cell+gene+therapy+in+patients+with+Wiskott-Aldrich+syndrome%5BTitle%5D)+AND+%22Science%22%5BJournal%5D)">Lentiviral hematopoietic stem cell gene therapy in patients with Wiskott-Aldrich syndrome.</a> Science. 341 (6148), 1233151(2013).</li>
<li>Biffi, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Lentiviral+hematopoietic+stem+cell+gene+therapy+benefits+metachromatic+leukodystrophy%5BTitle%5D)+AND+%22Science%22%5BJournal%5D)">Lentiviral hematopoietic stem cell gene therapy benefits metachromatic leukodystrophy.</a> Science. 341 (6148), 1233158(2013).</li>
<li>Gabriel, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Comprehensive+genomic+access+to+vector+integration+in+clinical+gene+therapy%5BTitle%5D)+AND+%22Nat+Med%22%5BJournal%5D)">Comprehensive genomic access to vector integration in clinical gene therapy.</a> Nat Med. 15 (12), 1431-1436 (2009).</li>
<li>Gillet, N. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+host+genomic+environment+of+the+provirus+determines+the+abundance+of+HTLV-1-infected+T-cell+clones%5BTitle%5D)+AND+%22Blood%22%5BJournal%5D)">The host genomic environment of the provirus determines the abundance of HTLV-1-infected T-cell clones.</a> Blood. 117 (11), 3113-3122 (2011).</li>
</ol>

The authors have nothing to disclose.

Here, we described a protocol for genome-wide mapping of the integration sites of mLV, a retrovirus that targets chromatin regions, epigenetically marked as active promoters and enhancers. Critical steps and/or limitations of the protocol include: (i) mLV transduction of the target cell population; (ii) amplification of virus-host junctions by LM-PCR; (iii) retrieval of a high fraction of integration sites. mLV-based retroviral vectors efficiently transduce dividing cells. The low efficiency of transduction of non-dividi...

Cell identity is determined by the expression of specific sets of genes. The role of cis-regulatory elements, such as promoters and enhancers, is crucial for the activation of cell-type specific transcriptional programs. These regulatory regions are characterized by specific chromatin features, such as peculiar histone modifications, transcription factors and co-factors binding, and chromatin accessibility, which have been widely used for their genome-wide identification in several cell types1,2,3. In particular, the genome-wide profile of acetylation of histone H3 lysine 27 (H3K27ac) is commonly used to define active promoters, enhancers and super-enhancers4,5,6.
Moloney murine leukemia virus (MLV) is a gamma-retrovirus that is widely used for gene transfer in mammalian cells. After infecting a target cell, the retroviral RNA genome is retro-transcribed in a double-stranded DNA molecule that binds viral and cellular proteins to assemble the pre-integration complex (PIC). The PIC enters the nucleus and binds the host cell chromatin. Here, the viral integrase, a key PIC component, mediates the integration of the proviral DNA into the host cell genome. mLV integration in the genomic DNA is not random, but occurs in active cis-regulatory elements, such as promoters and enhancers, in a cell-specific fashion7,8,9,10. This peculiar integration profile is mediated by a direct interaction between the mLV integrase and the cellular bromodomain and extraterminal domain (BET) proteins11,12,13. BET proteins (BRD2, BRD3, and BRD4) act as a bridge between host chromatin and mLV PIC: through their bromodomains they recognize highly acetylated cis-regulatory regions, while the extraterminal domain interacts with the mLV integrase11,12,13.
Here, we describe the retroviral scanning, a novel tool to map active cis-regulatory regions based on the integration properties of mLV. Briefly, cells are transduced with mLV-derived retroviral vector expressing the enhanced green fluorescent protein (eGFP) reporter gene. After genomic DNA extraction, the junctions between the 3&#39; long terminal repeat (LTR) of the mLV vector and the genomic DNA are amplified by linker-mediated PCR (LM-PCR) and massively sequenced. mLV integration sites are mapped to the human genome and genomic regions highly targeted by mLV are defined as clusters of mLV integration sites.
Retroviral scanning was used to define cell-specific active regulatory elements in several human primary cells14,15. mLV clusters co-mapped with epigenetically defined promoters and enhancers, most of which harbored active histone marks, such as H3K27ac, and were cell-specific. Retroviral scanning allows the genome-wide identification of DNA regulatory elements in prospectively purified cell populations7,14, as well as in retrospectively defined cell populations, such as keratinocyte stem cells, that lack effective markers for prospective isolation15.

