Tissue-specific microRNA inhibition is a technology that is underdeveloped in the microRNA field. Herein, we describe a protocol to successfully inhibit the miR-181 microRNA family in myoblast cells from the heart. Nanovector technology is used to deliver a microRNA sponge that demonstrates significant in vivo cardio-specific miR-181 family inhibition.
MicroRNA (miRNA) is small non-coding RNA which inhibits post-transcriptional messenger RNA (mRNA) expression. Human diseases, such as cancer and cardiovascular disease, have been shown to activate tissue and/or cell-specific miRNA expression associated with disease progression. The inhibition of miRNA expression offers the potential for a therapeutic intervention. However, traditional approaches to inhibit miRNAs, employing antagomir oligonucleotides, affect specific miRNA functions upon global delivery. Herein, we present a protocol for the in vivo cardio-specific inhibition of the miR-181 family in a rat model. A miRNA-sponge construct is designed to include 10 repeated anti-miR-181 binding sequences. The cardio-specific α-MHC promoter is cloned into the pEGFP backbone to drive the cardio-specific miR-181 miRNA-sponge expression. To create a stable cell line expressing the miR-181-sponge, myoblast H9c2 cells are transfected with the α-MHC-EGFP-miR-181-sponge construct and sorted by fluorescence-activated cell sorting (FACs) into GFP positive H9c2 cells which are cultured with neomycin (G418). Following stable growth in neomycin, monoclonal cell populations are established by additional FACs and single cell cloning. The resulting myoblast H9c2-miR-181-sponge-GFP cells exhibit a loss of function of miR-181 family members as assessed through the increased expression of miR-181 target proteins and compared to H9c2 cells expressing a scramble non-functional sponge. In addition, we develop a nanovector for the systemic delivery of the miR-181-sponge construct by complexing positively charged liposomal nanoparticles and negatively charged miR-181-sponge plasmids. In vivo imaging of GFP reveals that multiple tail vein injections of a nanovector over a three-week period are able to promote a significant expression of the miR-181-sponge in a cardio-specific manner. Importantly, a loss of miR-181 function is observed in the heart tissue but not in the kidney or the liver. The miRNA-sponge is a powerful method to inhibit tissue-specific miRNA expression. Driving the miRNA-sponge expression from a tissue-specific promoter provides specificity for the miRNA inhibition, which can be confined to a targeted organ or tissue. Furthermore, combining nanovector and miRNA-sponge technologies permits an effective delivery and tissue-specific miRNA inhibition in vivo.
Over the last two decades, there have been numerous studies that have pointed to the significant role of miRNAs in human disease. Findings from a large body of literature demonstrate the undeniable importance of miRNAs in the pathophysiology of diseases, such as cancer1 and cardiovascular disease2,3,4,5. For example, miR-21 is upregulated in many cancers, resulting in an increased cell cycle and cell proliferation6. In hepatitis C infections, miR-122 plays an important role in the replication of the virus7, and it has been shown that the inhibition of miR-122 decreases the viral load8. In cardiac hypertrophy, miR-212/132 is upregulated in the heart and is involved in the pathological phenotype9. The obvious importance of the downregulation or functional inhibition of an upregulated miRNA suggests opportunities for therapeutically exploiting the miRNA biology in almost all diseases.
The four miR-181 family members, miR-181a/b/c/d, are found in three genomic locations in the human genome. The intronic region of a non-coding RNA host gene (MIR181A1-HG) encodes the cluster of miR-181-a/b-1. The intronic region of the NR6A1 gene encodes the miR-181-a/b-2. The miR-181-c/d cluster is located in an uncharacterized transcript on chromosome 19. All the miR-181 family members share the same "seed" sequence and all four miR-181 family members can potentially regulate the same mRNA targets.
We3,4 and others10 have highlighted the importance of miR-181 family members during the end-stage heart failure. We have also recognized that a miR-181c upregulation occurs under pathological conditions associated with an increased risk of heart disease, such as type II diabetes, obesity, and aging3,4,5. It has been postulated that the overexpression of miR-181c causes oxidative stress which leads to a cardiac-dysfunction4.
Several groups have suggested that miRNA exist in mitochondria11,12,13,14, but we were the first to demonstrate that miR-181c is derived from the nuclear genome, processed, and subsequently translocated to the mitochondria in the RISC3. Furthermore, we have detected a low expression of miR-181a and miR-181b in the mitochondrial compartment of the heart5. Importantly, we have found that miR-181c represses the mt-COX1 mRNA expression, thereby demonstrating that miRNAs participate in the mitochondrial gene regulation and alter mitochondrial function3,4.
