Name: Écran CRISPR à l’échelle du génome pour dévoiler les gènes radiosensibles et radiorésistants (Vidéo) | JoVE Journal
Uploaded: 2025-05-23T13:25:00.000+00:00
Duration: 8 min 32 s
Description: Découvrez le criblage CRISPR à l'échelle du génome pour identifier les gènes radiosensibles et radiorésistants dans les cellules de cancer du poumon. Cette méthode précise améliore la recherche génomique fonctionnelle.

ai_agent_IP

ai_agent

maintenance

instantTrialDurationMinutes

isBiopharma

enableNewMyJoveSectionDesign

educationFeatures

seoMetaApi

ai_copilot_institution_blacklist

ai_chat_institution_blacklist

freeAccessWindow

ssoRoleCapture

scheduledMaintenanceBanner

joveLabsFeatures

disable_autoplay_for_bots

extended_trial_duration

5 minutes

<ol><li>Barrangou, R., Marraffini, L. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((CRISPR-Cas+systems%3A+Prokaryotes+upgrade+to+adaptive+immunity%5BTitle%5D)+AND+%22Mol+Cell%22%5BJournal%5D)">CRISPR-Cas systems: Prokaryotes upgrade to adaptive immunity.</a> Mol Cell. 54 (2), 234-244 (2014).</li>
<li>Joung, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Genome-scale+CRISPR-Cas9+knockout+and+transcriptional+activation+screening%5BTitle%5D)+AND+%22Nat+Protoc%22%5BJournal%5D)">Genome-scale CRISPR-Cas9 knockout and transcriptional activation screening.</a> Nat Protoc. 12 (4), 828-863 (2017).</li>
<li>Sanjana, N. E., Shalem, O., Zhang, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Improved+vectors+and+genome-wide+libraries+for+CRISPR+screening%5BTitle%5D)+AND+%22Nat+Methods%22%5BJournal%5D)">Improved vectors and genome-wide libraries for CRISPR screening.</a> Nat Methods. 11 (8), 783-784 (2014).</li>
<li>Arroyo, J. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+Genome-wide+CRISPR+death+screen+identifies+genes+essential+for+oxidative+phosphorylation%5BTitle%5D)+AND+%22Cell+Metab%22%5BJournal%5D)">A Genome-wide CRISPR death screen identifies genes essential for oxidative phosphorylation.</a> Cell Metab. 24 (6), 875-885 (2016).</li>
<li>Sidik, S. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+genome-wide+CRISPR+screen+in+toxoplasma+identifies+essential+apicomplexan+genes%5BTitle%5D)+AND+%22Cell%22%5BJournal%5D)">A genome-wide CRISPR screen in toxoplasma identifies essential apicomplexan genes.</a> Cell. 166 (6), 1423-1435 (2016).</li>
<li>Jing, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Genome-wide+CRISPR+activation+screening+in+senescent+cells+reveals+SOX5+as+a+driver+and+therapeutic+target+of+rejuvenation%5BTitle%5D)+AND+%22Cell+Stem+Cell%22%5BJournal%5D)">Genome-wide CRISPR activation screening in senescent cells reveals SOX5 as a driver and therapeutic target of rejuvenation.</a> Cell Stem Cell. 30 (11), 1452-1471 (2023).</li>
<li>Shifrut, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Genome-wide+CRISPR+screens+in+primary+human+t+cells+reveal+key+regulators+of+immune+function%5BTitle%5D)+AND+%22Cell%22%5BJournal%5D)">Genome-wide CRISPR screens in primary human t cells reveal key regulators of immune function.</a> Cell. 175 (7), 1958-1971 (2018).</li>
<li>Shalem, O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Genome-scale+CRISPR-Cas9+knockout+screening+in+human+cells%5BTitle%5D)+AND+%22Science%22%5BJournal%5D)">Genome-scale CRISPR-Cas9 knockout screening in human cells.</a> Science. 343 (6166), 84-87 (2014).</li>
<li>Katti, A., Diaz, B. J., Caragine, C. M., Sanjana, N. E., Dow, L. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((CRISPR+in+cancer+biology+and+therapy%5BTitle%5D)+AND+%22Nat+Rev+Cancer%22%5BJournal%5D)">CRISPR in cancer biology and therapy.</a> Nat Rev Cancer. 22 (5), 259-279 (2022).</li>
