Method Article

진드기의 RNA 간섭

DOI:

10.3791/2474

January 20th, 2011

In This Article

Summary

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

unfed 거려에 dsRNA의 주입에 의한 RNA 간섭 (RNAi)의 방법을 설명합니다. RNAi는 유전자 조작의 다른 방법의 사용이 제한되었습니다 진드기에서 가장 널리 사용되는 유전자 입을 기술입니다.

Abstract

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

진드기는 야생 국내 동물과 인간의 의무 hematophagous ectoparasites하고 있으며, 인간의 질병 1과 가장 중요한 벡터의 벡터는 가축 업계 세계 2에 영향을 미치는 것으로 모기의 두번째 세계로 간주됩니다. 진드기는 하위 클래스 Acari, 주문 Parasitiformes, 아목 Ixodida 분류하고 북극에서 열대 지역 3 전세계 배포됩니다. 틱 infestations을 제어하기위한 노력에도 불구하고, 이러한 ectoparasites는 4,5 인간과 동물의 건강에 심각한 문제가 남아 있습니다.

RNA 간섭 (RNAi) 6 신진 대사 경로에 유전자 기능 또는 효과를 결정하기 위해 유전자 발현의 중단과 관련된 핵산 기반 반대 유전자 접근 방식이다. 작은 방해 RNAS (siRNAs)는 dsRNA 트리거 7-9과 같은 순서를 포함하는 세포질 mRNAs의 강력한 일련의 특정 저하를 두 번 좌초 RNA (dsRNA)과 결과에 의해 시작되는 RNAi 경로의 효과기 분자 수 있습니다. dsRNA에 의해 시작 포스트 transcriptional 유전자 입을 메커니즘은 모든 eukaryotes에서 발견되었습니다 것은 지금까지 공부하고, RNAi는 급속하게 기능 게놈 연구와 다른 응용 프로그램 10 도구로 생물의 다양한 개발되었습니다.

RNAi는 유전자 조작에 대한 대체 방법을 사용할 수 없거나 신뢰할 수 5,11 아르 진드기 및 다른 유기체에서 가장 널리 사용되는 유전자 입을 기술되었다. 진드기의 유전적 특성은 RNAi 12,13의 최근 응용까지 제한되었습니다. RNAi를 사용할 것으로 짧은 시간에, 그것은 틱 유전자 기능을 연구를위한 유용한 도구로, 경마 병원체 인터페이스의 특성 및 심사와 진드기 항원 보호 14 특성 것으로 판명되었습니다. 여기에, unfed 거려에 dsRNA의 주입을 통해 RNAi에 대한 방법을 설명합니다. 그것은이 실험 방법에서 얻은 지식은 기본적인 생물 학적 시스템의 이해와 틱 infestations을 제어하고 체크 통한 병원균 15-19의 전송을 방지하기 위해 백신의 발전에 현저하게 기여할 가능성이 높습니다.

Protocol

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

1. dsRNA의 생성.

  1. dsRNA의 시험 관내 전사 및 합성 (예를 들어, Dermacentor에 대한 oligonucleotide primers subolesin에게 D8AAT75를 사용 variabilis에 대한 T7 프로 모터 시퀀스를 포함하는 oligonucleotide primers를 합성 :
    5' - TAATACGACTCACTATAGGGTACTGACTGGGATCCCCTGCACAGT - 3 '와 D8DVT73 : 5' - TAATACGACTCACTATAGGGTACTCGAGCTTGGTGGAAAGGACG - 3').
  2. RT - PCR은 각 oligonucleotide 뇌관과 틱 총 RNA 중 1-10 NG 10 pmol를 사용하여 대상 유전자를 증폭.
  3. PCR 제품을 정화.
  4. 정화 PCR 제품의 8 μL를 사용하여 dsRNA를 합성.
  5. 분석법에 의해 dsRNA를 계량.

2. dsRNA와 진드기의 사출.

2.1. 주사 진드기의 준비.