<table><tbody><tr><td>PBS, pH 7.4</td><td>ThermoScientific</td><td>10010031</td><td>or equivalent</td></tr><tr><td>Fetal Bovine Serum</td><td>ThermoScientific</td><td>16000044</td><td>or equivalent</td></tr><tr><td>0.2 ml tubes</td><td>general lab supplier</td><td></td><td></td></tr><tr><td>1.5 ml tubes</td><td>general lab supplier</td><td></td><td></td></tr><tr><td>QIAGEN QIAmp DNA mini Kit&amp;nbsp;</td><td>QIAGEN</td><td>51306</td><td>or equivalent</td></tr><tr><td>T4 DNA ligase&amp;nbsp;</td><td>New England BioLabs</td><td>M0202T</td><td></td></tr><tr><td>T4 DNA Ligase Reaction buffer</td><td>New England BioLabs</td><td>M0202T</td><td></td></tr><tr><td>Linker Plus Strand oligonucleotide</td><td>general lab supplier</td><td></td><td>5&amp;rsquo;-PO&lt;sub&gt;4&lt;/sub&gt;-TAGTCCCTTAAGCGGAG-3&amp;rsquo;&amp;nbsp; (Purification grade: SDS-PAGE)</td></tr><tr><td>Linker Minus Strand oligonucleotide</td><td>general lab supplier</td><td></td><td>5&amp;rsquo;-GTAATACGACTCACTATAGGGCTCCGCTTAAGGGAC-3&amp;rsquo; (Purification grade: SDS-PAGE)</td></tr><tr><td>Tru9I</td><td>Roche-Sigma-Aldrich</td><td>11464825001</td><td></td></tr><tr><td>SuRE/Cut Buffer M</td><td>Roche-Sigma-Aldrich</td><td>11417983001</td><td></td></tr><tr><td>PstI&amp;nbsp;</td><td>Roche-Sigma-Aldrich</td><td>10798991001</td><td></td></tr><tr><td>SuRE/Cut Buffer H</td><td>Roche-Sigma-Aldrich</td><td>11417991001</td><td></td></tr><tr><td>Platinum Taq DNA Polimerase High Fidelity&amp;nbsp;</td><td>Invitrogen</td><td>11304011</td><td></td></tr><tr><td>10 mM dNTP Mix</td><td>Invitrogen</td><td>18427013</td><td>or equivalent</td></tr><tr><td>PCR grade water</td><td>general lab supplier</td><td></td><td></td></tr><tr><td>96-well thermal cycler (with heated lid)</td><td>general lab supplier</td><td></td><td></td></tr><tr><td>linker primer</td><td>general lab supplier</td><td></td><td>5&amp;rsquo;-GTAATACGACTCACTATAGGGC-3&amp;rsquo; (Purification grade: PCR grade)</td></tr><tr><td>MLV-3&amp;rsquo; LTR primer</td><td>general lab supplier</td><td></td><td>5&amp;rsquo;-GACTTGTGGTCTCGCTGTTCCTTGG-3&amp;rsquo; (Purification grade: PCR grade)</td></tr><tr><td>linker nested primer 454</td><td>general lab supplier</td><td></td><td>5&amp;rsquo;-GCCTTGCCAGCCCGCTCAG[AGGGCTCCGCTTAAGGGAC](Purification grade: SDS-PAGE)</td></tr><tr><td>MLV-3&amp;rsquo; LTR nested primer 454</td><td>general lab supplier</td><td></td><td>5&amp;rsquo;-GCCTCCCTCGCGCCATCAGTAGC[GGTCTCCTCTGAGTGATTGACTACC](Purification grade: SDS-PAGE)</td></tr><tr><td>linker nested primer Illumina</td><td>general lab supplier</td><td></td><td>5&#039;-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-[AGGGCTCCGCTTAAGGGAC](Purification grade: