Short Hairpin RNA-Mediated Gene Knockdown in iHSPCs In Vitro: A Lentivirus-Based shRNA Expression System Delivery into iHSPCs for Knockdown of Specific Gene Expression

Overview

In this video, we demonstrate a method to perform transduction of shRNA lentiviral vectors to obtain stable knockdown cell lines in immortalized hematopoietic stem and progenitor cells (iHSPCs).

Protocol

1. Preparation of immortalized hematopoietic stem and progenitor cell lines (iHSPCs)

1. Maintain iHSPC cell line in complete RPMI 1640 medium containing 100 ng/mL FL and 1 μM β-estradiol.
2. Passage the cells at a ratio of 1:10 every 3 days.
   NOTE: Make complete RPMI 1640 medium by supplementing with 10% fetal bovine serum (FBS), 5 x10^-5 M β-mercaptoethanol, and 10 μg/mL gentamicin. Recombinant murine FL is also commercially available.

2. Lentiviral transduction

1. Plate iHSPCs at a density of 1 x 10⁵ cells/well in 12-well plates in 1 mL of complete medium containing 100 ng/mL FL, 1 μM β-estradiol, and 8 μg/mL polybrene.
   NOTE: The concentration of polybrene depends on the cell types and is usually in the range of 4-8 μg/mL.
2. Add shRNA-carrying lentivirus in each well at a multiplicity of infection (MOI) of 100.
   NOTE: The lentiviral vector is pLKO.1-Puro with a puromycin selection marker (Figure 1). The target sequences of shRNAs against LacZ, Tcf4, and Id2, respectively, are listed in the Table of Materials. The MOI is defined by the number of virions that are added per cell during infection.
   
3. Spin the plates at 1,100 x g for 90 min at 37 °C.
4. Incubate the plate containing infected cells for overnight at 37 °C in an incubator.
   NOTE: If the cells are sensitive to polybrene, then refresh the cells with the complete medium without polybrene after the spin infection.
5. Refresh cells with complete medium containing 100 ng/mL FL and 1 μM β-estradiol 24 h after the infection.
6. Add 6 μg/mL of puromycin to the medium to select the infected cells after an additional 24 h.
   NOTE: Transduced lentiviral vector usually takes 48 h for expressing genes, including puromycin resistant gene. Ensure that the concentration of puromycin is optimized for each cell line.
7. Refresh the selection medium containing 100 ng/mL FL, 1 μM β-estradiol, and 6 μg/mL puromycin every 3 days and maintain the cells for at least one week to expand the stably transduced iHSPC cells.
   NOTE: Puromycin selection usually takes effect 48 h later, and the period of selection depends on cell types.

Representative Results

Figure 1: The construct of lentiviral vector pLKO.1-Puro.

Materials

Name	Company	Catalog Number	Comments
1.5 mL Micro tube	ExtraGene	TUBE-170-C
12-well tissue culture-treated plate	Falcon	353043
Fetal bovine serum (FBS)	Corning	35-010-CV
RPMI 1640 medium	Gibco	11875-085
β-estradiol	Sigma-Aldrich	E2758-250MG
β-mercaptoethanol (β-ME)	Sigma-Aldrich	M6250
Flt3 ligand (FL)	Home-made
Polybrene	Sigma-Aldrich	TR-1003-G
Puromycin	Invivogen	ant-pr-1
shId2 (GCTTATGTCGAATGATAGCAA/TRCN0000054390)	The RNAi Consortium (TRC)
shLacZ (CGCGATCGTAATCACCCGAGT/TRCN0000072224)	The RNAi Consortium (TRC)
shTcf4 (GCTGAGTGATTTACTGGATTT/TRCN0000012094)	The RNAi Consortium (TRC)