Name: Elektroporationsbasierter CRISPR-Cas9-vermittelter Gen-Knockout in THP-1-Zellen und Einzelzell-Klonisolierung (Video) | JoVE Journal
Uploaded: 2025-02-28T12:30:00.000+00:00
Duration: 9 min 29 s
Description: Lernen Sie die CRISPR-Cas9-basierte Gen-Knockout-Methode in THP-1-Zellen zur Untersuchung von HIV-Resistenzmechanismen in Makrophagen. Dieses Protokoll ermöglicht präzise genetische Modifikationen für AIDS-Forschung.

ai_agent_IP

ai_agent

maintenance

instantTrialDurationMinutes

isBiopharma

enableNewMyJoveSectionDesign

educationFeatures

seoMetaApi

ai_copilot_institution_blacklist

ai_chat_institution_blacklist

freeAccessWindow

ssoRoleCapture

scheduledMaintenanceBanner

joveLabsFeatures

disable_autoplay_for_bots

extended_trial_duration

5 minutes

<ol><li>Tsuchiya, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Establishment+and+characterization+of+a+human+acute+monocytic+leukemia+cell+line+%28THP-1%29%5BTitle%5D)+AND+%22Int+J+Cancer%22%5BJournal%5D)">Establishment and characterization of a human acute monocytic leukemia cell line (THP-1).</a> Int J Cancer. 26 (2), 171-176 (1980).</li>
<li>Danis, V. A., Millington, M., Hyland, V. J., Grennan, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Cytokine+production+by+normal+human+monocytes%3A+inter-subject+variation+and+relationship+to+an+IL-1+receptor+antagonist+%28IL-lRa%29+gene+polymorphism%5BTitle%5D)+AND+%22Clin+Exp+Immunol%22%5BJournal%5D)">Cytokine production by normal human monocytes: inter-subject variation and relationship to an IL-1 receptor antagonist (IL-lRa) gene polymorphism.</a> Clin Exp Immunol. 99, https://academic.oup.com/cei/article/99/2/303/6484286 (1995).</li>
<li>Bol, S. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Donor+variation+in+in+vitro+HIV-1+susceptibility+of+monocyte-derived+macrophages%5BTitle%5D)+AND+%22Virology%22%5BJournal%5D)">Donor variation in in vitro HIV-1 susceptibility of monocyte-derived macrophages.</a> Virology. 390 (2), 205-211 (2009).</li>
<li>Appleby, L. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Sources+of+heterogeneity+in+human+monocyte+subsets%5BTitle%5D)+AND+%22Immunol+Lett%22%5BJournal%5D)">Sources of heterogeneity in human monocyte subsets.</a> Immunol Lett. 152 (1), 32-41 (2013).</li>
<li>O'Neill, M. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Single-cell+and+bulk+RNA-sequencing+reveal+differences+in+monocyte+susceptibility+to+Influenza+A+virus+infection+between+Africans+and+Europeans%5BTitle%5D)+AND+%22Front+Immunol%22%5BJournal%5D)">Single-cell and bulk RNA-sequencing reveal differences in monocyte susceptibility to Influenza A virus infection between Africans and Europeans.</a> Front Immunol. 12, 768189(2021).</li>
<li>Wen, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Comparability+study+of+monocyte-derived+dendritic+cells%2C+primary+monocytes%2C+and+THP1+cells+for+innate+immune+responses%5BTitle%5D)+AND+%22J+Immunol+Methods%22%5BJournal%5D)">Comparability study of monocyte-derived dendritic cells, primary monocytes, and THP1 cells for innate immune responses.</a> J Immunol Methods. 498, 113147(2021).</li>
<li>Inagaki, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Interferon-g-induced+apoptosis+and+activation+of+THP-1+macrophages%5BTitle%5D)+AND+%22Life+Sci%22%5BJournal%5D)">Interferon-g-induced apoptosis and activation of THP-1 macrophages.</a> Life Sci. 71 (21), 2499-2508 (2002).</li>
<li>Boonkaewwan, C., Toskulkao, C., Vongsakul, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Anti-inflammatory+and+immunomodulatory+activities+of+stevioside+and+its+metabolite+steviol+on+THP-1+cells%5BTitle%5D)+AND+%22J+Agric+Food+Chem%22%5BJournal%5D)">Anti-inflammatory and immunomodulatory activities of stevioside and its metabolite steviol on THP-1 cells.</a> J Agric Food Chem. 54 (3), 785-789 (2006).</li>