This article discusses the methodology required to design a miRNA-sponge to knock down the entire miR-181 family in cardiomyocytes. Moreover, we outline a protocol for the in vivo application of the miR-181-sponge.
All experimental procedures were approved by the Institutional Animal Care and Use Committee of Johns Hopkins University.
1. Sponge Design
2. Cloning the Recipient Vector to Include a Tissue-specific Promoter
Note: Use the pEGFP-C1 vector as the recipient vector for the expression cassette of the miRNA sponge. The pEGFP-C1 vector contains a reading frame for an EGFP driven by a cytomegalovirus (CMV) promoter. The CMV promoter is constitutively active in mammalian cells. If a tissue-specific promoter is required, the CMV promoter can be removed by digestion of AseI and NheI enzymes (see step 2.1). The plasmid contains an extensive multiple cloning site (MCS) as well as kanamycin (Kan) and neomycin (G418) markers for a selection in bacteria and a stable expression in mammalian cells, respectively.
3. Cloning the Sponge
4. Generation of Stable H9c2 miR-181-sponge Expressing Cells
5. Synthesis and Purification of Sponge-nanoparticles (miR-181-sponge Nanoparticles)
6. Systemic Delivery of Sponge-nanoparticles and Validation of In Vivo Effects
In the stably transfected pEGFP-miR-181-sponge-expressing H9c2 cells (from step 4.2), the expression of the entire miR-181 family (miR-181a, miR-181b, miR-181c, and miR-181d) was moderately decreased relative to pEGFP-scrambled-expressing H9c2 cells. MiR-181-sponge serves as a competitive inhibitor of the entire miR-181 family, so we anticipated that the expression of the miR-181c mitochondrial target gene, mt-COX1, would increase. Western blot data suggest that the mt-COX1 expression was increased in the pEGFP-miR-181-sponge-expressing H9c2 cells compared to the pEGFP-scramble-expressed H9c2 cells. Additionally, no expression changes for either mt-COX2 or mt-COX3 were detected via immunoblot in the pEGFP-miR-181-sponge-expressing H9c2 cells. We used α-tubulin as the normalization control for the immunoblotting analysis. GFP signals were mainly observed in the liver and kidney up to 2 weeks post-systemic delivery of the miR-sponge nanovector (Figure 1A). However, the GFP expression was significantly higher in the heart tissue after 3 weeks of miR-181-sponge nanovector delivery (Figure 1A and 1B). Of note, there was a GFP signal detected in the liver tissue in some animals 3 weeks after the systemic delivery; however, there were no functional effects of the miR-181-sponge in the liver at that time point.
The western blot showed a significant increase in the mt-COX1 expression in the miR-181-sponge nanovector-injected rats compared to the scramble nanovector groups (Figure 2). Higher mt-COX1 suggests there is a lower miR-181c expression in the heart after 3 weeks of the miR-181-sponge nanovector delivery, as mt-COX1 is the direct target for miR-181c. We used α-tubulin as the normalization control for the immunoblots.
Echocardiography showed no change in the cardiac function of the miR-181-sponge nanovector-injected rats before, during, and at the end of the treatment regimen, compared to the scramble nanovector group of animals.
Figure 1. In vivo analysis of nanovector delivery of the miR-181-Sponge. (A) This panel shows the optimized 3-week treatment protocols with 6 intravenous injections through the tail vein. The yellow colorization in the epifluorescence image demonstrates the expression of the pEGFP vector. The maximum intensity of the yellow colorization is observed at the week 3 time point. (B) The α-MHC promoter sequence in the pEGFP vector selectively expresses either the miR-181-sponge or the scrambled sequence in the heart at day 21. Please click here to view a larger version of this figure.
Figure 2. Validation of the effect of miR-181-sponge nanovector on miR-181c expression. This is the western blot analysis of the mt-COX1 expression in the heart lysates obtained from pEGFP-scramble and pEGFP-miR-181-sponge nanovector-injected rats. Whole-heart homogenates were probed with the indicated antibodies. We used α-tubulin as a loading control. The band-densitometry is shown in the bar graph below. Student's t-test was performed, and the standard error was plotted in the bar graph as error bars. * p <0.05 vs. pEGFP-scramble group. n = 4.
