הרשמה ל-JoVE נדרשת לצפייה בתוכן זה. התחברו או התחילו בגרסת ניסיון בחינם.

מאמר שיטה

Multiplex assay PCR ?????? ?? ???? Mec ???????? ???? Staphylococcal I ?V ?-methicillin

11.7K צפיות

⸱

DOI:

10.3791/50779

⸱

5 בספטמבר 2013

במאמר זה

הודעת תיקון

Important: There has been an erratum issued for this article. View Erratum Notice

סיכום

אנו מדגימים בדיקת PCR מולטיפלקס פשוטה לסינון והקלדה מהירים של כרומוזום קלטת סטפילוקוקלית (SCCmec) סוגים I-V עבור סטפילוקוקוס זהוב עמיד למתיצילין, ומספקים כמה מהשלבים החיוניים והניואנסים הפרוצדורליים שהופכים אותה למוצלחת בהתאמת בדיקה זו למעבדות בודדות.

תקציר

Staphylococcal ???? ???????? MEC (SCC MEC) ????? ??? ??? ???????? ???? ???? ????? ???????? ?? ????????????? ??????? ?? ??????????? Methicillin ???? (MRSA), ?????? ?? ?????????? ???????? ?? ????? ??????? MRSA (CA-MRSA) ?????? ?? ???? ????? ?????. ??????? ????? PCR ???????? ????? SCC MEC ?? ??? ????? ?????? MEC ???? ?????? ??????? CCR ????, ??? ?????? ????? ???? ??? ?????? ???????? PCR ?????? ??????. ?????? ??????? assay PCR ????? ???? ?????? ????? ?? ????? ??? ??? ???? V MEC SCC ??????, ????? ??? ????? ???? ????? ??? ??? ??? ????. assay ???? ?? ????? ???? MEC SCC ?????? ?????? ???, ?? ???? ???? ???? ????? ???? ????? ?????. ?? ???, ??? ?? ??????????? ?? assay ????? ?? ?? ???????? ??????? ??????, ?? ???????? ??????, ??? ????? assay ?? ??????? ??????. ??? ???? ?? ?????? ?? ???? assay MRSA SCC MEC, ??? ??? ??????? ???? ?????? ?? assay PCR ?????, ????? ???? ?????? ???????? ????????? ??????????? ?? ???? ?? ?? ??????.

מבוא

??????????? Methicillin ???? (MRSA) ??? ??????? ???? ????? ??? ????? ???? 21-67-KB ????, ???? ???? ???????? MEC staphylococcal (SCC MEC) ????? ?? ??????? methicillin (MECA) ??????? ???? ?????? ???????????? ????? 1 . SCC MEC ??????? ?? ??? ??????? ?? ????? ???? ?????? ???????, ??? ??????? ?????? ??????? (???? ??? MEC ??????? ?? CCR), ??? J-?????? (???? 1). ???? ?? MEC ????? ?IS 431mec, Meca, ????? ????? ?? ??????? ?? ??? ?????????, mecR1 ?mecI, ????? ???? ?? CCR ????? ?? recombinases (CCR / ccrAB) ??? ????? ????????? ?? SCC MEC ??????? ??? ? ???????? ???? 1. ??????? ??? ??? ??????? MEC ???? (mecB ?MECC) ?????, ????? ????? ???????? ???? Meca ??? 2. ??? ????? MEC SCC ????? ?????? J (J1, J2, J3 ?) ??????? ??? ?????? ?????? CCR MEC ??????? ???? ?? ?????? ?????. ???? ???? ????? ?? MEC ????? (???? A, B, C, D ?-E) ?allotypes ?? CCR ????? (???? 1-8) ??????. ??????? ????? ?? ??????? ???????? ??? ?allotypes ????? ???? MEC SCC ?????. ?? ?? ??????? ?? SCC MEC ????? ?????? ?? ??? ????? ?????? ?????????? ?????? ?? ?????? ???????? ???? Staphylococcal (IWG-SCC), ?????? MEC SCC ??????? ?????? ???????? ?? ???? ?? MEC ?????? ???? CCR, ??? ????? ???? ???? ?? ?? ?????? ????? J 1-DNA. MRSA??????? ??????? ???? ??? ?? ??? ????? ?? ???? ????? MEC SCC ?????? ?? ????? ?? ??? (?? / ????) ????? ???????? ?? ??? ?????, ???? ????? multilocus ??? (ST) ? / ?? ????? staphylococcal ?? (???) ????? (???? ST8 -T008-MRSA-IVA). ???, SCC MEC ????? ??? ??? ???????? ???? ???? ????? ????????????? ?????? ?? ????? ?? MRSA, ?????? ?? ?????????? ???????? ?? ????? ??????? MRSA (CA-MRSA) ?????? ?? ???? ????? ?????.