SDS-PAGE)</td></tr><tr><td>MLV-3&amp;rsquo; LTR nested primer Illumina</td><td>general lab supplier</td><td></td><td>5&#039;-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-[GGTCTCCTCTGAGTGATTGACTACC](Purification grade: SDS-PAGE)</td></tr><tr><td>Sodium Acetate Solution (3M) pH 5.2</td><td>general lab supplier</td><td></td><td></td></tr><tr><td>Ethanol (absolute) for molecular biology</td><td>Sigma-Aldrich</td><td>E7023</td><td>or equivalent</td></tr><tr><td>Topo TA Cloning kit (with pCR2.1-TOPO vector)</td><td>Invitrogen</td><td>K4500-01</td><td></td></tr><tr><td>QIAquick Gel Extraction kit</td><td>QIAGEN</td><td>28704</td><td></td></tr><tr><td>Agarose</td><td>Sigma-Aldrich</td><td>A9539</td><td>or equivalent</td></tr><tr><td>Ethidium bromide&amp;nbsp;</td><td>Sigma-Aldrich</td><td>E1510</td><td>or equivalent</td></tr><tr><td>100 bp DNA ladder</td><td>Invitrogen</td><td>15628019</td><td>or equivalent</td></tr><tr><td>6x Loading Buffer</td><td>ThermoScientific</td><td>R0611</td><td>or equivalent</td></tr><tr><td>NanoDrop 2000 UV-Vis Spectrophotometer</td><td>ThermoScientific</td><td>ND-2000</td><td></td></tr><tr><td>Nextera XT Index kit</td><td>Illumina</td><td>FC-131-1001 or FC-131-1002</td><td></td></tr><tr><td>2x KAPA HiFi Hot Start Ready Mix&amp;nbsp;</td><td>KAPA Biosystems</td><td>KK2601</td><td></td></tr><tr><td>Dynal magnetic stand for 2 ml tubes</td><td>Invitrogen</td><td>12321D</td><td>or equivalent</td></tr><tr><td>Agencourt AMPure XP 60 ml kit</td><td>Beckman Coulter Genomics</td><td>A63881</td><td></td></tr><tr><td>Tris-HCl 10 mM, pH 8.5</td><td>general lab supplier</td><td></td><td></td></tr><tr><td>Agilent 2200 TapeStation system</td><td>Agilent Technologies</td><td>G2964AA</td><td>or equivalent</td></tr><tr><td>D1000 ScreenTape</td><td>Agilent Technologies</td><td>5067-5582</td><td>or equivalent</td></tr><tr><td>D1000 Reagents</td><td>Agilent Technologies</td><td>5067-5583</td><td>or equivalent</td></tr><tr><td>KAPA Library Quantification Kit for Illumina platforms (ABI Prism)</td><td>KAPA Biosystems</td><td>KK4835</td><td></td></tr><tr><td>ABI Prism 7900HT Fast Real-Time PCR System</td><td>Applied Biosystems</td><td>4329003</td><td></td></tr><tr><td>NaOH 1.0 N, molecular biology-grade</td><td>general lab supplier</td><td></td><td></td></tr><tr><td>HT1 (Hybridization Buffer)</td><td>Illumina&amp;nbsp;</td><td>Provided in the MiSeq Reagent Kit</td><td></td></tr><tr><td>MiSeq Reagent Kit v3 (150 cycles)</td><td>Illumina</td><td>MS-102-3001</td><td></td></tr><tr><td>MiSeq System</td><td>Illumina</td><td>SY-410-1003</td><td></td></tr><tr><td>PhiX Control v3</td><td>Illumina</td><td>FC-110-3001</td><td></td></tr></tbody></table>