<li>Sasmal, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Synthetic+host-guest+assembly+in+cells+and+tissues%3A+Fast%2C+stable%2C+and+selective+bioorthogonal+imaging+via+molecular+recognition%5BTitle%5D)+AND+%22Anal+Chem%22%5BJournal%5D)">Synthetic host-guest assembly in cells and tissues: Fast, stable, and selective bioorthogonal imaging via molecular recognition.</a> Anal Chem. 90 (19), 11305-11314 (2018).</li>
<li>Roos, W. P., Thomas, A. D., Kaina, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((DNA+damage+and+the+balance+between+survival+and+death+in+cancer+biology%5BTitle%5D)+AND+%22Nat+Rev+Cancer%22%5BJournal%5D)">DNA damage and the balance between survival and death in cancer biology.</a> Nat Rev Cancer. 16 (1), 20-33 (2016).</li>
<li>Huang, R., Zhou, P. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((DNA+damage+repair%3A+Historical+perspectives%2C+mechanistic+pathways+and+clinical+translation+for+targeted+cancer+therapy%5BTitle%5D)+AND+%22Signal+Transduct+Target+Ther%22%5BJournal%5D)">DNA damage repair: Historical perspectives, mechanistic pathways and clinical translation for targeted cancer therapy.</a> Signal Transduct Target Ther. 6 (1), 254(2021).</li>
<li>O'Connor, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Targeting+the+DNA+damage+response+in+cancer%5BTitle%5D)+AND+%22Mol+Cell%22%5BJournal%5D)">Targeting the DNA damage response in cancer.</a> Mol Cell. 60 (4), 547-560 (2015).</li>
<li>Lord, C. J., Ashworth, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+DNA+damage+response+and+cancer+therapy%5BTitle%5D)+AND+%22Nature%22%5BJournal%5D)">The DNA damage response and cancer therapy.</a> Nature. 481 (7381), 287-294 (2012).</li>
<li>Carusillo, A., Mussolino, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((DNA+Damage%3A+From+threat+to+treatment%5BTitle%5D)+AND+%22Cells%22%5BJournal%5D)">DNA Damage: From threat to treatment.</a> Cells. 9 (7), 1665(2020).</li>
<li>Li, X., Heyer, W. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Homologous+recombination+in+DNA+repair+and+DNA+damage+tolerance%5BTitle%5D)+AND+%22Cell+Res%22%5BJournal%5D)">Homologous recombination in DNA repair and DNA damage tolerance.</a> Cell Res. 18 (1), 99-113 (2008).</li>
<li>Chang, H., Pannunzio, N. R., Adachi, N., Lieber, M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Non-homologous+DNA+end+joining+and+alternative+pathways+to+double-strand+break+repair%5BTitle%5D)+AND+%22Nat+Rev+Mol+Cell+Biol%22%5BJournal%5D)">Non-homologous DNA end joining and alternative pathways to double-strand break repair.</a> Nat Rev Mol Cell Biol. 18 (8), 495-506 (2017).</li>
<li>Andratschke, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((European+society+for+radiotherapy+and+oncology+and+European+organization+for+research+and+treatment+of+cancer+consensus+on+re-irradiation%3A+Definition%2C+reporting%2C+and+clinical+decision+making%5BTitle%5D)+AND+%22Lancet+Oncol%22%5BJournal%5D)">European society for radiotherapy and oncology and European organization for research and treatment of cancer consensus on re-irradiation: Definition, reporting, and clinical decision making.</a> Lancet Oncol. 23 (10), e469-e478 (2022).</li>
<li>Olivares-Urbano, M. A., Grinan-Lison, C., Marchal, J. A., Nunez, M. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((CSC+radioresistance%3A+A+therapeutic+challenge+to+improve+radiotherapy+effectiveness+in+cancer%5BTitle%5D)+AND+%22Cells%22%5BJournal%5D)">CSC radioresistance: A therapeutic challenge to improve radiotherapy effectiveness in cancer.</a> Cells. 9 (7), 1651(2020).</li>
<li>Schaue, D., McBride, W. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Opportunities+and+challenges+of+radiotherapy+for+treating+cancer%5BTitle%5D)+AND+%22Nat+Rev+Clin+Oncol%22%5BJournal%5D)">Opportunities and challenges of radiotherapy for treating cancer.</a> Nat Rev Clin Oncol. 12 (9), 527-540 (2015).</li>