  1. 첫째, 50 ML 일회용 원심 분리기 튜브의 각 솔루션에서 그들을 흔들어 진드기를 유지하기 위해 튜브 톱을 통해 고급 메쉬 와이어 화면을 통해 솔루션을 decanting하여 솔루션의 일련의 진드기 씻으십시오. 세탁 진드기에 대한 솔루션의 순서는 수돗물, 3 % 과산화수소, 증류수, 70 % 에탄올과 증류수로 두 번 더 씻는다 두 씻는다입니다.
  2. 종이 타올에있는 진드기를 얼룩 건조.
  3. 실험에 따라, 20 50 그룹으로 진드기를 계산, 실험 그룹의 번호로 단단히 장착되어 뚜껑과 라벨을 가진 1.25 온스 플라스틱 컵의 각 그룹에서 진드기를 놓습니다.

2.2. 사출 팀 틱.

RNAi 팀은 세 사람으로 구성되어 있습니다 : (1) 붉은 치과 왁스의 시트에 부착된 이중 끈적끈적한 테이프의 각 체크를 위치 한 사람이, 후에 진드기를 모니터링 진드기 (3) 한 사람을 주사 (2) 한 사람 사출 그들을 활성화하는 진드기에 CO 2를 통기하여 실험 그룹의 번호로 표시 컵에 사는 진드기로 계산됩니다. 모든 팀 구성원은 일회용 장갑을 착용해야합니다.

2.3. 주사 진드기의 배치.

  1. 더몬트 미세 집게를 사용하여 체크를 캡처하여 붉은 치과 왁스의 3 "X 6"시트에 부착된 스티커를 두 번 테이프에 복부 쪽을 놓으십시오. 진드기는 밀접한 5 진드기의 그룹에서 함께 위치하고 있습니다.
  2. 모든 5 진드기의 mouthparts 더들을 구속하기 위해 이상의 마스킹 테이프의 작은 스트립을 플레이스하지만 사출 과정이 체크 주입기 (그림 1)에 의해 관찰 수 있도록 노출 신체의 대부분을 떠나있는 동안.

2.4. 진드기의 사출.

  1. 진드기는 외골격의 복부 표면의 오른쪽 하단 사분면에 주입됩니다.
  2. 첫째, 피어스 ½ ", 29 게이지 바늘 (그림 2A)가 장착되어 Monoject의 인슐린 주사기를 사용하여 외골격에 구멍.
  3. 45 ° beveled 포인트와 1 인치 33 게이지 바늘로 맞춤 제작 해밀턴 주사기를 사용하여 - (μL 당 5 X 10 11 분자 5 × 10 10) (그림 2B) dsRNA 솔루션의 0.2-0.5 μL 즉시 개나 주사 . 바늘은 dsRNA의 배치 및 유지를 확보하기 위해 틱 캐비티에 잘 배치해야합니다. 어떤 액체가 주입 사이트 (그림 2C)에서 탈출 가능성이 높습니다. 관리는 이상 hemolymph의 손실을 일으킬 것입니다 진드기를 주입하고 진드기의 죽음을 일으킬 수하지 않도록해야합니다.
  4. 각 실험 그룹의 주사를 완료한 후 해밀턴 주사기를 청소합니다. 또 다른 실험 그룹에 대한 사용하기 전에. 폐기물 컨테이너에 추방, 15 번 반복 후 3 % 과산화수소를 포함하는 비커에서 먼저 주사기를 작성합니다. 폐기물 컨테이너에 추방, 15 번 반복 후 멸균 물을 들어있는 비커에서 주사기를 작성합니다. 벤트 경우, 플런저가 원활하게 이동하고 진드기의 주입에 필요한 부드러운 터치에 응답하지 않습니다, 때문에 해밀턴 주사기의 플런저를 구부 않도록주의를 가져가라.

2.5. 주사 후 진드기의 치료.