retroviral scanning: mapping mlv integration sites to define cell-specific regulatory regions

Retroviral Scanning: Mapping MLV Integration Sites to Define Cell-specific Regulatory Regions

Moloney murine leukemia (MLV) virus-based retroviral vectors integrate predominantly in acetylated enhancers and promoters. For this reason, mLV integration sites can be used as functional markers of active regulatory elements. Here, we present a retroviral scanning tool, which allows the genome-wide identification of cell-specific enhancers and promoters. Briefly, the target cell population is transduced with an mLV-derived vector and genomic DNA is digested with a frequently cutting restriction enzyme. After ligation of genomic fragments with a compatible DNA linker, linker-mediated polymerase chain reaction (LM-PCR) allows the amplification of the virus-host genome junctions. Massive sequencing of the amplicons is used to define the mLV integration profile genome-wide. Finally, clusters of recurrent integrations are defined to identify cell-specific regulatory regions, responsible for the activation of cell-type specific transcriptional programs.
The retroviral scanning tool allows the genome-wide identification of cell-specific promoters and enhancers in prospectively isolated target cell populations. Notably, retroviral scanning represents an instrumental technique for the retrospective identification of rare populations (e.g. somatic stem cells) that lack robust markers for prospective isolation.

Workflow of the retroviral scanning procedure
The workflow of retroviral scanning procedure is schematized in Figure 1. The target cell population is purified and transduced with a mLV-derived retroviral vector expressing an eGFP reporter gene. The transgene is flanked by the two identical long terminal repeats (5' and 3' LTR), ensuring synthesis, reverse transcription and integration of the viral geno...

Here, we describe a protocol for genome-wide mapping of the integration sites of Moloney murine leukemia virus-based retroviral vectors in human cells.

Moloney murine leukemia (MLV) virus-based retroviral vectors integrate predominantly in acetylated enhancers and promoters. For this reason, mLV ...