<li>Allen, C., Her, S., Jaffray, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Radiotherapy+for+cancer%3A+Present+and+future%5BTitle%5D)+AND+%22Adv+Drug+Deliv+Rev%22%5BJournal%5D)">Radiotherapy for cancer: Present and future.</a> Adv Drug Deliv Rev. 109, 1-2 (2017).</li>
<li>Xue, C., Greene, E. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((DNA+repair+pathway+choices+in+CRISPR-Cas9-Mediated+genome+editing%5BTitle%5D)+AND+%22Trends+Genet%22%5BJournal%5D)">DNA repair pathway choices in CRISPR-Cas9-Mediated genome editing.</a> Trends Genet. 37 (7), 639-656 (2021).</li>
<li>Tzelepis, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+CRISPR+dropout+screen+identifies+genetic+vulnerabilities+and+therapeutic+targets+in+acute+myeloid+leukemia%5BTitle%5D)+AND+%22Cell+Rep%22%5BJournal%5D)">A CRISPR dropout screen identifies genetic vulnerabilities and therapeutic targets in acute myeloid leukemia.</a> Cell Rep. 17 (4), 1193-1205 (2016).</li>
<li>Rottner, A. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+genome-wide+CRISPR+screen+identifies+CALCOCO2+as+a+regulator+of+beta+cell+function+influencing+type+2+diabetes+risk%5BTitle%5D)+AND+%22Nat+Genet%22%5BJournal%5D)">A genome-wide CRISPR screen identifies CALCOCO2 as a regulator of beta cell function influencing type 2 diabetes risk.</a> Nat Genet. 55 (1), 54-65 (2023).</li>
<li>Chen, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((CRISPR-Cas9+for+cancer+therapy%3A+Opportunities+and+challenges%5BTitle%5D)+AND+%22Cancer+Lett%22%5BJournal%5D)">CRISPR-Cas9 for cancer therapy: Opportunities and challenges.</a> Cancer Lett. 447, 48-55 (2019).</li>
<li>Gupta, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((CRISPR-Cas9+system%3A+A+new-fangled+dawn+in+gene+editing%5BTitle%5D)+AND+%22Life+Sci%22%5BJournal%5D)">CRISPR-Cas9 system: A new-fangled dawn in gene editing.</a> Life Sci. 232, 116636(2019).</li>
<li>Li, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Genome-wide+CRISPR+screen+identifies+host+dependency+factors+for+influenza+A+virus+infection%5BTitle%5D)+AND+%22Nat+Commun%22%5BJournal%5D)">Genome-wide CRISPR screen identifies host dependency factors for influenza A virus infection.</a> Nat Commun. 11 (1), 164(2020).</li>
<li>Hung, K. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Targeted+profiling+of+human+extrachromosomal+DNA+by+CRISPR-CATCH%5BTitle%5D)+AND+%22Nat+Genet%22%5BJournal%5D)">Targeted profiling of human extrachromosomal DNA by CRISPR-CATCH.</a> Nat Genet. 54 (11), 1746-1754 (2022).</li>
<li>Bhattacharya, D., Van Meir, E. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+simple+genotyping+method+to+detect+small+CRISPR-Cas9+induced+indels+by+agarose+gel+electrophoresis%5BTitle%5D)+AND+%22Sci+Rep%22%5BJournal%5D)">A simple genotyping method to detect small CRISPR-Cas9 induced indels by agarose gel electrophoresis.</a> Sci Rep. 9 (1), 4437(2019).</li>
<li>Razavi, Z., Soltani, M., Souri, M., Van Wijnen, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((CRISPR+innovations+in+tissue+engineering+and+gene+editing%5BTitle%5D)+AND+%22Life+Sci%22%5BJournal%5D)">CRISPR innovations in tissue engineering and gene editing.</a> Life Sci. 358, 123120(2024).</li>
<li>Wang, W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+genome-wide+CRISPR-based+screen+identifies+KAT7+as+a+driver+of+cellular+senescence%5BTitle%5D)+AND+%22Sci+Transl+Med%22%5BJournal%5D)">A genome-wide CRISPR-based screen identifies KAT7 as a driver of cellular senescence.</a> Sci Transl Med. 13 (575), eabd2655(2021).</li>