  1. 좋은 포셉 즉시 더블 끈적끈적한 테이프에서 주입 체크를 들고 플라스틱 복구 컨테이너 (약 6 "X 6"과 진드기의 탈출을 방지하기 위해 마스킹 테이프와 함께 반지를 낀)에 놓으십시오. 진드기는 주사 후 간략하게 운영 중지 상태가됩니다하지만 곧 접시 주위에 크롤 링을 시작합니다.
  2. 입김을 즉시 진드기를 활성화에 도움이되는 복구 컨테이너에서 그들을 배치 후 진드기에 2 CO. 진드기가 크롤 링하고 활성화되면, 사출 상처가 빠르게 치유하고 그들이 가장 가능성이 살아남을 것입니다.
  3. 각 실험 그룹의 숫자에 따라 진드기를 카운트하고 단단하게 장착되어 뚜껑이있는 표시 플라스틱 컵에서 그들을 놓으십시오. 대체 진드기는 언제는 다음 실험 그룹을 주입하기 전에 죽었를 대체하는 주입해야합니다.

2.6. 개최 틱.

  1. 습도 챔버에있는 진드기 (12hr 밝은 장소 : 22-25 12 시간 어두운 photoperiod을 ° C 및 95 %의 상대 Humidity) 및 1 일 개최.
  2. 틱 수유 세포에 넣어 거려, 실험 그룹 당 하나는 양에 접착시키고 uninjected 남성 또는 여성 진드기 (주입 아니었 중에서 성별)의 동일한 번호와 피드 수 있습니다. 충만 피드 여성 진드기는 10 먹이의 일 때 제어 여성 후 양에서 제거됩니다 이들은 호스트 수집 무게 아르를 떨어뜨리고있다.
  3. 종이팩에 진드기를 삽입하고, 산란의 완성까지 습도 챔버하다. 가중치 그룹의 모든 진드기에 의해 생산되는 계란 질량에 의해 산란을 평가해보십시오.

2.7. RNAi 후 틱 표현형 분석.

  1. , 틱 중량, 산란 및 달걀 다산 살아남은 진드기의 수를 결정하여 수유 후 표현형 틱 평가. 그러나, 다른 분석은 연구의 대상 유전자와 목적에 따라 수행할 수 있습니다.

3. RT - PCR로 유전자 입을를 확인 분석.

  1. 수유 후 제어 주입 및 dsRNA - 주입 그룹에서 개별 진드기의 침샘과 배짱을 해부하다.
  2. 개별 조직 샘플에서 총 RNA를 추출합니다.
  3. 실시간 RT - PCR에 의해 개별 조직의 목표 유전자 성적표를 분석하고 틱 16에 대한 RNA 수준을 정상화는 genNorm 방법 (생물 래드 iQ5 일반용, 버전 2.0에 의해 구현으로 ddCT 방법)을 사용하여 rRNA.
  4. 한 amplicon이 형성되도록하는 반응의 끝에 그 해리 곡선을 실행하여 모든 시료에 대해 동일한 온도 범위에서 일관되게 amplicons의 변성.
  5. mRNA 수준 (표준 CT 값) 제어 주입 및 dsRNA - 주입 진드기는 학생`S T 테스트 (P는 = 0.05)를 사용하여 사이를 비교합니다.

4. 대표 결과 :

프로토콜은 여기에 (표 1) 다양한 ixodid 틱 수종에 RNAi을 위해 저희 실험실에서 사용되었습니다 설명했다. 진드기에 주입 dsRNA의 금액은 체크의 크기에 따라 다릅니다; 큰 틱 종 더 큰 볼륨을 수용할 수 있습니다. 부정적인 제어 진드기는 관련이없는 dsRNA로 주입해야합니다. 이러한 subolesin 14-19,22-25,27-32,34 및 베타 굴지 20,21 등 여러 dsRNAs는 긍정적인 컨트롤로 사용할 수 있습니다. 그것이 혼합 dsRNA 솔루션을 피하기 위해 트리 트먼트를 사이에 주사기를 씻어하는 것이 중요합니다. 프로토콜이 제대로되면 5 % 미만의 사망률은 24 시간 후 주사 절차에서 얻을 수 있습니다. 진드기의 유전자 최저 후 전형적인 표현형 보호하는 항원을 체크를 위해 화면을 위해 dsRNA의 수영장과 함께 주입 진드기의 패널​​로 그림 3에 표시됩니다.