The overall goal of this procedure is to map integration sites of murine leukemia virus derived retroviral vectors to define cell specific regulatory regions. This method can help answer key question in gene therapy and gene regulation studies such as where the vector integrates in the human genome and which regulatory element can actively use via particular sub type. We first had the idea for this method observing that in gene therapy studies, MLV vectors integrate into active sub specific promoters and enhancers.Begin by transducing the target cells with an MLV-derived retroviral vector harboring the EGFP reporter gene and pseudotyped with VSV-G or the amphrotopic envelope glycoprotein. Mock transduced cells are used as a negative control. 48 hours after transduction, centrifuge the samples and then resuspend 100, 000 cells in 300 microliters of PBS containing two percent fetal bovine serum.Then, measurement the EGFP expression by flow site metric analysis. Harvest another 0.5 to five million transduced cells for genomic DNA preparation and subsequent restriction enzyme digestion. Set up four restriction enzyme digestions per sample in 1.5 milliliter tubes.Digest 0.1 to one microgram G-DNA in each tube. By adding 10 units of TRU91 and one microliter of buffer M per sample in a final volume of 10 microliters. Dispense two microliters of the mix into digestion tubes.And then incubate the reactions at 65 degrees celsius for six hours or overnight. Following the incubation, add 40 microliters of water to a 1.5 milliliter tube. In the same tube, add 10 units of PST1 and one microliters of buffer H per sample.Dispense 10 microliters of the digestion reaction mix in the digestion tubes. Incubate the reactions at 37 degrees celsius for six hours or overnight. The next day, set up eight linker ligation reactions in 1.5 milliliter tubes.For each reaction, add the ligase reaction mixture to 10 microliters of the digestion genomic DNA. Incubate at 16 degrees celsius for three to six hours. For first-round PCR, set up 48 PCR reactions in 0.2 milliliter tubes.For each PCR, add the reaction mixture containing the linker primer and MLV3 prime LTR primer to two microliters of the ligation reaction. Place the samples in a thermal cycler with heater lid. Set the cycling parameters and run the first round PCR reaction.For the second round PCR, set up the reaction mixture including linker nested primer and MLV3 prime LTR nested primer. Then, add two microliters of the PCR product from the first-round PCR as template. Then, run the second round PCR reaction to generate the final LN PCR products.After the second round PCR, pull the 48 nested LM PCR reactions in a 15 milliliter tube. Then add 20 microliters of loading buffer to 100 microliters of the pooled and precipitated LM PCR product. And load the sample onto a one percent agarose gel together with the 100 base pair DNA ladder.Run the gel at five volt per centimeter for 30 to 60 minutes once the bands are resolved, cut the proportion of the gel containing 500 to 150 base pair long amplicons. After purifying the LM PCR product with a column based gel extraction kit, measure the concentration using a UV spectrophotometer before proceeding to library preparation. Also, evaluate the length of the LM PCR products using a bioanalyzer instrument as per the manufacturer's instructions.Prepare the library by setting up an indexing PCR. For each PCR, use 150 to 170 nanograms of purified LM PCR product, in different index combination for each sample. Perform the PCR in a thermal cycler with heated lid as indicated.Following the PCR, dilute the purified library to 10 nanomolar with 10 millimolar tris HCL. Next, mix five microliters of diluted pool with five microliters of 0.2 newtons sodium hydroxide in a new 1.5 milliliter tube. Vortex briefly, spin down and then incubate for five minutes at room temperature to denature the libraries.Place the tubes of denatured pool on ice and 990 microliters of pre-chilled HT1 hybridization buffer. Then aliquot 300 microliters of denatured pool into a new 1.5 milliliter tube. And add 300 microliters of pre-chilled HT1 to obtain a ten picomolar final library pool.In parallel, mix 10 nanomolar of fixed control library in a two microliter volume with 3 microliters of 10 millimolar tris HCl in a 1.5 milliliter tube. Add five microliters of 0.2 newtons sodium hydroxide and vortex briefly. After spinning down, incubate for five minutes at room temperature to denature the diluted fix.After the incubation, place the tube on ice and add 990 microliters of pre-chilled HT1. Now, aliquot 100 microliters of denatured fix in a new 1.5 milliliter tube and add 300 microliters of pre-chilled HT1 to obtain a 10 picomolar final concentration of fix. Finally, in a new 1.5 milliliter tube, mix 510 microliters of denatured library pool with 90 microliters of denatured fixed library, thus obtaining a final 10 picomolar pool with 15%of fix control to be sequenced.This image shows the analysis of 3498, 2989, and 4103 clusters of recurrent MLV integration sites in hematopoietic stem progenitor cells, erythroid progenitors and myeloid progenitors respectively. In each cell population, greater than 95%of MLV clusters overlapped with epigenetically defined enhancers and promoters. Cell specific MLV targeted regions were highly acetylated and associated with cell specific expression of the targeted gene.Examples are the promoter of HSP specific SPINK2 gene. The locus control region containing potent enhancers of the erythroid specific beta-like globin genes. Enhancers located upstream of the NPP specific LYZ gene.Luciferase reporter assays validated the subset of cell specific MLV targeted enhancers in EPP and MPP. Erythroid specific MLV targeted regions had higher activity in EPP than in MPP and vice versa, confirming that MLV identifies cell specific enhancers possibly controlling the expression of nearby genes. Once mastered, this technique can be done in on week if it's performed properly.While attempting this procedure, it's important to remember to maximize the frequency of transduced cells for optimal integration site retrieval. After watching this video, you should have a good understanding of how to map viral integration sites by first adjusting the genomic DNA then ligating the genomic fragments with a DNA linker followed by amplifying the host genome viral junction via LM PCR and lastly deep sequencing the amplicon library.

retroviral-scanning-mapping-mlv-integration-sites-to-define-cell

Research

JoVE Journal

Genetics

Human endogenous retroviruses (HERV), which occupy 8% of the human genome, retain scarce coding capacities but a hundred thousand long terminal repeats (LTRs). A custom Affymetrix microarray was designed to identify individual HERV locus expression and was used on prostate cancer tissues as a proof of concept for future clinical studies.