<li>Chanput, W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((%CE%B2-Glucans+are+involved+in+immune-modulation+of+THP-1+macrophages%5BTitle%5D)+AND+%22Mol+Nutr+Food+Res%22%5BJournal%5D)">β-Glucans are involved in immune-modulation of THP-1 macrophages.</a> Mol Nutr Food Res. 56 (5), 822-833 (2012).</li>
<li>Cui, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((USP3+inhibits+type+I+interferon+signaling+by+deubiquitinating+RIG-I-like+receptors%5BTitle%5D)+AND+%22Cell+Res%22%5BJournal%5D)">USP3 inhibits type I interferon signaling by deubiquitinating RIG-I-like receptors.</a> Cell Res. 24 (4), 400-416 (2014).</li>
<li>Chen, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((SAMHD1+suppresses+innate+immune+responses+to+viral+infections+and+inflammatory+stimuli+by+inhibiting+the+NF-%CE%BAB+and+interferon+pathways%5BTitle%5D)+AND+%22Proc+Natl+Acad+Sci+USA%22%5BJournal%5D)">SAMHD1 suppresses innate immune responses to viral infections and inflammatory stimuli by inhibiting the NF-κB and interferon pathways.</a> Proc Natl Acad Sci USA. 115 (16), E3798-E3807 (2018).</li>
<li>Pradhananga, S., Spalinskas, R., Poujade, F. A., Eriksson, P., Sahlén, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Promoter+anchored+interaction+landscape+of+THP-1+macrophages+captures+early+immune+response+processes%5BTitle%5D)+AND+%22Cell+Immunol%22%5BJournal%5D)">Promoter anchored interaction landscape of THP-1 macrophages captures early immune response processes.</a> Cell Immunol. 355, 104148(2020).</li>
<li>Mezzasoma, L., Talesa, V. N., Romani, R., Bellezza, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Anp+and+BNP+exert+anti-inflammatory+action+via+npr-1%2Fcgmp+axis+by+interfering+with+canonical%2C+non-canonical%2C+and+alternative+routes+of+inflammasome+activation+in+human+THP1+cells%5BTitle%5D)+AND+%22Int+J+Mol+Sci%22%5BJournal%5D)">Anp and BNP exert anti-inflammatory action via npr-1/cgmp axis by interfering with canonical, non-canonical, and alternative routes of inflammasome activation in human THP1 cells.</a> Int J Mol Sci. 22 (1), 1-17 (2021).</li>
<li>Martinat, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((SUMOylation+of+SAMHD1+at+Lysine+595+is+required+for+HIV-1+restriction+in+non-cycling+cells%5BTitle%5D)+AND+%22Nat+Commun%22%5BJournal%5D)">SUMOylation of SAMHD1 at Lysine 595 is required for HIV-1 restriction in non-cycling cells.</a> Nat Commun. 12 (1), 4582(2021).</li>
<li>Rensen, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Clustering+and+reverse+transcription+of+HIV-1+genomes+in+nuclear+niches+of+macrophages%5BTitle%5D)+AND+%22EMBO+J%22%5BJournal%5D)">Clustering and reverse transcription of HIV-1 genomes in nuclear niches of macrophages.</a> EMBO J. 40 (1), e105247(2021).</li>
<li>Ikeda, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((APOBEC3+degradation+is+the+primary+function+of+HIV-1+Vif+determining+virion+infectivity+in+the+myeloid+cell+line+THP-1%5BTitle%5D)+AND+%22mBio%22%5BJournal%5D)">APOBEC3 degradation is the primary function of HIV-1 Vif determining virion infectivity in the myeloid cell line THP-1.</a> mBio. 14 (4), e0078223(2023).</li>
<li>Jinek, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+programmable+dual+RNA-guided+DNA+endonuclease+in+adaptive+bacterial+immunity%5BTitle%5D)+AND+%22Science%22%5BJournal%5D)">A programmable dual RNA-guided DNA endonuclease in adaptive bacterial immunity.</a> Science. 337, 816-821 (2012).</li>
<li>Kurosaki, T., Maquat, L. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Nonsense-mediated+mRNA+decay+in+humans+at+a+glance%5BTitle%5D)+AND+%22J+Cell+Sci%22%5BJournal%5D)">Nonsense-mediated mRNA decay in humans at a glance.</a> J Cell Sci. 129 (3), 461-467 (2016).</li>