??????? ????? PCR ???????? ????? SCC MEC ?? ??? ????? ?????? MEC ???? ?????? ??????? CCR ????, ??? ?????? ????? ???? (20 ?? 30) ??? ?????? ???????? PCR ?????? ??????. Okuma et al., ????, ????? 21 ???????? ??????? ???? ?? PCR ???? ??? ?????? SCC-MEC ??? IVb 3. ????? et al. Subse?????? ??? ????? assay ??? ???? ?????? ?? CCR, MEC, ??????? ?????? ?J-???????, ??? ?? ?? ???? ???? ?? ?? ???????? ??????? PCR ???? 4. ??? ???? ????? MEC SCC, ????? PCR (M-PCR) ????? ?????? ??????? ?????? ????? ????? ?????? PCR ???. ?? Lencastre ??????? ????? M-PCR ?????? ????? ?? SCC MEC I-IV, ?????? ???? ??? ?SCC MEC ??????, ?? M-PCR ???? ?????? ?? SCC MEC IV 5,6,7. ?? ???, ????? ???? ?? ???? ???? ????, ?????? 2 ?????? ??? ????? ?? SCC MEC IV, ?????? ???? ?? ??? typeable. ??????? ???? ?? ????? MEC SCC, ?????? ?????? assay PCR ????? ???? ?????? ????? ?? ????? ??? ??? ???? V 8 MEC SCC ??????, ????? ??? ????? ???? ????? ? ??? ???ecame ???? 9. assay ???? ?? ????? ???? MEC SCC ?????? ?????? ???, ?? ???? ???? ?????? ????? ????? ?????? (337 ??????; ?????? 30 ????? 2013). ??? ?????? ??????, ?????? ????? ???? ????? ??????? ?????? assay ?? ???? ?????? MEC ???? ??? MRSA SCC ????. ??? ????? ??????? ?? assay ????? ?? ?? ???????? ??????? ??????, ?? ???????? ??????, ??? ????? assay ?? ??????? ??????. ??? ???? ?? ?????? ?? ???? assay MRSA SCC MEC, ????? ?????? ??? ?????? ???? ?????? ?? M-PCR ???? ?SCC MEC ?????, ??? ?? ???? ???? ?????? ???????? ????????? ??????????? ??????? ???? ????????.

הגישה מוגבלת. התחברו או התחילו תקופת ניסיון כדי לצפות בתוכן זה.

פרוטוקול

????? ??? ?????? ?????? ?????? ?????? ?????? ???????? ???? 2. ???? ??? ???? ????? ???? ????? ?????? ????? ?? ???????? ??? ???.

1. ?????? ????

  1. ??????? ???? ???? ????? ?? MRSA ??????. ???? ????? ?-PCR ??? ????? ?????, ??? ????? ??? ?? MRSA ?? ??? ????? ?????? ?????? ?? ??? ?? ???????? ?? ??? (TSA) ???? ???? tryptic. ?????? ????? ???????? ??????? ???? ?? ???? ???. ????? ????? ???? 37

הגישה מוגבלת. התחברו או התחילו תקופת ניסיון כדי לצפות בתוכן זה.

תוצאות

שיטה זו המעודכנת של M-PCR מסוגלת לקבוע (לסווג) את סוגי SCCmec I-V, כמו כן תת-סוגים עיקריים של SCCmec IV. הבדיקה מתמקדת באתרים ייחודיים וספציפיים של SCCmec I, II, III, IVa, IVb, IVc, IVd, IVE ו-V, עם זיהוי נלווה של הגן mecA. זיהוי ראשוני של SCCmec VI ו-VIII הוא אפשרי גם כן, אך ידרוש בדיקות נוספות לאישור. איור 3 מדגים SCCmec I-VI ו-VIII מייצגים ואת מיקומם של כל יעד בתוך האלמנט.