Microarray-based Identification of Individual HERV Loci Expression: Application to Biomarker Discovery in Prostate Cancer

Linear-amplification mediated (LAM)-PCR is a method developed to identify the exact positions of integrating viral vectors in the genome. The technique has evolved to be the superior method to study clonal dynamics in gene therapy patients, biosafety of novel vector technologies, T-cell diversity, cancer stem cell models, etc.

Linear Amplification Mediated PCR &#8211; Localization of Genetic Elements and Characterization of Unknown Flanking DNA

We describe a protocol for amplifying retroviral integration sites from the genomic DNA of infected cells, sequencing the amplified virus-host junctions, and then mapping these sequences to a reference genome. We also describe techniques to quantify the distribution of integration sites relative to various genomic annotations using BEDTools.

Amplification, Next-generation Sequencing, and Genomic DNA Mapping of Retroviral Integration Sites

This manuscript describes the experimental procedure and software analysis for a bidirectional integration site assay that can simultaneously analyze upstream and downstream vector-host junction DNA. Bidirectional PCR products can be used for any downstream sequencing platform. The resulting data are useful for a high-throughput, quantitative comparison of integrated DNA targets.

Bidirectional Retroviral Integration Site PCR Methodology and Quantitative Data Analysis Workflow

Full-length individual proviral sequencing (FLIPS) provides an efficient and high-throughput method for the amplification and sequencing of single, near full-length (intact and defective) HIV-1 proviruses and allows for determination of their potential replication-competency. FLIPS overcomes limitations of previous assays designed to sequence the latent HIV-1 reservoir.

Amplification of Near Full-length HIV-1 Proviruses for Next-Generation Sequencing

Here, we present the protocols to identify 1) virus-encoded immunomodulators that promote arbovirus replication and 2) eukaryotic host factors that restrict arbovirus replication. These fluorescence- and luminescence-based methods allow researchers to rapidly obtain quantitative readouts of arbovirus replication in simplistic assays with low signal-to-noise ratios.

Arbovirus Infections As Screening Tools for the Identification of Viral Immunomodulators and Host Antiviral Factors

We present a genome engineering workflow for the generation of new in vitro models for HIV-1 infection that recapitulate proviral integration at selected genomic sites. Targeting of HIV-derived reporters is facilitated by CRISPR-Cas9-mediated, site-specific genome manipulation. Detailed protocols for single-cell clone generation, screening, and correct targeting verification are provided.

CRISPR-Cas9-based Genome Engineering to Generate Jurkat Reporter Models for HIV-1 Infection with Selected Proviral Integration Sites

A high throughput protocol for functional assessment of HIV efficient reactivation and clearance of latent proviruses is described and applied by testing the impact of interventions on HIV transcription and splicing. Representative results of the effect of latency reversing agents on LTR-driven transcription and splicing are provided.

High Throughput In Vitro Assessment of Latency Reversing Agents on HIV Transcription and Splicing

Targeted DNA epigenome editing represents a powerful therapeutic approach. This protocol describes the production, purification, and concentration of all-in-one lentiviral vectors harboring the CRISPR-dCas9-DNMT3A transgene for epigenome-editing applications in human induced pluripotent stem cell (hiPSC)-derived neurons.

Lentiviral Vector Platform for the Efficient Delivery of Epigenome-editing Tools into Human Induced Pluripotent Stem Cell-derived Disease Models

Insertional mutagenesis is an essential tool in forward genetics for identifying functional genomic elements. Here, we describe the Insertion-based Screen for functional Elements and Transcripts (InSET), a method for detecting lentivirus integration sites within a lentivirus-based insertional mutagenesis cell library.

Identification of Functionally-Relevant Lentivirus Integration Sites in an Insertional Mutagenesis Cell Library

Learn to map MLV retroviral integration sites in human cells using linker-mediated PCR and deep sequencing. This method identifies cell-specific regulatory regions to advance gene therapy strategies.

Retroviral Scanning: Mapping MLV Integration Sites to Define Cell-specific Regulatory Regions

Explore More Videos