<li>Tuladhar, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((CRISPR-Cas9-based+mutagenesis+frequently+provokes+on-target+mRNA+misregulation%5BTitle%5D)+AND+%22Nat+Commun%22%5BJournal%5D)">CRISPR-Cas9-based mutagenesis frequently provokes on-target mRNA misregulation.</a> Nat Commun. 10 (1), 4056(2019).</li>
<li>Embree, C. M., Abu-Alhasan, R., Singh, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Features+and+factors+that+dictate+if+terminating+ribosomes+cause+or+counteract+nonsense-mediated+mRNA+decay%5BTitle%5D)+AND+%22J+Biol+Chem%22%5BJournal%5D)">Features and factors that dictate if terminating ribosomes cause or counteract nonsense-mediated mRNA decay.</a> J Biol Chem. 298 (11), 102592(2022).</li>
<li>Xue, C., Greene, E. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((DNA+repair+pathway+choices+in+CRISPR-Cas9-mediated+genome+editing%5BTitle%5D)+AND+%22Trends+Genet%22%5BJournal%5D)">DNA repair pathway choices in CRISPR-Cas9-mediated genome editing.</a> Trends Genet. 37 (7), 639-656 (2021).</li>
<li>Schnoor, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Efficient+non-viral+transfection+of+THP-1+cells%5BTitle%5D)+AND+%22J+Immunol+Methods%22%5BJournal%5D)">Efficient non-viral transfection of THP-1 cells.</a> J Immunol Methods. 344 (2), 109-115 (2009).</li>
<li>Tang, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+method+for+high+transfection+efficiency+in+THP-1+suspension+cells+without+PMA+treatment%5BTitle%5D)+AND+%22Anal+Biochem%22%5BJournal%5D)">A method for high transfection efficiency in THP-1 suspension cells without PMA treatment.</a> Anal Biochem. 544, 93-97 (2018).</li>
<li>Ji, W., Zhang, L., Liu, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Protocol+using+lentivirus+to+establish+THP-1+suspension+cell+lines+for+immunostaining+and+confocal+microscopy%5BTitle%5D)+AND+%22STAR+Protoc%22%5BJournal%5D)">Protocol using lentivirus to establish THP-1 suspension cell lines for immunostaining and confocal microscopy.</a> STAR Protoc. 4 (1), 102032(2023).</li>
<li>Guo, C., Ma, X., Gao, F., Guo, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Off-target+effects+in+CRISPR%2FCas9+gene+editing%5BTitle%5D)+AND+%22Front+Bioeng+Biotechnol%22%5BJournal%5D)">Off-target effects in CRISPR/Cas9 gene editing.</a> Front Bioeng Biotechnol. 11, (2023).</li>
<li>Synthego Performance Analysis, ICE Analysis. 3.0, Synthego. 
 <a target="_blank" href="https://www.synthego.com/help/citing-ice">https://www.synthego.com/help/citing-ice</a> (2019).</li>
<li>Salamov, A. A., Nishikawa, T., Swindells, M. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Assessing+protein+coding+region+integrity+in+cDNA+sequencing+projects%5BTitle%5D)+AND+%22Bioinformatics%22%5BJournal%5D)">Assessing protein coding region integrity in cDNA sequencing projects.</a> Bioinformatics. 14, 384-390 (1998).</li>
<li>Pedersen, A. G., Nielsen, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Neural+network+prediction+of+translation+initiation+sites+in+eukaryotes%3A+Perspectives+for+EST+and+genome+analysis%5BTitle%5D)+AND+%22Proc+Int+Conf+Intell+Syst+Mol+Biol%22%5BJournal%5D)">Neural network prediction of translation initiation sites in eukaryotes: Perspectives for EST and genome analysis.</a> Proc Int Conf Intell Syst Mol Biol. 5, 226-233 (1997).</li>
<li>Concordet, J. P., Haeussler, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((CRISPOR%3A+Intuitive+guide+selection+for+CRISPR%2FCas9+genome+editing+experiments+and+screens%5BTitle%5D)+AND+%22Nucleic+Acids+Res%22%5BJournal%5D)">CRISPOR: Intuitive guide selection for CRISPR/Cas9 genome editing experiments and screens.</a> Nucleic Acids Res. 46 (W1), W242-W245 (2018).</li>
<li>Laguette, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((SAMHD1+is+the+dendritic-+and+myeloid-cell-specific+HIV-1+restriction+factor+counteracted+by+Vpx%5BTitle%5D)+AND+%22Nature%22%5BJournal%5D)">SAMHD1 is the dendritic- and myeloid-cell-specific HIV-1 restriction factor counteracted by Vpx.</a> Nature. 474 (7353), 654-657 (2011).</li>