<li>Xu, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Engineered+miniature+CRISPR-Cas+system+for+mammalian+genome+regulation+and+editing%5BTitle%5D)+AND+%22Mol+Cell%22%5BJournal%5D)">Engineered miniature CRISPR-Cas system for mammalian genome regulation and editing.</a> Mol Cell. 81 (20), 4333-4345 (2021).</li>
<li>Huang, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((FACS-based+genome-wide+CRISPR+screens+define+key+regulators+of+DNA+damage+signaling+pathways%5BTitle%5D)+AND+%22Mol+Cell%22%5BJournal%5D)">FACS-based genome-wide CRISPR screens define key regulators of DNA damage signaling pathways.</a> Mol Cell. 83 (15), 2810-2828 (2023).</li>
<li>Feng, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Genome-wide+CRISPR+screen+identifies+synthetic+lethality+between+DOCK1+inhibition+and+metformin+in+liver+cancer%5BTitle%5D)+AND+%22Protein+Cell%22%5BJournal%5D)">Genome-wide CRISPR screen identifies synthetic lethality between DOCK1 inhibition and metformin in liver cancer.</a> Protein Cell. 13 (11), 825-841 (2022).</li>
<li>Saurat, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Genome-wide+CRISPR+screen+identifies+neddylation+as+a+regulator+of+neuronal+aging+and+AD+neurodegeneration%5BTitle%5D)+AND+%22Cell+Stem+Cell%22%5BJournal%5D)">Genome-wide CRISPR screen identifies neddylation as a regulator of neuronal aging and AD neurodegeneration.</a> Cell Stem Cell. 31 (8), 1162-1174 (2024).</li>
<li>Du, Y., Liu, Y., Hu, J., Peng, X., Liu, Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((CRISPR%2FCas9+systems%3A+Delivery+technologies+and+biomedical+applications%5BTitle%5D)+AND+%22Asian+J+Pharm+Sci%22%5BJournal%5D)">CRISPR/Cas9 systems: Delivery technologies and biomedical applications.</a> Asian J Pharm Sci. 18 (6), 100854(2023).</li>
<li>Shi, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+genome-wide+CRISPR+screen+identifies+WDFY3+as+a+regulator+of+macrophage+efferocytosis%5BTitle%5D)+AND+%22Nat+Commun%22%5BJournal%5D)">A genome-wide CRISPR screen identifies WDFY3 as a regulator of macrophage efferocytosis.</a> Nat Commun. 13 (1), 7929(2022).</li>
<li>Liu, N., Olson, E. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((CRISPR+modeling+and+correction+of+cardiovascular+disease%5BTitle%5D)+AND+%22Circ+Res%22%5BJournal%5D)">CRISPR modeling and correction of cardiovascular disease.</a> Circ Res. 130, (2022).</li>
<li>Feng, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Genome-wide+CRISPR+screens+using+isogenic+cells+reveal+vulnerabilities+conferred+by+loss+of+tumor+suppressors%5BTitle%5D)+AND+%22Sci+Adv%22%5BJournal%5D)">Genome-wide CRISPR screens using isogenic cells reveal vulnerabilities conferred by loss of tumor suppressors.</a> Sci Adv. 8 (19), 6638(2022).</li>
<li>Ghaemi, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((CRISPR-Cas9+genome+editing+delivery+systems+for+targeted+cancer+therapy%5BTitle%5D)+AND+%22Life+Sci%22%5BJournal%5D)">CRISPR-Cas9 genome editing delivery systems for targeted cancer therapy.</a> Life Sci. 267, 118969(2021).</li>
<li>Derry, W. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((CRISPR%3A+Development+of+a+technology+and+its+applications%5BTitle%5D)+AND+%22FEBS+J%22%5BJournal%5D)">CRISPR: Development of a technology and its applications.</a> FEBS J. 288 (2), 358-359 (2021).</li>
<li>Sharma, G., Sharma, A. R., Bhattacharya, M., Lee, S. S., Chakraborty, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((CRISPR-Cas9%3A+A+preclinical+and+clinical+perspective+for+the+treatment+of+human+diseases%5BTitle%5D)+AND+%22Mol+Ther%22%5BJournal%5D)">CRISPR-Cas9: A preclinical and clinical perspective for the treatment of human diseases.</a> Mol Ther. 29 (2), 571-586 (2021).</li>
</ol>