종 틱 dsRNA는 주입 참조
Ixodes scapularis의 cDNA 도서관, subolesin, 굴지, nucleotidase, NF - KB, akirin 21, 22, 29, 30
Dermacentor variabilis subolesin, GST, ubiquitin, vATPase, selenoproteins M과 W2a, 조혈 줄기 / 전구 세포 굴지 Proteasome 26S subunit, ferritin1, varisin, akirin, 단백질과 같은 15, 19, 22, 24, 26, 30-32
Dermacentor marginatus subolesin 22
Amblyomma americanum cDNA 도서관, subolesin, akirin 17, 22, 30
Amblyomma hebraeum subolesin, voraxin 28
Rhipicephalus의 sanguineus Rs86, subolesin 22, 23
Rhipicephalus microplus GST, ubiquitin, selenoprotein, Bm86, Bm91, subolesin, GI, GIII, EF1a, flagelliform 실크 단백질, 폰 Willebrand
인자
16, 18, 25, 27
Rhipicephalus의 annulatus ubiquitin, subolesin, EF1a, GIII 16

표 1. RNAi 프로토콜이 사용되었습니다있는 수종으로 톡톡 두드려.

figure-protocol-1
그림 1. 빨간 치과 왁스의 시트을 준수 더블 스티커 테이프에 진드기의 배치, 최대 복부 측면. 진드기는 마스킹 테이프의 작은 스트립이 주입기는 주입 중에 진드기의 사체를 관찰 수 있도록하면서 추가로 진드기를 확보하기 위해 mouthparts 위에 배치되는 후, 5 그룹에 배치됩니다.

figure-protocol-2
그림 2. 분사 절차는 인슐린 싸이로 틱 외골격의 (A) 오른쪽 아래 사분면 피어싱을 포함ringe는 주사 사이트를 만들기 위해 29 게이지 바늘로 장착되어, (C) 대부분은 / 틱 hemolymph의 일부 누수가 발생합니다 33 게이지 바늘로 해밀턴 주사기를 사용하여이 사이트에서 dsRNA의 (B) 즉시 분사 유체.

figure-protocol-3
그림 3. RNAi가 Amblyomma americanum에서 진드기 항원에 대한 보호 화면으로 사용된있는 체크 여섯 그룹의 패널. 긍정적인 subolesin RNAi 제어 및 부정 무관한 dsRNA 제어와 비교하면 진드기의 phenotypic 변화를 볼 수 있습니다. 본 실험에서는 각 그룹의 틱 사망률, 무게, 그리고 산란에 대한 RNAi의 효과는 통계적으로 분석했다.

Discussion

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

다른 방법은 진드기 14 33 RNAi에 대해 설명하고 있지만, dsRNA의 주입은 가장 널리 unfed (표 1)과 먹이 진드기 16,25,34 모두에서 사용됩니다 여기에 설명되어 있습니다. RNAi는 틱 유전자 기능 연구, 경마 병원체 인터페이스의 특성 및 심사와 진드기 항원 보호 14,35의 특성화를위한 유용한 도구로 표시되었습니다. 특히, RNAi가 나 35 기능 분석을위한 가장 중요한 도구가되고 있습니다.

Methodologically, RNAi 가능성이 높습 개인의 다수의 유전자 최저를 허용할 수 있습니다보다 효율적인 방법으로 진화합니다. 진드기의 dsRNA 유도된 RNAi의 메커니즘은 더 나은 이해하고이 수종 35,36에서이 유전자 접근 방식의 활용에 기여하기 위해 정제해야합니다. 진드기의 RNAi의 오프 대상 효과의 정도도 충분히 14,27 연설을해야 할 중요한 질문이다. 마지막으로, RNAi는 대부분 틱 유전자 규정 및 시스템 생물학의 연구에 종합적인 기여를 제공하고 경마 병원체 인터페이스와 틱 infestations과 틱 통한 병원균의 전송을 제어하는​​ 백신의 개발에 영향을 미칠 수 있습니다.

Disclosures

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,
관심 없음 충돌 선언하지 않습니다.