<li>Hrecka, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Vpx+relieves+inhibition+of+HIV-1+infection+of+macrophages+mediated+by+the+SAMHD1+protein%5BTitle%5D)+AND+%22Nature%22%5BJournal%5D)">Vpx relieves inhibition of HIV-1 infection of macrophages mediated by the SAMHD1 protein.</a> Nature. 474 (7353), 658-661 (2011).</li>
<li>Seki, A., Rutz, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Optimized+RNP+transfection+for+highly+efficient+CRI+SPR%2FCas9-mediated+gene+knockout+in+primary+T+cells%5BTitle%5D)+AND+%22J+Exp+Med%22%5BJournal%5D)">Optimized RNP transfection for highly efficient CRI SPR/Cas9-mediated gene knockout in primary T cells.</a> J Exp Med. 215 (3), 985-997 (2018).</li>
<li>Batista Napotnik, T., Polajžer, T., Miklavčič, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Cell+death+due+to+electroporation+-+A+review%5BTitle%5D)+AND+%22Bioelectrochemistry%22%5BJournal%5D)">Cell death due to electroporation - A review.</a> Bioelectrochemistry. 141, 107871(2021).</li>
<li>Perretta-Tejedor, N., Freke, G., Seda, M., Long, D. A., Jenkins, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Generating+mutant+renal+cell+lines+using+CRISPR+technologies%5BTitle%5D)+AND+%22Methods+Mol+Biol%22%5BJournal%5D)">Generating mutant renal cell lines using CRISPR technologies.</a> Methods Mol Biol. 2067, 323-340 (2020).</li>
<li>Sentmanat, M. F., Peters, S. T., Florian, C. P., Connelly, J. P., Pruett-Miller, S. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+survey+of+validation+strategies+for+CRISPR-Cas9+editing%5BTitle%5D)+AND+%22Sci+Rep%22%5BJournal%5D)">A survey of validation strategies for CRISPR-Cas9 editing.</a> Sci Rep. 8 (1), 888(2018).</li>
<li>Makino, S., Fukumura, R., Gondo, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Illegitimate+translation+causes+unexpected+gene+expression+from+on-target+out-of-frame+alleles+created+by+CRISPR-Cas9%5BTitle%5D)+AND+%22Sci+Rep%22%5BJournal%5D)">Illegitimate translation causes unexpected gene expression from on-target out-of-frame alleles created by CRISPR-Cas9.</a> Sci Rep. 6, 39608(2016).</li>
<li>Bowling, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Downstream+alternate+start+site+allows+N-terminal+nonsense+variants+to+escape+NMD+and+results+in+functional+recovery+by+readthrough+and+modulator+combination%5BTitle%5D)+AND+%22J+Pers+Med%22%5BJournal%5D)">Downstream alternate start site allows N-terminal nonsense variants to escape NMD and results in functional recovery by readthrough and modulator combination.</a> J Pers Med. 12 (9), 1448(2022).</li>
<li>Inácios, Â, et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Nonsense+mutations+in+close+proximity+to+the+initiation+codon+fail+to+trigger+full+nonsense-mediated+mRNA+decay%5BTitle%5D)+AND+%22J+Biol+Chem%22%5BJournal%5D)">Nonsense mutations in close proximity to the initiation codon fail to trigger full nonsense-mediated mRNA decay.</a> J Biol Chem. 279 (31), 32170-32180 (2004).</li>
<li>Li, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Efficient+inversions+and+duplications+of+mammalian+regulatory+DNA+elements+and+gene+clusters+by+CRISPR%2FCas9%5BTitle%5D)+AND+%22J+Mol+Cell+Biol%22%5BJournal%5D)">Efficient inversions and duplications of mammalian regulatory DNA elements and gene clusters by CRISPR/Cas9.</a> J Mol Cell Biol. 7 (4), 284-298 (2015).</li>
<li>Guo, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((CRISPR+inversion+of+CTCF+sites+alters+genome+topology+and+enhancer%2Fpromoter+function%5BTitle%5D)+AND+%22Cell%22%5BJournal%5D)">CRISPR inversion of CTCF sites alters genome topology and enhancer/promoter function.</a> Cell. 162 (4), 900-910 (2015).</li>
</ol>

