כתב היד הזה מתאר את משלוח יעיל, שאינו ויראלי של miR לתאי אנדותל ידי וקטור PEI / MNP ו המגנטיזציה שלהם. לכן, בנוסף שינוי גנטי, גישה זו מאפשרת להדרכת תא מגנטית ויכולת גילוי MRI. הטכניקה יכולה לשמש כדי לשפר את המאפיינים של מוצרי תא טיפוליים.
Access restricted. Please log in or start a trial to view this content.
Access restricted. Please log in or start a trial to view this content.
Access restricted. Please log in or start a trial to view this content.
Access restricted. Please log in or start a trial to view this content.
Access restricted. Please log in or start a trial to view this content.
| Name | Company | Catalog Number | Comments |
|---|---|---|---|
| PEI 25 kDa | Sigma Aldrich | 408727 | |
| EZ-Link Sulfo-NHS-LC-Biotin | Thermo Scientific | 21335 | |
| PD-10 עמודי התפלה | GE Healthcare | 17085101 | המכילים תמיסת ריאגנט נינהידרין בינונית Sephadex G-25 |
| 2% | סיגמא אולדריץ' | 7285 | |
| גליצין | סיגמא אולדריץ' | 410225 | |
| ערכת כימות ביוטין פירס | תרמו סיינטיפיק | 28005 | |
| קורא מיקרופלייט דגם 680 | Bio-Rad | ||
| Streptavidin MagneSphere חלקיקים פרמגנטיים | Promega | Z5481 | |
| Millex-HV PVDF מסנן | Merck | SLHV013SL 0.45 ומיקרו; m | |
| מאזניים 120 מיקרוסקופ אלקטרונים שידור | Zeiss | מתח תאוצה 120 גלאי | |
| רנטגן ספיר | EDAX-Amatek | ||
| תרבית תאים פלסטיק | TPP | ||
| NHS-אסתר אטו 565 | ATTO-TEC GmbH | AD 565-31 | |
| NHS-אסתר אטו 488 | ATTO-TEC GmbH | AD 488-31 | |
| Cy5 miRNA תווית ערכת IT | Mirus Bio | MIR 9650 | |
| ביוטין אטו 565 | ATTO-TEC GmbH | AD 565-71 | |
| קולגן מסוג IV Gibco | Thermo Scientific | 17104019 | |
| מדיום גידול אנדותל, EGM-2 | Lonza | CC-3156 & CC-4176 | |
| פניצילין/סטרפטומיצין | תרמו סיינטיפיק | 15140122 | 100 יח'/מ"ל, 100 ומיקרו; g/mL |
| Matrigel | BD Biosciences | 356234 | |
| נוגדן נגד PECAM-1 | Santa Cruz | sc-1506 | |
| MS MACS עמודות | Miltenyi Biotec | 130-042-201 | |
| Near-IR Live/Dead Cell Stain Kit | Thermo Scientific | L10119 | |
| Cy3 Colour-Labeled Pre-miR Negative Control | Thermo Scientific | AM17120 | "Cy3-miR" או "Cyanine-miR3" בכתב היד |
| Pre-miR miRNA Precursor Molecules - Negative Control | Thermo Scientific | AM17110 | "scr-miR" בכתב היד |
| מעכב סינתטי Anti-has-miR92a-3p | Thermo Scientific | AM10916 | |
| LSM 780 ELYRA PS.1 מערכת | Zeiss | ||
| Paraformaldehyde | Sigma Aldrich | 158127 | תמיסה 4% בכתם |
| גרעיני PBS DAPI | Thermo Scientific | D1306 | |
| NucleoSpin ערכת בידוד RNA | Machery-Nagel | 740955 | |
| mirVana miRNA ערכת בידוד | Thermo Scientific | AM1560 | |
| TaqMan MicroRNA ערכת שעתוק הפוך | Thermo Scientific | 4366596 | |
| StepOnePlus מערכת PCR בזמן אמת Applied | Biosystems | ||
| ערכת שעתוק הפוך cDNA בקיבולת גבוהה | Thermo Scientific | 4368814 | |
| has-miR-92a TaqMan assay | Thermo Scientific | 000431 | רצף miRNA בוגר: UAUUGCACUUGUCCCGGCCUGU |
| FastGene Taq Ready Mix | Nippon Genetics | LS27 | |
| ITGA5 TaqMan assay | Thermo Scientific | Hs01547673_m1 | |
| RNU6B TaqMan Assay | Thermo Scientific | 001093 | |
| 18S rRNA Endogenous Control | Thermo Scientific | 4333760F | |
| ג'לטין | Sigma Aldrich | G7041 | |
| CellTrace Calcein אדום-כתום | תרמו מדעי | C34851 | |
| PBS | Pan Biotech | P04-53500 | |
| BSA | Sigma Aldrich | ||
| MACS buffer | Miltenyi Biotec | 130-091-221 | |
| Agarose | Sigma Aldrich | A9539 | |
| 7.1 מערכת MRI לבעלי חיים טסלה | Bruker Corporation | A7906 | |
| תוכנת ImageJ | המכונים הלאומיים לבריאות | שודרגה עם מכשיר AngiogenesisAnalyzer (NIH) | |
| MPS | תוכנת Bruker Biospin | ||
| Matlab | Mathworks | ||
| טבעת מגנט ניאודים | magnets4you GmbH | RM-10x04x05-G | ø 10 מ"מ; שימור הוא ~ 1.3 T, כפייה ו-ge; 955 kA/m |
| Click-iT EdU Alexa Fluor 647 ערכת הדמיה | Thermo Scientific | C10340 | |
| FluorSave Reagent | Merck | 345789 | |
| אמבט אולטרסאונד | בנדלין | אלקטרוני סוג: RK 100 SH |
Access restricted. Please log in or start a trial to view this content.
Request permission to reuse the text or figures of this JoVE article
Request Permission