Acknowledgements

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

우리는 결실 토론 및 기술 지원을위한 실험실의 구성원 감사합니다. 이 비디오 프레 젠 테이션은 연구 베티 Pathobiology학과에 대한 준회원 딘, 베티 건강 과학 센터, 오클라호마 주립 대학에 의해 지원되었다. 연구는 정부의 드 Ciencia 전자 Innovación, 스페인 (프로젝트 BFU2008-01244/BMC), JF에 CSIC 교내 프로젝트 PA1002451에 의해 후원 되었음 : 월터 R. Sitlington는 KMK, CVHS 2,009 RAC 부여 OAES 음식 동물 연구를위한 의자를 둘러 싸인 동물 건강 자금과 USDA, 국가 연구 이니셔티브 경쟁 그랜트 번호 2007-04613.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
RT-PCR 시스템 액세스PromegaA1250
Purelink PCR 정제 키트InvitrogenK3100-02
메가스크립트 RNAi 키트AmbionAM1626M
레드 치과 왁스전자 현미경 과학72674
플라스틱 컵, 1.25oz 및 뚜껑Solo Cup Company, Urbana Ill.
미세 집게전자 현미경 과학다양한
인슐린 주사기Monoject½ 장착; ", 29 게이지 바늘
Hamilton 주사기Hamilton701SN,33/.375”/45DGR맞춤형
TriReagentSigma93289
iScript One-Step RT-PCR Kit with SYBR GreenBio-Rad170-8892
Real-time PCR detection systemBio-RadMultiple참조 http:// www.bio-rad.com/