<table><tbody><tr><td>0,2 &Mikro; m Spritzenfilter</td><td>ClearLine</td><td>146560</td><td>_</td></tr><tr><td>0,4 % Trypanblau</td><td>Beckman Coulter</td><td>383200</td><td>_</td></tr><tr><td>1,5 mL Tube</td><td>Eppendorf</td><td>3810X</td><td>_</td></tr><tr><td>24-Well-Platte</td><td>Corning</td><td>353047</td><td>_</td></tr><tr><td>6x TriTrack DNA Loading Dye</td><td>Thermo scientific</td><td>R1161</td><td>_</td></tr><tr><td>75 cm&sup2; Kulturflasche mit belüfteter Kappe</td><td>Corning</td><td>353136</td><td>_</td></tr><tr><td>8-Streifen-PCR-Röhrchen mit Kappen</td><td>Life Technologies</td><td>AM12230</td><td>_</td></tr><tr><td>96-Well-Platten</td><td>Corning</td><td>353072</td><td>_</td></tr><tr><td>96-Well-Platten</td> mit flachem Boden <td>Corning</td><td>353077</td><td>_</td></tr><tr><td>Agarose</td><td>Euromedex</td><td>D5</td><td>_</td></tr><tr><td>ATGpr</td><td>_</td><td>_</td><td>https://atgpr.dbcls.jp/</td></tr> <tr><td>ChemiDoc Imaging System</td><td>BIO-RAD</td><td>12003153</td><td>_</td></tr><tr><td>Zählobjektträger</td><td>NanoEntek</td><td>DHC-N04</td><td>_</td></tr><tr><td>CRISPOR</td><td>_</td><td>_</td><td>http://crispor.gi.ucsc.edu/</td></tr> <tr><td>DPBS</td><td>Gibco</td><td>14190094</td><td>_</td></tr><tr><td>Ensembl</td><td>EMBL-EBI</td><td>_</td><td>https://www.ensembl.org/index.html</td></tr><tr><td>Fötales Rind Serum</td><td>Sigma-Aldrich</td><td>F7524</td><td>_</td></tr><tr><td>FlowJo</td><td>BD Life Sciences</td><td>v10.10</td><td>_</td></tr><tr><td>GeneRuler 100 bp Plus DNA Ladder</td><td>Thermo scientific</td><td>SM0323</td><td>_</td></tr><tr><td>Genome Data Viewer</td><td>NCBI</td><td>_</td><td>https://www.ncbi.nlm.nih.gov/gdv/</td></tr> <tr><td>GraphPad Prism</td><td>Dotmatics</td><td>_</td><td>Version 9.3.1</td></tr><tr><td>Herculase II Fusion DNA-Polymerasen</td><td>Agilent</td><td>600679</td><td>_</td></tr><tr><td>ICE CRISPR Analysewerkzeug</td><td>Synthego</td><td>_</td><td>https://www.synthego.com/products/bioinformatics/crispr-analysis</td></tr><tr><td>Image Lab Touch</td><td>BIO-RAD</td><td>_</td><td>Version 2.4.0.03</td></tr><tr><td>NEBuffer 2</td><td>New England Biolabs</td><td>B7002S</td><td>Im Lieferumfang enthalten T7EI M0302S</td></tr><tr><td>Neon Kit, 10 & micro; L</td><td>Invitrogen</td><td>MPK1025K</td><td>Elektroporationskit mit Spitzen, Röhrchen, Puffer