<table><tbody><tr><td>Boîte de culture cellulaire et tissulaire de 150 mm</td><td>Wuxi NEST Biotechnology Co., Ltd.</td><td>715011</td><td>Boîte</td></tr><tr><td>de culture cellulaire 35 mm</td><td>Wuxi NEST Biotechnology Co., Ltd.</td><td>706011</td><td>Culture cellulaire</td></tr><tr><td>A549 lignée cellulaire</td><td>ATCC-</td><td></td><td>-</td></tr><tr><td>Kit de comptage cellulaire-8</td><td>Shanghai Beyotime Biotech Inc</td><td>C0041</td><td>Pour le test de viabilité cellulaire</td></tr><tr><td>CO2-indépendant PHCbi</td><td></td><td>MCO-50AIC</td><td>Culture cellulaire</td></tr><tr><td>Countess 3 FL compteur de cellules automatisé</td><td>Themo Scientific</td><td>AMQAF2001</td><td>Pour le comptage cellulaire</td></tr><tr><td>EDTA</td><td>Gibco</td><td>25200056</td><td>Culture cellulaire</td></tr><tr><td>Sérum fœtal bovin</td><td>Gibco</td><td>10099141</td><td>Culture cellulaire</td></tr><tr><td>Microscopie à fluorescence</td><td>LEICA</td><td>ebq 100-04</td><td>Pour microscope à fluorescence</td></tr><tr><td>Bibliothèque lentivirale CRISPR à l’échelle du génome</td><td>Shanghai OBiO Technology Co., Ltd.</td><td>H5070</td><td>Pour l’infection lentivirale</td></tr><tr><td>MiniAmp plus PCR</td><td>Themo Scientific</td><td>C37835</td><td>Pour l’amplification PCR</td></tr><tr><td>Plaques de culture cellulaire NEST, 12 puits</td><td>Wuxi NEST Biotechnology Co., Ltd.</td><td>712002</td><td>Plaques</td></tr> de <tr><td>culture cellulaire NEST, 6 puits</td><td>Wuxi NEST Biotechnology Co., Ltd.</td><td>703002</td><td>Plaques</td></tr> de <tr><td>culture cellulaire NEST, 96 puits</td><td>Wuxi NEST Biotechnology Co., Ltd.</td><td>701001</td><td>Culture cellulaire</td></tr><tr><td>PBS</td><td>Gibco</td><td>C10010500BT</td> Amorce directe PCR <td>de culture cellulaire</td></tr><tr><td>(AATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCG)</td><td>Beijing AuGCT Biotech Co., Ltd.</td><td>-</td><td>Pour l’amplification PCR</td></tr><tr><td>PCR reverse primer (GATGTGCGCTCTGCCCACTGACGGGCA)</td><td>Beijing AuGCT Biotech Co., Ltd.</td><td>-</td><td>Pour l’amplification PCR</td></tr><tr><td>Polybrene</td><td>Shanghai Beyotime Biotech Inc</td><td>C0351</td><td>Pour l’infection lentivirale</td></tr><tr><td>Puromycine</td><td>MCE</td><td>HY-K1057</td><td>Pour la sélection post-infection lentivirale</td></tr><tr><td>RPMI 1640 milieu de culture cellulaire Gibco</td><td></td><td>23400-021</td><td>Culture cellulaire</td></tr><tr><td>TIANGENamp kit d’ADN génomique</td><td>Beijing TIANGEN Biotech Co., Ltd.</td><td>DP304</td><td>Pour l’extraction d’ADN génomique</td></tr><tr><td>Diffractomètre à poudre à rayons X</td><td>PerkinElmer</td><td></td><td>Pour la radiothérapie</td></tr></tbody></table>