הפריימרים הספציפיים לסוג I (אדום) פוגעים ב-orf E...

הגישה מוגבלת. התחברו או התחילו תקופת ניסיון כדי לצפות בתוכן זה.

דיון

בדיקת ה-PCR המולטיפלקס המתוארת כאן מספקת שיטה פשוטה ואמינה לסיווג סוגים ותת-סוגים עיקריים של SCCmec IV בסטפילוקוקים, עם אפליה בו זמנית של MRSA מ-MSSA. הבדיקה חזקה, נעשית בנוחות בתגובת PCR אחת והתוצאות קלות לפירוש. לבדיקה יש מגבלות בכך שהיא מכוונת למיקומים בודדים בתוך כל סוג SCCmec , אך אינה מציעה הקלדה מורכבת מקיפה של ccr ו-mec , ולכן אינה יכולה להיחשב כתקן זהב. בלי קשר, אימות נרחב של הפרוטוקול הוכיח שהוא נותר כלי מולקולרי רב ערך למחקרים מדעיים ואפידמיולוגיים על MRSA.

הגישה מוגבלת. התחברו או התחילו תקופת ניסיון כדי לצפות בתוכן זה.

גילויים

לא הוכרז על ניגוד עניינים.

תודות

אנו מודים ל-T. Ito, K. Hiramatsu, R. Daum, H. de Lencastre ו-D. Coleman על המתנה האדיבה של כמה זני ייחוס ששימשו במחקר זה. עבודה זו נתמכה בחלקה כספית על ידי המרכז לעמידות אנטי-מיקרוביאלית (CAR), שירותי הבריאות של אלברטה-קלגרי/שירותי מעבדה של קלגרי/אוניברסיטת קלגרי.

הגישה מוגבלת. התחברו או התחילו תקופת ניסיון כדי לצפות בתוכן זה.

חומרים

אגר
רשימת החומרים שנעשה בהם שימוש במאמר זה
שםחברהמספר קטלוגהערות
סויה טריפטיפישר (BD)CA90002-700 (236920)
מים מזוקקים סטרילייםLife Technologies10977-015
Platinum Taq: כולל 10x מאגר PCR ו-50 מ"מ MgCl2Life Technologies10966-034
100 mM dNTPLife Technologies10297-018
Tris baseSigma-AldrichT6066
חומצה בוריתסיגמא-אולדריץ'B7901
EDTALife Technologies15576-028
AgaroseLife Technologies16500-500
GlycerolLife Technologies15514-011
ברומופנול כחולסיגמא-אולדריץ'B8026
1Kb+ חיי סולם DNA טכנולוגיות10787-026
אתידיום ברומידסיגמא-אולדריץ'E7637
צינורות מיקרוצנטריפוגה 1.5 מ"ל VWR (Axygen Scientific)10011-700
מקלות תרביתVWRCA10805-018
צינורות PCRקוטרAD0210-FCN (חדש #: DIATEC420-1250)
צנטריפוגהאפנדורף5417c
בלוק חוםVWR13259-030 / 13259-286
ThermalcyclerApplied Biosystems (2720)4359659
תא אלקטרופורזה ג'ל אופקי וצולל עם תבנית ג'לBioRad170-4469
ספק כוחBioRad164-5050
שייקר נדנדהVWR40000-300
מולקולרי מערכת Imager Gel DocBioRad1708170