R und E</td></tr><tr><td>Neon Transfektionssystem</td><td>Invitrogen</td><td>MPK5000</td><td>_</td></tr><tr><td>NetStart 1.0</td><td>_</td><td>_</td><td>https://services.healthtech.dtu.dk/services/NetStart-1.0/</td></tr> <tr><td>Nukleasefreies Wasser</td><td>Synthego</td><td>_</td><td>_</td></tr><tr><td>PCR Primer (EGFP)</td><td>Eurofins</td><td>_</td><td>Fw : GGAATGCAAGGTCTGTTGAATG ; Rev : CACCTTGATGCCGTTCTTCT</td></tr><tr><td>PCR-Primer (SAMHD1)</td><td>Eurofins</td><td>_</td><td>Fw : CGGGATTGATTTGAGGACGA ; Rev : GGGTGGCAAGTTAGTGAAGA</td></tr><tr><td>Penicillin-Streptomycin (10.000 U/ml)</td><td>Gibco</td><td>15140122</td><td>_</td></tr><tr><td>PFA</td><td>Elektronenmikroskopie Sciences</td><td>15714</td><td>_</td></tr><tr><td>PMA</td><td>Sigma-Aldrich</td><td>P8139</td><td>_</td></tr><tr><td>PrimerQuest</td><td>IDT</td><td>_</td><td>https://eu.idtdna.com/pages/tools/primerquest</td></tr><tr><td>QIAquick PCR-Aufreinigungskit</td><td>Qiagen</td><td>28104</td><td>_</td></tr><tr><td>QuickExtract DNA-Extraktionslösung</td><td>Biosearch Technologies</td><td>QE09050</td><td>_</td></tr><tr><td>RPMI 1640, GlutaMAX</td><td>Gibco</td><td>61870010</td><td>_</td></tr><tr><td>SnapGene Viewer</td><td>Dotmatics</td><td>_</td><td>Version 7</td></tr><tr><td>SpCas9 2NLS Nuklease</td><td>Synthego</td><td>_</td><td>_</td></tr><tr><td>SYBR Safe DNA Gel Stain</td><td>Invitrogen</td><td>S33102</td><td>_</td></tr><tr><td>Synthetische sgRNA (EGFP)</td><td>Synthego</td><td>_</td><td>#1 : CGCGCCGAGGUGAAGUUCGA ; #2 : UUCAAGUCCGCCAUGCCCGA ; #3 : CAACUACAAGACCCGCGCCG</td></tr><tr><td>Synthetische sgRNA (SAMHD1)</td><td>Synthego</td><td>_</td><td>#1 : AUCGCAACGGGGACGCUUGG ; #2 : GCAGUCAAGAACCUGCGGCGC ; #3 : CCAUCCCGACUACAAGACAU</td></tr><tr><td>Spritze Plastipak Luer Lock</td><td>BD</td><td>301229</td><td>_</td></tr><tr><td>T100 Thermocycler</td><td>BIO-RAD</td><td>1861096</td><td>_</td></tr><tr><td>T7 Endonuklease I</td><td>Neu England Biolabs</td><td>M0302S</td><td>_</td></tr><tr><td>TAE Puffer UltraPure, 10x</td><td>Invitrogen</td><td>15558026</td><td>400 mM Tris-Acetat, 10 mM EDTA</td></tr><tr><td>THP-1 Zellen</td><td>ATCC</td><td>TIB-202</td><td>_</td></tr><tr><td>Trypsin-EDTA (0,05 %)</td><td>Gibco</td><td>25300054</td><td>_</td></tr><tr><td>ZE5 Zellanalysator</td><td>BIO-RAD</td><td>12014135</td><td>_</td></tr></tbody></table>