Écran crispr à l’échelle du génome pour dévoiler les gènes radiosensibles et radiorésistants

Genome-Wide CRISPR Screen for Unveiling Radiosensitive and Radioresistant Genes

Le cancer du poumon, avec le taux de mortalité le plus élevé, représente une maladie médicale très agressive et répandue. En utilisant la lignée cellulaire du cancer du poumon A549 comme exemple pour réaliser un dépistage CRISPR à l’échelle du génome avec le rayonnement comme condition de dépistage, le flux de travail schématique est illustré à la figure 1. Tout d’abord, explorez la sensibilité des cellules A549 à différentes doses de rayonnement par la formation de clones et les expériences...

Écran CRISPR à l’échelle du génome pour dévoiler les gènes radiosensibles et radiorésistants

The CRISPR-Cas9 system has been harnessed and repurposed into a powerful genome editing tool. By leveraging this technology, researchers can precisely ...

genome-wide-crispr-screen-for-unveiling-radiosensitive-radioresistant

Research

Recherche

JoVE Journal

Cancer Research

Recherche sur le cancer

Cette vidéo décrit une méthode de criblage pour identifier les mouches Drosophila transgéniques, dont le génome a été modifié à l’aide de CRISPR-Cas9. CRISPR-Cas9 est un puissant outil d'édition du génome qui a révolutionné la façon dont les scientifiques peuvent manipuler le génome d'un organisme. Dans l’exemple de protocole, nous verrons comment identifier les mutants générés par CRISPR, dans lesquels l’insertion d’une séquence de transactivation remplace le premier exon du gène sans branche...

Dépistage des modifications génomiques : une méthode pour identifier les mutants générés par CRISPR chez la drosophile

La technique de génotypage décrit ici, qui couple de réaction en chaîne par polymérase fluorescente (PCR) à une électrophorèse sur gel capillaire, permet de génotypage à haut débit des clones knock-out à médiation par nuclease. Il évite les limitations rencontrées par d'autres techniques de génotypage et est plus rentable que les méthodes de séquençage.