References

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,
  1. Overview: Ticks as vectors of pathogens that cause disease in humans and animals. Front. Biosci. 13, 6938-6946 (2008).">de la Fuente, J. Overview: Ticks as vectors of pathogens that cause disease in humans and animals. Front. Biosci. 13, 6938-6946 (2008).
  2. mosquito control-Lessons from the past, solutions for the future. Vet. Parasitol. 132, 205-215 (2005).">Peter, R. J. mosquito control-Lessons from the past, solutions for the future. Vet. Parasitol. 132, 205-215 (2005).
  3. Systematics and evolution of ticks with a list of valid genus and species names. Parasitol. 129, S15-S36 (2004).">Barker, S. C., Murrell, A. Systematics and evolution of ticks with a list of valid genus and species names. Parasitol. 129, S15-S36 (2004).
  4. Tick control: Thoughts on a research agenda. Vet. Parasitol. 138, 161-168 (2006).">Willadsen, P. Tick control: Thoughts on a research agenda. Vet. Parasitol. 138, 161-168 (2006).
  5. Strategies for development of vaccines for control of ixodid tick species. Parasite Immunol. 28, 275-283 (2006).">de la Fuente, J., Kocan, K. M. Strategies for development of vaccines for control of ixodid tick species. Parasite Immunol. 28, 275-283 (2006).
  6. Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature. 391, 806-811 (1998).">Fire, A. Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature. 391, 806-811 (1998).
  7. RNA interference: traveling in the cell and gaining functions. Trends Genet. 19, 39-46 (2003).">Cerutti, H. RNA interference: traveling in the cell and gaining functions. Trends Genet. 19, 39-46 (2003).
  8. RNA silencing in Drosophila. FEBS Lett. 579, 5940-5949 (2005).">Kavi, H. H. RNA silencing in Drosophila. FEBS Lett. 579, 5940-5949 (2005).
  9. Revealing the world of RNA interference. Nature. 431, 338-342 (2004).">Mello, C. C., Conte, D. J. r Revealing the world of RNA interference. Nature. 431, 338-342 (2004).
  10. RNA interference and potential applications. Curr. Top. Med. Chem. 6, 901-911 (2006).">Zhou, D. RNA interference and potential applications. Curr. Top. Med. Chem. 6, 901-911 (2006).
  11. Application of RNA interference in tick salivary gland research. J. Biomol. Tech. 16, 297-305 (2005).">Ramakrishnan, V. G. Application of RNA interference in tick salivary gland research. J. Biomol. Tech. 16, 297-305 (2005).
  12. RNA interference: applicability in tick research. Exp. Appl. Acarol. 28, 89-96 (2002).">Aljamali, M. N. RNA interference: applicability in tick research. Exp. Appl. Acarol. 28, 89-96 (2002).
  13. RNA interference in ticks: a study using histamine binding protein dsRNA in the female tick Amblyomma americanum. Insect. Mol. Biol. 12, 299-305 (2003).">Aljamali, M. N. RNA interference in ticks: a study using histamine binding protein dsRNA in the female tick Amblyomma americanum. Insect. Mol. Biol. 12, 299-305 (2003).
  14. RNA interference for the study and genetic manipulation of ticks. Trends Parasitol. 23, 427-433 (2007).">de la Fuente, J. RNA interference for the study and genetic manipulation of ticks. Trends Parasitol. 23, 427-433 (2007).
  15. Functional genomic studies of tick cells in response to infection with the cattle pathogen, Anaplasma marginale. Genomics. 90, 712-722 (2007).">de la Fuente, J. Functional genomic studies of tick cells in response to infection with the cattle pathogen, Anaplasma marginale. Genomics. 90, 712-722 (2007).
  16. Identification and characterization of Rhipicephalus (Boophilus) microplus candidate protective antigens for the control of cattle tick infestations. Parasitol. Res. 106, 471-479 (2010).">AlmazäN, C. Identification and characterization of Rhipicephalus (Boophilus) microplus candidate protective antigens for the control of cattle tick infestations. Parasitol. Res. 106, 471-479 (2010).
  17. Identification of protective antigens by RNA interference for control of the lone star tick, Amblyomma americanum. Vaccine. 28, 1786-1795 (2010).">de la Fuente, J. Identification of protective antigens by RNA interference for control of the lone star tick, Amblyomma americanum. Vaccine. 28, 1786-1795 (2010).
  18. Differential expression of genes in salivary glands of male Rhipicephalus (Boophilus) microplus in response to infection with Anaplasma marginale. BMC Genomics. 11, 186-186 (2010).">Zivkovic, Z. Differential expression of genes in salivary glands of male Rhipicephalus (Boophilus) microplus in response to infection with Anaplasma marginale. BMC Genomics. 11, 186-186 (2010).
  19. Reduction of tick infections with Anaplasma marginale and A. phagocytophilum by targeting the tick protective antigen subolesin. Parasitol. Res. 100, 85-91 (2006).">de la Fuente, J. Reduction of tick infections with Anaplasma marginale and A. phagocytophilum by targeting the tick protective antigen subolesin. Parasitol. Res. 100, 85-91 (2006).
  20. Disruption of Ixodes scapularis anticoagulation by using RNA interference. Proc. Natl. Acad. Sci U.S.A. 101, 1141-1146 (2004).">Narasimhan, S. Disruption of Ixodes scapularis anticoagulation by using RNA interference. Proc. Natl. Acad. Sci U.S.A. 101, 1141-1146 (2004).