elektroporationsbasierter crispr-cas9-vermittelter gen-knockout in thp-1-zellen und einzelzell-klonisolierung

Electroporation-Based CRISPR-Cas9-Mediated Gene Knockout in THP-1 Cells and Single-Cell Clone Isolation

Es wurde eine THP-1-Zelllinie erzeugt, die das GFP-Reporterprotein (THP-1_GFP) stabil exprimiert (Abbildung 2A) und als Werkzeug zur Etablierung eines Protokolls für eine effiziente CRISPR-Cas9-vermittelte Genedition verwendet. Zu diesem Zweck wurden mit dem CRISPOR-Web-Tool29 (Abbildung 2B) 3 sgRNAs, die auf das EGFP-Gen abzielen, mit dem CRISPOR-Web-Tool 29 (Abbildung 2B) entwickelt, die gleichzeitig mit Cas9 in einem molaren V...

Elektroporationsbasierter CRISPR-Cas9-vermittelter Gen-Knockout in THP-1-Zellen und Einzelzell-Klonisolierung

The human acute monocytic leukemia (AML) THP-1 cell line is widely used as a model to study the functions of human monocyte-derived macrophages, including ...

electroporation-based-crispr-cas9-mediated-gene-knockout-thp-1-cells

Research

Forschung

JoVE Journal

Immunology and Infection

Immunologie und Infektion

In diesem Video demonstrieren wir die All-in-One-CRISPR-Cas9-basierte Genomeditierung in kultivierten Zellen, bei der Cas9 und sgRNA den Zellen als ein einziges Plasmidkonstrukt zur Verfügung gestellt werden. Das CRISPR-Cas9-System und das gewünschte einzubringende Gen wurden durch Elektroporationstechnik in die Zellen eingeführt, um eine erfolgreiche Geneditierung zu ermöglichen.

All-in-One-CRISPR-Genom-Editing: Eine Methode für den homologiegesteuerten reparaturbasierten Gen-Knock-in in kultivierten Zellen mit dem CRISPR-Cas9-System

Dieses Video zeigt einen Assay zur Durchführung von Gen-Editierung in menschlichen T-Zellen mit der CRISPR-Cas9-Technologie. Eine Mischung aus primären CD4+- und CD8+-T-Zellen wird mit einem CRISPR-Cas9-Ribonukleoprotein-Komplex kombiniert, der auf spezifische Gene für den Knockout abzielt. Bei der Elektroporation leitet die sgRNA Cas9 zur Ziel-DNA-Sequenz und erzeugt so präzise Schnitte. Diese Schnitte werden dann durch den nicht-homologen Endverbindungsmechanismus der Zelle repariert, was zu...

Eine CRISPR-Cas9-Technik zur Gen-Editierung in T-Zellen

Die Genotypisierung hier beschriebene Technik, die Paare fluoreszierende Polymerase-Kettenreaktion (PCR) Gelelektrophorese Kapillare ermöglicht eine Hochdurchsatz-Genotypisierung von Nuklease-vermittelte knockout-Klone. Es umgeht die von anderen Genotypisierung Techniken konfrontiert Einschränkungen und kostengünstiger als Sequenzierungsverfahren ist.

Mit Hilfe eines Fluoreszenz-PCR-Kapillar-Gel-Elektrophorese-Technik CRISPR zum Genotyp / Cas9 vermittelte Knock-out Mutanten in einem Hochdurchsatz-Format

Jüngste Fortschritte in der Fähigkeit, somatische Zelllinien genetisch zu manipulieren, haben großes Potenzial für grundlegende und angewandte Forschung. Hier präsentieren wir zwei Ansätze für CRISPR / Cas9-produzierte Knockout-Produktion und Screening in Säugetierzelllinien, mit und ohne Verwendung von selektierbaren Markern.