Primer Name | Sequence | TM | Notes | Use | Target | |
SAM3-1F | ATGCATTAGTTATTAATGCTT GACACACTTGACAATTTCT |
58.4 | Rat MHC promoter to clone into EGFP | PCR | MHC promoter | |
SAM3-2R | GACCGGTAGCGCTAGCTG ACTCACTGGGAGATTGCTT |
59.8 | Rat MHC promoter to clone into EGFP | PCR | MHC promoter | |
SAM3-3F | CGAACGACCTACACCGAACT | 64 | Screen EGFP-F | Colony PCR | Positive promoter clones | |
SAM3-4R | CGCTAGTCCTTGACCCTCTG | 63.9 | Screen MHC-R | Colony PCR | Positive promoter clones | |
SAM5-1F | CCTGTCTCCAACACACAAGC | 59.3 | Sequence MHC promoter | Sequencing | MHC promoter | |
SAM5-2R | CAGACTGCAGGGCTGGTT | 60 | Sequence MHC promoter | Sequencing | MHC promoter |
Table 1. Primer sequences.
This article described the design and synthesis of a miRNA-sponge and demonstrated how the tissue-specific expression of the sponge is a powerful tool to inhibit tissue-specific miRNA family expression.
We have demonstrated that a miR-181 family targeting sponge can be cloned into an expression plasmid with a cardiac-specific promoter. The plasmid can be efficiently packaged into a nanovector particle for delivery both in vitro and in vivo using electroporation or a tail vein injection, respectively (Figure 1). The miR-181 sponge can inhibit a cardiac-specific expression of the miR-181 family and can affect the expression of miR-181 target genes (Figure 2). The GFP in the plasmid is an added advantage, which can visualize the delivery and the expression profile of the nanovector without sacrificing the animals.
Briefly, a miRNA-sponge consists of a series of miRNA antisense sequences placed after a reporter gene that acts as a decoy miRNA target mRNA. Naturally occurring miRNA-sponges have been found to be endogenously expressed in plants and animal cells as long non-coding RNAs (lncRNAs)17. In the present study, we have utilized a sponge approach to inhibit the entire miR-181 family in the heart. Although the miR-181-sponge approach is a physiologically relevant method to downregulate the miR-181 family in cultured cells, an in vivo application of miR-181-sponges can be detrimental. For example, several studies have demonstrated a protective role of miR-181a and miR-181b in different cell/tissue types18,19,20. Therefore, the miR-181-sponge expression should be targeted specifically to heart tissue.
Small oligonucleotides have been demonstrated to block the miRNA function through annealing to the mature miRNA guide strand and prevent a proper loading into the RNA-induced silencing complex (RISC). A problem associated with this approach is that oligonucleotides have to be delivered in a saturating dose sufficient to block cellular pools of mature miRNAs. Oligonucleotides also suffer from challenges involving transport across cellular membranes and a general stability of the molecule. Ingeniously, it has been shown that an exogenously supplied miRNA target can act as a decoy for its cognate miRNA21. By virtue of multiple binding sites tethered together into a pseudo 3'UTR construct, the decoy target, or miRNA-sponge, is able to stably interact with its target miRNAs and sequester the miRNA into microribonucleoprotein complexes (miRNPs), thus effectively preventing the miRNA function. The so-called "miRNA-sponge" is an effective anti-sense technology, which can efficiently downregulate miRNA both in vitro and in vivo. Therefore, the application of a miRNA-sponge can be used to study miRNA loss-of-function phenotypes.
The notion that RNA interference (RNAi) could lead to a new class of therapeutics caught the attention of many investigators soon after its discovery. The field of applied RNAi therapeutics has moved very quickly from lab to bedside. Presently, miRNA therapeutics is one of the fast-growing therapeutic interventions in oncology and is currently in phase 1 clinical trials. Antisense oligonucleotides, or antagomirs, are one of the most widely used miRNA inhibitory approaches. Ma et al.22 used miR-10b antagomir, both in vitro and in vivo, to silence upregulated miR-10b in a solid tumor.
In vivo, the efficient silencing of upregulated miRNAs requires a chemical modification of the antagomirs to improve the binding affinity, biostability, and pharmacokinetic properties. To increase the duplex melting temperature (Tm) and improve the nuclease resistance of antagomirs, chemical modifications can be performed, such as 2′-O-methyl (2′-O-Me), 2′-O-methoxyethyl (2′-MOE) 2′-fluoro, and the bicyclic-locked nucleic acid (LNA)23,24,25,26,27,28,29,30,31. For a better efficiency of the in vivo delivery, the antagomir can be modified by the phosphorothioate (PS) linkages, which have increased the nuclease resistance28. Additionally, PS backbone modifications also enhance the binding to plasma proteins reducing urinary excretion. Thus, PS-modified antagomirs show a significant improvement of pharmacokinetic properties, facilitating their systemic delivery32. It has also been shown that using peptide nucleic acid (PNA) or morpholino oligomers, designed to target a specific miRNA, can be used to study miRNA loss-of-function phenotypes33,34,35,36,37,38,39. Polylysine-conjugated and nanoparticle-complexed PNA antagomirs efficiently inhibit the miRNA function both in vitro and in vivo36,37,38,39. Despite recent advances, an effective and tissue-specific delivery of miRNA-derivatives remains a challenge. These include the potential for off-target effects, triggering innate immune responses and, most importantly, obtaining a specific delivery into the cells of targeted organs/tissues.