מקורות

  1. IWG-SCC. Classification of staphylococcal cassette chromosome mec (SCCmec): guidelines for reporting novel SCCmec elements. Antimicrobial Agents and Chemotherapy. 53 (12), 4961-4967 (2009).
  2. Ito, T., Hiramatsu, K., Tomasz, A., de Lencastre, H., Perreten, V., Holden, M., et al. Guidelines for Reporting Novel mecA Gene Homologues. Antimicrobial Agents and Chemotherapy. 56 (10), 4997-4999 (2012).
  3. Okuma, K., Iwakawa, K., Turnidge, J. D., Grubb, W. B., Bell, J. M., O'Brien, F. G., et al. Dissemination of new methicillin-resistant Staphylococcus aureus clones in the community. Journal of Clinical Microbiology. 40 (11), 4289-4294 (2002).
  4. Kondo, Y., Ito, T., Ma, X. X., Watanabe, S., Kreiswirth, B. N., Etienne, J., et al. Combination of multiplex PCRs for staphylococcal cassette chromosome mec type assignment: rapid identification system for mec, ccr, and major differences in junkyard regions. Antimicrobial Agents and Chemotherapy. 51 (1), 264-274 (2007).
  5. Oliveira, D. C., de Lencastre, H. Multiplex PCR strategy for rapid identification of structural types and variants of the mec element in methicillin-resistant Staphylococcus aureus. Antimicrobial Agents and Chemotherapy. 46 (7), 2155-2161 (2002).
  6. Milheirico, C., Oliveira, D. C., de Lencastre, H. Update to the multiplex PCR strategy for assignment of mec element types in Staphylococcus aureus. Antimicrobial Agents and Chemotherapy. 51 (9), 3374-3377 (2007).
  7. Milheirico, C., Oliveira, D. C., de Lencastre, H. Multiplex PCR strategy for subtyping the staphylococcal cassette chromosome mec type IV in methicillin-resistant Staphylococcus aureus: 'SCCmec IV multiplex'. Journal of Antimicrobial Chemotherapy. 60 (1), 42-48 (2007).
  8. Zhang, K., McClure, J. A., Elsayed, S., Louie, T., Conly, J. M. Novel multiplex PCR assay for characterization and concomitant subtyping of staphylococcal cassette chromosome mec types I to V in methicillin-resistant Staphylococcus aureus. Journal of Clinical Microbiology. 43 (10), 5026-5033 (2005).
  9. Zhang, K., McClure, J. A., Conly, J. M. Enhanced multiplex PCR assay for typing of staphylococcal cassette chromosome mec types I to V in methicillin-resistant Staphylococcus aureus. Molecular and Cellular Probes. 26 (5), 218-221 (2012).
  10. de Lamballerie, X., Zandotti, C., Vignoli, C., Bollet, C., de Micco, P. A one-step microbial DNA extraction method using "Chelex 100" suitable for gene amplification. Research in Microbiology. 143 (8), 785-790 (1992).
  11. Lee, P. Y., Costumbrado, J., Hsu, C. Y., Kim, Y. H. Agarose gel electrophoresis for the separation of DNA fragments. J. Vis. Exp. (62), e3923(2012).
  12. McClure, J. A., Conly, J. M., Elsayed, S., Zhang, K. Multiplex PCR assay to facilitate identification of the recently described Staphylococcal cassette chromosome mec type VIII. Molecular and Cellular Probes. 24 (4), 229-232 (2010).
  13. Zhang, K., McClure, J. A., Elsayed, S., Conly, J. M. Novel staphylococcal cassette chromosome mec type, tentatively designated type VIII, harboring class A mec and type 4 ccr gene complexes in a Canadian epidemic strain of methicillin-resistant Staphylococcus aureus. Antimicrobial Agents and Chemotherapy. 53 (2), 531-540 (2009).

הגישה מוגבלת. התחברו או התחילו תקופת ניסיון כדי לצפות בתוכן זה.

הדפסות חוזרות והרשאות

תיקון


Formal Correction: Erratum: Multiplex PCR Assay for Typing of Staphylococcal Cassette Chromosome Mec Types I to V in Methicillin-resistant Staphylococcus aureus
Posted by JoVE Editors on 3/19/2019. Citeable Link.

An erratum was issued for: Multiplex PCR Assay for Typing of Staphylococcal Cassette Chromosome Mec Types I to V in Methicillin-resistant Staphylococcus aureus.  There was a typo in Table 1.

In Table 1, the Oligonucleotide sequence for Type III-F5 was updated from:

TTCTCATTGATGCTGAAGCC

To:

GAAACTAGTTATTTCCAACGG

תגיות

טיפוס SCCmecזיהוי MRSAמיצוי DNAאלקטרופורזה של ג'לתכנון פריימריםאופטימיזציה של PCRעמידות לאנטיביוטיקה