Selektionsabhängige und unabhängige Erzeugung von CRISPR / Cas9-vermittelten Gen-Knockouts in Säugetierzellen

Dieses Protokoll beschreibt im Detail die Generation der Fußabdruck-freie induzierten pluripotenten Stammzellen (iPSCs) aus menschlichen Zellen der Bauchspeicheldrüse in den Feeder-freien Bedingungen, gefolgt von Bearbeitung mit CRISPR/Cas9 Ribonucleoproteins und Charakterisierung der geänderten einzellige Klone.

Effiziente Erzeugung und Bearbeitung von Feeder-freie IPSCs aus menschlichen Zellen der Bauchspeicheldrüse mit dem CRISPR-Cas9-System

Ein Protokoll für schnelle CRISPR/Cas9-vermittelte gen Störung bei Maus und humane primäre hämatopoetische Zellen wird in diesem Artikel beschrieben. Cas9-SgRNA Ribonucleoproteins sind über Elektroporation mit SgRNAs erzeugt durch in-vitro- Transkription und kommerzielle Cas9 eingeführt. Hohe Wirkungsgrade Bearbeitung werden mit wenig Zeit und finanziellem Aufwand erreicht.

Hocheffiziente gen Störung der murinen und menschlichen hämatopoetischen Vorläuferzellen von CRISPR/Cas9

Hier präsentieren wir Ihnen ein Protokoll zur primären oder erweiterten menschlichen natürlichen (NK) Killerzellen mit Cas9 Ribonucleoproteins (Cas9/RNPs) genetisch zu verändern. Mithilfe dieses Protokolls erzielten wir menschliche NK-Zellen für Umwandlung Wachstumsfaktor-b-Rezeptor 2 (TGFBR2) und Hypoxanthin-Phosphoribosyltransferase 1 (HPRT1) mangelhaft.

Generation von Knock-out-Grund- und erweiterten menschlichen NK-Zellen mit Cas9 Ribonucleoproteins

Hier wird ein Protokoll zur effizienten CRISPR/Cas9 Ribonucleoprotein-vermittelten Genbearbeitung in Säugetierzellen mittels Röhrenelektroporation vorgestellt.

CRISPR/Cas9 Ribonucleoprotein-vermittelte präzise Genbearbeitung durch Tube Electroporation

Die vorgestellte Methode beschreibt die Erzeugung eines CRISPR-vermittelten Gen-Knockouts in der humanen embryonalen Stammzelllinie (hESC) H9, die sgRNAs, die auf das L2HGDH-Gen abzielen, unter Verwendung eines hocheffizienten lentiviralen Gentransfersystems stabil exprimiert.

CRISPR-Cas9-vermittelte Gendeletion in humanen pluripotenten Stammzellen, die unter feederfreien Bedingungen kultiviert wurden

Hier skizzieren wir ein umfassendes Protokoll für die Generierung und Verwendung von labortechnisch hergestellten Glioblastom-Organoiden (LEGO), um Genotyp-Phänotyp-Abhängigkeiten zu untersuchen und potenzielle Medikamente für die Glioblastombehandlung zu screenen.

Labortechnische Glioblastom-Organoidkultur und Wirkstoffscreening

Es wird ein detailliertes Protokoll für die Verwendung der CRISPR/Cas9-Technologie zur Erzielung eines hocheffizienten gezielten Knock-ins von großen, multicistronischen Konstrukten in primären humanen T-Zellen über den Homologie-vermittelten Endverbindungsweg (HMEJ) zur Verfügung gestellt. T-Zellen, die mit diesem cGMP-adaptierbaren Protokoll hergestellt wurden, behalten eine hervorragende Zellexpansion, Zytotoxizität und Zytokinproduktion bei.

Nicht-virales Engineering von primären humanen T-Zellen durch Homologie-vermittelte Endverknüpfung und gezielte Integration großer DNA-Templates

Lernen Sie die CRISPR-Cas9-basierte Gen-Knockout-Methode in THP-1-Zellen zur Untersuchung von HIV-Resistenzmechanismen in Makrophagen. Dieses Protokoll ermöglicht präzise genetische Modifikationen für AIDS-Forschung.

Elektroporationsbasierter CRISPR-Cas9-vermittelter Gen-Knockout in THP-1-Zellen und Einzelzell-Klonisolierung

Weitere Videos entdecken