Additionally, miRNA expression levels vary greatly depending on the cell and tissue type40. Furthermore, the miRNA expression can be increased or decreased in disease. The consequence of an altered miRNA expression and the effect on cellular and tissue function with sponge-inhibited miRNA expression needs to be validated and determined empirically. Extensive preclinical studies in animal disease models are needed to determine the optimal level of the inhibition for a given miRNA target.
Interestingly, miR-181c miRNA exhibits subcellular compartmentalization3,4,5. Specifically, as expected, the miR-181s are encoded in the nucleus and transcribed as long-pri-miRNA transcripts which are processed in the cytoplasm by the dicing machinery and incorporated into RISC. However, unlike canonical miRNAs that function in the cytoplasm, the mature form of miR-181c translocates into the mitochondria and functions in the regulation of mitochondrial-specific genes3. We have demonstrated that the miR-181-sponge can bind the mature form of miR-181c in the cytoplasmic fraction, thus preventing the translocation to the mitochondria. Consequently, an upregulation of mt-COX1 can be observed in the mitochondria under the conditions of a downregulation of the miR-181c expression.
We have reported the methodology required to design a miRNA-sponge to knock down the expression of any miRNA and outlined a protocol for the in vivo application of the miRNA-sponge. Tissue-specific miRNA inhibition is currently an under-developed technique in the miRNA field. The importance of downregulation or functional inhibition of upregulated miRNAs in human disease suggests that it may be possible to exploit miRNA biology for therapeutic intervention.
This study highlighted a strategy for lowering a miRNA, which can be successfully employed in a tissue-specific manner in vivo. The miRNA-sponges utilize the antisense sequence of the miRNA "seed" sequence. Therefore, miRNA-sponges can downregulate all of the miRNAs that share the same "seed" sequence, viz., the entire miRNA family. In this study, we have observed a significant downregulation of the entire miR-181 family (miR-181a, miR-181b, miR-181c, and miR-181d) with the expression of the miR-181-sponge, both in vitro and in vivo. If one family member confers protection while another family member has detrimental effects within the same organ, using the miRNA-sponge technology would not be the ideal approach.
The authors have nothing to disclose.
We thank Anthony K. L. Leung of the Department of Biochemistry and Molecular Biology, Bloomberg School of Public Health, Johns Hopkins University for his technical help with designing the miR-181-sponge construct. We also thank Polina Sysa-Shah and Kathleen Gabrielson of the Department of Molecular and Comparative Pathobiology, Johns Hopkins Medical Institutions for their technical assistance by the in vivo imaging of the miRNA-Sponge delivery.
This work was supported by grants from the NIH, HL39752 (to Charles Steenbergen) and by a Scientist Development Grant from the American Heart Association 14SDG18890049 (to Samarjit Das). The rat cardio-specific promoter was generously provided by Jeffery D. Molkentin at the Cincinnati Children's Hospital.
pEGFP-C1 vector | Addgene | 6084-1 | |
In-fusion | Clontech | 121416 | |
QIAprep Miniprep | Qiagen | 27104 | |
QIAquick Gel Extraction Kit | Qiagen | 28704 | |
miR-181-sponge synthesis | Introgen GeneArt | custome made | |
PCR primers | Integrated DNA Technologies | custome | |
EcoRI enzymes | New Endland Biolabs | R0101S | |
KpnI enzymes | New Endland Biolabs | R0142S | |
Rapid DNA Ligation Kit | Sigma-Aldrich | 11635379001 | |
H9c2 cells | ATCC | CRL-1446 | |
DMEM Media | Thermo Fisher Scientific | 11965092 | |
Fetal Bovine Serum | Thermo Fisher Scientific | 10082139 | |
Nucleofector 2b Device | Lonza | AAB-1001 | |
Nucleofector Kits for H9c2 (2-1) | Lonza | VCA-1005 | |
G418, Geneticin | Thermo Fisher Scientific | 11811023 | |
FACSAria II Flow cytometer | BD Bioscience | 644832 | |
Branson 450 sonifier | Marshall Scientific | EDP 100-214-239 | |
The Xenogen IVIS Spectrum optical imaging device | Caliper Life Sciences | ||
Anti-MTCO1 antibody | Abcam | ab14705 | |
α-tubulin antibody | Abcam | ab7291 | |
Sequoia C256 ultrasound system | Siemens |