L&#39;utilisation d&#39;un PCR-capillaire fluorescent Gel Electrophoresis Technique pour Génotype CRISPR / cas9 médiation Knockout Mutants dans un format à haut débit

Les progrès récents dans la capacité de manipuler génétiquement les lignées cellulaires somatiques offrent un grand potentiel pour la recherche fondamentale et appliquée. Ici, nous présentons deux approches pour la production et le dépistage de knock-out créés par CRISPR / Cas9 dans des lignées cellulaires de mammifères, avec et sans utilisation de marqueurs sélectionnables.

Génération indépendante et dépendante de la sélection de CRISPR / Cas9-Meded Knockouts dans les cellules de mammifères

Une bibliothèque CRISPR/sgRNA a été appliquée à interroger des gènes codant pour des protéines. Toutefois, la faisabilité d’une bibliothèque de sgRNA afin de découvrir la fonction d’une limite de la FCCT dans la régulation des gènes reste inexplorée. Nous décrivons ici une bibliothèque de sgRNA spécifiques de locus HOX afin d’élucider la fonction des limites de la FCCT dans loci HOX .

HOX Locus Focused CRISPR/sgRNA bibliothèque préalable identifier critique FCCT limites

La technologie CRISPR-Cas9 fournit une méthode efficace pour modifier précisément le génome des mammifères dans n'importe quel type de cellule et représente un nouveau moyen d'effectuer des écrans génétiques à l'échelle du génome. Un protocole détaillé discutant des étapes requises pour la réussite des écrans CRISPR-Cas9 à l'échelle du génome sont fournis ici.

Écrans génétiques crispR-basés en commun dans les cellules de mammifères

Ce manuscrit décrit une approche de dépistage à l’échelle du génome basée sur les cellules pour identifier les interactions extracellulaires de récepteur-ligand.

Identification des récepteurs de surface cellulaire à l’aide d’écrans génétiques CRISPR/Cas9 à l’échelle du génome

Ici nous décrivons une méthodologie rapide et directe de criblage d’in vivo CRISPR/Cas9 utilisant des injections lentiviral embryonnaires ultrason-guidées dans utero pour évaluer simultanément des fonctions de plusieurs gènes dans la peau et la cavité buccale des souris immunocompétentes.

Dépistage in Vivo CRISPR/Cas9 pour évaluer simultanément la fonction génétique dans la peau de la souris et la cavité buccale

Un obstacle important aux technologies comme CRISPR est les événements hors cible qui peuvent perturber les gènes vitaux. La « circularisation pour la notification in vitro des effets de clivage par séquençage » (CIRCLE-seq) est une technique conçue pour identifier les sites de clivage non intentionnels. Cette méthode cartographie l’activité à l’échelle du génome de CRISPR-Cas9 avec une sensibilité élevée et sans biais.

CIRCLE-Seq pour l’interrogation de l’édition de gènes hors cible

L’article décrit un protocole pour l’application d’un modèle in vitro d’épuisement afin de réaliser un dépistage CRISPR knock-out à l’échelle du génome dans des cellules T à récepteur antigénique chimérique de donneur sain.

Réalisation d’un criblage CRISPR in vitro à l’échelle du génome dans des cellules T à récepteur d’antigène chimérique

Ici, nous présentons un protocole qui intègre la technologie CRISPR/Cas9 avec le test Cell Counting Kit-8 (CCK-8) pour identifier les gènes candidats qui sont cruciaux pour la capacité de prolifération anormale des cellules souches hématopoïétiques et progénitrices.

Évaluation de gènes anormaux liés à la croissance de cellules souches et progénitrices hématopoïétiques en combinant la technologie CRISPR/Cas9 avec le comptage cellulaire

Découvrez le criblage CRISPR à l'échelle du génome pour identifier les gènes radiosensibles et radiorésistants dans les cellules de cancer du poumon. Cette méthode précise améliore la recherche génomique fonctionnelle.

Écran CRISPR à l’échelle du génome pour dévoiler les gènes radiosensibles et radiorésistants

Explorer plus de vidéos