  21. RNA interference screening in ticks for identification of protective antigens. Parasitol. Res. 96, 137-141 (2005).">de la Fuente, J. RNA interference screening in ticks for identification of protective antigens. Parasitol. Res. 96, 137-141 (2005).
  22. The tick protective antigen, 4D8, is a conserved protein involved in modulation of tick blood ingestion and reproduction. Vaccine. 24, 4082-4095 (2006).">de la Fuente, J. The tick protective antigen, 4D8, is a conserved protein involved in modulation of tick blood ingestion and reproduction. Vaccine. 24, 4082-4095 (2006).
  23. Synergistic effect of silencing the expression of tick protective antigens 4D8 and Rs86 in Rhipicephalus sanguineus by RNA interference. Parasitol. Res. 99, 108-113 (2006).">de la Fuente, J. Synergistic effect of silencing the expression of tick protective antigens 4D8 and Rs86 in Rhipicephalus sanguineus by RNA interference. Parasitol. Res. 99, 108-113 (2006).
  24. Autocidal control of ticks by silencing of a single gene by RNA interference. Biochem. Biophys. Res. Commun. 344, 332-338 (2006).">de la Fuente, J. Autocidal control of ticks by silencing of a single gene by RNA interference. Biochem. Biophys. Res. Commun. 344, 332-338 (2006).
  25. Bm86, Bm91 and subolesin, in the silencing of the tick protective antigens. Int. J. Parasitol. 37, 653-662 (2007).">Nijhof, A. M. Bm86, Bm91 and subolesin, in the silencing of the tick protective antigens. Int. J. Parasitol. 37, 653-662 (2007).
  26. Silencing of the defensin, varisin, in male Dermacentor variabilis by RNA interference results in reduced Anaplasma marginale infections. Exp. Appl. Acarol. 46, 17-28 (2008).">Kocan, K. M. Silencing of the defensin, varisin, in male Dermacentor variabilis by RNA interference results in reduced Anaplasma marginale infections. Exp. Appl. Acarol. 46, 17-28 (2008).
  27. Evidence of the role of tick subolesin in gene expression. BMC Genomics. 9, 372-372 (2008).">de la Fuente, J. Evidence of the role of tick subolesin in gene expression. BMC Genomics. 9, 372-372 (2008).
  28. The impact of RNA interference of the subolesin and voraxin genes in male Amblyomma hebraeum (Acari: Ixodidae) on female engorgement and oviposition. Exp. Appl. Acarol. 47, 71-86 (2009).">Smith, A. The impact of RNA interference of the subolesin and voraxin genes in male Amblyomma hebraeum (Acari: Ixodidae) on female engorgement and oviposition. Exp. Appl. Acarol. 47, 71-86 (2009).
  29. Tick subolesin is an ortholog of the akirins described in insects and vertebrates. Dev. Comp. Immunol. 33, 612-617 (2009).">Galindo, R. C. Tick subolesin is an ortholog of the akirins described in insects and vertebrates. Dev. Comp. Immunol. 33, 612-617 (2009).
  30. Conservation and immunogenicity of the mosquito ortholog of the tick protective antigen, subolesin. Parasitol. Res. 105, 97-111 (2009).">Canales, M. Conservation and immunogenicity of the mosquito ortholog of the tick protective antigen, subolesin. Parasitol. Res. 105, 97-111 (2009).
  31. Silencing of genes involved in Anaplasma marginale-tick interactions affects the pathogen developmental cycle in Dermacentor variabilis. BMC Dev. Biol. 9, 42-42 (2009).">Kocan, K. M. Silencing of genes involved in Anaplasma marginale-tick interactions affects the pathogen developmental cycle in Dermacentor variabilis. BMC Dev. Biol. 9, 42-42 (2009).
  32. Subolesin expression in response to pathogen infection in ticks. BMC Immunol. 11, 7-7 (2010).">Zivkovic, Z. Subolesin expression in response to pathogen infection in ticks. BMC Immunol. 11, 7-7 (2010).
  33. Functional genomics tool: gene silencing in Ixodes scapularis eggs and nymphs by electroporated dsRNA. BMC Biotechnol. 10, 1-1 (2010).">Karim, S. Functional genomics tool: gene silencing in Ixodes scapularis eggs and nymphs by electroporated dsRNA. BMC Biotechnol. 10, 1-1 (2010).
  34. Transovarial silencing of the subolesin gene in three-host ixodid tick species after injection of replete females with subolesin dsRNA. Parasitol. Res. 100, 1411-1415 (2007).">Kocan, K. M. Transovarial silencing of the subolesin gene in three-host ixodid tick species after injection of replete females with subolesin dsRNA. Parasitol. Res. 100, 1411-1415 (2007).
  35. Targeting the tick-pathogen interface for novel control strategies. Front. Biosci. 13, 6947-6956 (2008).">de la Fuente, J. Targeting the tick-pathogen interface for novel control strategies. Front. Biosci. 13, 6947-6956 (2008).
  36. Evidence of a tick RNAi pathway by comparative genomics and reverse genetics screen of targets with known loss-of-function phenotypes in Drosophila. BMC Mol. Biol. 10, 26-26 (2009).">Kurscheid, S. Evidence of a tick RNAi pathway by comparative genomics and reverse genetics screen of targets with known loss-of-function phenotypes in Drosophila. BMC Mol. Biol. 10, 26-26 (2009).

Reprints and Permissions

Request permission to reuse the text or figures of this JoVE article

Request Permission

Tags

RNA InterferenceTick Gene SilencingDouble Stranded RNAReal time RT PCRTick InjectionHumidity ChamberTick FeedingSalivary Gland DissectionGene Expression AnalysisTick Biology

Related Articles